Application of overexpressing Nudt12 in preparing a drug for treating acute myocardial infarction

Abstract

The present invention belongs to the field of biomedicine, and particularly relates to the application of overexpressing Nudt12 in the preparation of drugs for treating acute myocardial infarction. The present invention discloses the application of nucleoside diphosphate-linked moiety X motif 12 (Nudt12) in the preparation of drugs for treating acute myocardial infarction. By establishing a model of apoptosis induced by ischemia and hypoxia in neonatal mouse cardiomyocytes and a model of acute myocardial infarction induced by ligation of the left anterior descending coronary artery in mice, the present invention finds that after overexpression of Nudt12, it can significantly reduce the oxidative stress and apoptosis level of cardiomyocytes under ischemia and hypoxia conditions, increase the synthesis of ATP, enhance the anti-apoptosis ability of cardiomyocytes, significantly reduce myocardial fibrosis and the area of myocardial infarction after myocardial infarction, maintain the contraction of cardiomyocytes, and improve the cardiac function of mice with myocardial infarction. The present invention provides a new target and strategy for the clinical diagnosis and treatment of heart failure caused by acute myocardial infarction.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and particularly relates to the application of overexpressed nucleoside diphosphate linked to X-type motif 12 (Nudt12) in the preparation of drugs for treating acute myocardial infarction. Background Art

[0002] Acute myocardial infarction (AMI) is myocardial necrosis caused by acute and persistent ischemia and hypoxia of the coronary artery. Clinically, there is often severe and persistent retrosternal pain that cannot be completely relieved by rest and nitrates, accompanied by increased serum myocardial enzyme activity and progressive electrocardiogram changes. It can be complicated by arrhythmia, shock or heart failure, and often endangers life. During the development of AMI, due to vascular occlusion leading to cardiac ischemia and hypoxia, the cardiac energy metabolism and mitochondrial structure and function are abnormal, and finally the energy metabolism pattern of the failing heart changes, that is, the utilization of glucose increases and the utilization of fatty acids decreases. The metabolic state changes from aerobic metabolism to anaerobic glycolysis before, and a large amount of lactic acid is produced, leading to myocardial cell acidosis and aggravating cardiac remodeling and fibrosis after AMI. More and more evidence shows that myocardial cell energy metabolism disorder is not only one of the important mechanisms for the early reduction of contractility in heart failure, but also an important factor for myocardial fibrosis and the reduction of myocardial cell number after infarction. Therefore, improving myocardial energy metabolism and regulating the function of failing myocardium have become a new target for heart failure treatment. Currently, the treatment concept of heart failure is also changing, from the traditional improvement of hemodynamics and inhibition of excessive activation of neuroendocrine to the beginning of paying attention to myocardial energy metabolism therapy. By improving the energy metabolism of the heart, myocardial cells can obtain more energy substances, relieve the "hungry" state of the heart, and improve the function of the failing myocardium.

[0003] The energy starvation hypothesis points out that energy deficiency is the fundamental cause of myocardial remodeling. Therefore, the solution of energy metabolism problems can further prevent myocardial remodeling. Therefore, energy metabolism therapy shows great potential in acute myocardial infarction. Currently, angiotensin-converting enzyme inhibitors, angiotensin II receptor blockers, β-blockers, etc. are conventional drugs for heart failure, but their curative effects on heart failure patients are poor. Therefore, it is urgent to find new treatment means to improve myocardial energy metabolism.

[0004] At the 5' end of most eukaryotic cell mRNAs, there is an initiation structure of trans-7-methylguanosine triphosphate (m7Gppp), which helps maintain the stability of mRNA, coordinates the transport of mRNA from the nucleus to the cytoplasm, and promotes the binding of ribosomes and translation initiation factors in protein biosynthesis. In recent years, with the continuous development of research, a new covalent modification structure at the 5' end of mRNA has been detected in multiple species, including eukaryotes, prokaryotes, and even viruses, namely (reduced) nicotinamide adenine dinucleotide (Nicotinamide adenine dinucleotide, NAD + / NADH). The NAD + / NADH capping modification at the 5' end of transcripts has the effect of stabilizing RNA and protecting it from degradation by ribonucleases. In mammals, the hydrolysis of NAD + / NADH capping modification is mainly affected by the decapping of nucleoside diphosphate linked to X-type motif 12 (Nudt12). The proteins encoded by this part of RNA are mainly involved in signal transduction, transcription-related, protein translation, cell cycle, oxidative stress, mitochondria-related (including mitochondrial oxidative phosphorylation, mitochondrial composition, mitochondrial respiratory chain activity, pyruvate dehydrogenase complex activity, mitochondrial complex I, III, IV, V defects, etc.), photosynthesis, and abiotic stress responses such as cold, heat, drought, salt, nutrient deficiency, etc. However, there is no report on the role of Nudt12 in improving energy metabolism in acute myocardial infarction. Summary of the Invention

[0005] To solve the above problems, the present invention established a model of apoptosis induced by ischemia and hypoxia in neonatal mouse cardiomyocytes and a model of acute myocardial infarction induced by ligation of the left anterior descending coronary artery in mice. Using biological techniques such as MitoSOX mitochondrial superoxide detection, TUNEL apoptosis detection, ATP synthesis detection, and mouse echocardiography and section staining, the apoptosis of cardiomyocytes, energy metabolism, and the cardiac function and myocardial fibrosis of mice were evaluated. It was found that after overexpression of Nudt12, the oxidative stress and apoptosis levels of cardiomyocytes under ischemic and hypoxic conditions could be significantly reduced, the synthesis of ATP could be increased, the anti-apoptotic ability of cardiomyocytes could be enhanced, and the myocardial fibrosis and the area of myocardial infarction after myocardial infarction could be significantly reduced, maintaining the contraction of cardiomyocytes and improving the cardiac function of mice with myocardial infarction. The present invention provides a new target and strategy for the clinical diagnosis and treatment of heart failure caused by acute myocardial infarction.

[0006] In the present invention, the cloning site refers to the restriction endonuclease cleavage site, which is the insertion site of exogenous DNA.

[0007] On the one hand, the present invention provides the use of the Nudt12 gene in the preparation of a drug for treating acute myocardial infarction, and the drug includes a vector overexpressing the Nudt12 gene.

[0008] Specifically, the acute myocardial infarction includes acute ST-segment elevation myocardial infarction, acute non-ST-segment elevation myocardial infarction, ischemic cardiomyopathy, and heart failure.

[0009] Specifically, the drug is used to enhance the anti-apoptotic ability of cardiomyocytes or improve myocardial fibrosis.

[0010] More specifically, the vector can be a viral vector, preferably an adenovirus vector or an adeno-associated virus vector.

[0011] Preferably, the adenovirus is an adenovirus that highly expresses Nudt12.

[0012] More specifically, the inserted sequence of the viral vector is SEQ ID NO.1.

[0013] The cloning site of the viral vector is KpnI.

[0014] Specifically, the drug further includes pharmaceutically acceptable excipients.

[0015] More specifically, the pharmaceutically acceptable excipients include, but are not limited to, one or more of mannitol, sucrose, sodium chloride, magnesium chloride, polysorbate 80, glycerol, and N-(2-hydroxyethyl)piperazine-N'-2-ethanesulfonic acid.

[0016] Specifically, the dosage form of the drug can be an injection.

[0017] More specifically, the injection can be one of an aqueous injection, an oily injection, or a powder injection.

[0018] On the other hand, the present invention provides a drug for treating acute myocardial infarction, and the drug includes a viral vector overexpressing the Nudt12 gene.

[0019] Specifically, the vector is an adenovirus vector or an adeno-associated virus vector.

[0020] Specifically, the inserted sequence on the viral vector is SEQ ID NO.1, and the cloning site is KpnI.

[0021] Specifically, the acute myocardial infarction includes acute ST-segment elevation myocardial infarction, acute non-ST-segment elevation myocardial infarction, ischemic cardiomyopathy, and heart failure.

[0022] Specifically, the drug is used to enhance the anti-apoptotic ability of cardiomyocytes or improve myocardial fibrosis.

[0023] Specifically, the drug further comprises pharmaceutically acceptable excipients.

[0024] More specifically, the pharmaceutically acceptable excipients include, but are not limited to, one or more of mannitol, sucrose, sodium chloride, magnesium chloride, polysorbate 80, glycerol, and N-(2-hydroxyethyl)piperazine-N'-2-ethanesulfonic acid.

[0025] Specifically, the dosage form of the drug can be an injection.

[0026] More specifically, the injection can be one of aqueous injection, oily injection, or powder injection.

[0027] The technical effects achieved by the present invention: After Nudt12 overexpression, it can significantly reduce the oxidative stress and apoptosis levels of cardiomyocytes under ischemic and hypoxic conditions, increase the synthesis of ATP, enhance the anti-apoptotic ability of cardiomyocytes, significantly reduce the myocardial fibrosis and the area of myocardial infarction after myocardial infarction, maintain the contraction of cardiomyocytes, and improve the cardiac function of myocardial infarction mice. Brief Description of the Drawings

[0028] Figure 1 NAD + / NADH cap modification and Nudt12 expression levels in neonatal mouse ventricular myocytes (NMVMs) and adult mouse cardiac myocytes (AMCMs) induced by ischemia and hypoxia; wherein, A shows the detection of NAD + / NADH cap modification levels in NMVMs induced by ischemia and hypoxia and NMVMs under normoxia using NAD cap detection and quantitation (NAD-capQ) technology; B-E show the detection of Nudt12 mRNA and protein expression levels in NMVMs, AMCMs induced by ischemia and hypoxia, and NMVMs, AMCMs under normoxia using RT-qPCR and Western blot.

[0029] Figure 2 NAD + / NADH cap modification and Nudt12 expression levels in ischemic myocardial tissues in an acute myocardial infarction model induced by ligation of the left anterior descending branch of the coronary artery in mice; wherein, A shows the detection of NAD in infarct border zone tissues and sham operation group tissues at 1 day, 3 days, and 7 days after AMI using NAD-capQ technology + / NADH cap modification level; B-D: Detection of the mRNA and protein expression levels of Nudt12 in the tissue at the infarct border zone on the 1st, 3rd, and 7th days after AMI and in the sham operation group by RT-qPCR and Western blot.

[0030] Figure 3 Effect of overexpressing Nudt12 on the function of NMVMs after ischemia and hypoxia; among them, A is the protein expression level; B is the mRNA expression level; C is NAD + / NADH cap modification level.

[0031] Figure 4 Effect of overexpressing Nudt12 on the function of NMVMs after ischemia and hypoxia; among them, A is the mitochondrial morphology diagram; B is the mitochondrial reactive oxygen species level; C is the mitochondrial membrane potential change diagram.

[0032] Figure 5 Effect of overexpressing Nudt12 on the function of NMVMs after ischemia and hypoxia; among them, A is the mitochondrial ATP content change diagram; B-F are the cardiomyocyte apoptosis level diagrams.

[0033] Figure 6 Effect of overexpressing Nudt12 on the cardiac function after ligation of the left anterior descending branch of the coronary artery in mice; among them, A is the Western blot detection picture; B is the protein expression level; C is the mRNA expression level; D is NAD + / NADH cap modification level.

[0034] Figure 7 Diagram of the changes in the mechanical performance indexes of cardiomyocytes after ligation of the left anterior descending branch of the coronary artery in mice by overexpressing Nudt12.

[0035] Figure 8 Diagram of the changes in the cardiac function indexes after ligation of the left anterior descending branch of the coronary artery in mice by overexpressing Nudt12.

[0036] Figure 9 Diagram of the fibrosis degree of the myocardial tissue after ligation of the left anterior descending branch of the coronary artery in mice by overexpressing Nudt12; among them, A is HE staining; B is Masson staining.

[0037] Figure 10 Diagram of the cardiac function after ligation of the left anterior descending branch of the coronary artery in mice by overexpressing Nudt12; A is the echocardiogram; B is the diagram of the changes in the cardiac function indexes.

[0038] Figure 11 Adenovirus vector map.

[0039] Figure 12 Adeno-associated virus vector map. Specific implementation manner

[0040] The present invention will be further described in detail below in conjunction with specific embodiments. The following embodiments are not used to limit the present invention, but only to illustrate the present invention. Unless otherwise specified, the experimental methods used in the following embodiments are those without specific conditions, which are usually carried out under conventional conditions. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0041] Specific Pathogen Free (SPF)-level C57BL / 6J male mice (8 weeks old, weighing about 25 g) required for the experiment were purchased from Hangzhou Qizhen Laboratory Animal Technology Co., Ltd., and SPF-level C57BL / 6J neonatal mice, regardless of gender (1-3 days old), were purchased from Shanghai Jiesijie Laboratory Animal Center. The animal handling and experimental operations involved in this study strictly complied with the guidelines for the feeding and use of laboratory animals and were approved by the Animal Ethics Committee of Fudan University.

[0042] 1 Experimental method

[0043] 1.1 Extraction and culture of neonatal mouse ventricular myocytes (NMVMs)

[0044] 1.1.1 Preparation of main solutions and related buffers

[0045] Preparation of 50 mL of 10% complete medium: 44.5 mL of high-glucose DMEM (Gibco, 11995-065), 0.5 mL of P / S double antibody (Biological Industries, 03-031-1BCS), and 5 mL of fetal bovine serum (FBS, Jiangsu Enmoase Biotechnology Co., Ltd., CCS30009.02) were fully stirred and mixed, then filtered and dispensed into 50 mL centrifuge tubes. After making marks, they were stored at 4°C for standby.

[0046] 1.1.2 Plating of laminin

[0047] The specific steps are as follows:

[0048] (1) Calculate the required amount of laminin (Roche, 11243217001) according to the number of neonatal mice (taking 50 neonatal mice as an example).

[0049] (2) One well of a 6-well plate requires 1 mL of Laminin diluent. Taking two 6-well plates as an example, there are a total of 12 wells, and 12 mL of Laminin diluent is required. Prepare 12 mL of PBS, mix in 120 μL of Laminin stock solution (prepared at a ratio of 1:100), and mix well by vortexing.

[0050] (3) Aspirate the prepared Laminin into the well plate using a pipette and place it in an incubator at 37 °C for more than 2 hours.

[0051] (4) When the liquid has evaporated, a thin gel-like substance remains at the bottom of the well plate, and at this point, the plating is complete.

[0052] 1.1.3 Primary extraction of NMVMs

[0053] The specific steps are as follows:

[0054] (1) After the Laminin plating is completed, prepare C57 mouse neonatal mice aged 1 - 3 days in a sterile medicine bowl. Wear sterile gloves.

[0055] (2) Prepare three 10-cm culture dishes and add pre-cooled PBS to the culture dishes. Prepare one sterile medicine bowl and add an appropriate amount of 75% ethanol.

[0056] (3) Disinfect the neonatal mice by soaking them in 75% ethanol, cut open the left thoracic cavity, squeeze out the heart, and cut out the entire heart (disinfect and cut one neonatal mouse at a time to prevent death due to hypothermia caused by ethanol evaporation).

[0057] (4) Then wash three times in turn in the three 10-cm culture dishes. If there is blood in the heart cavity, the heart can be squeezed through forceps.

[0058] (5) Transfer all the heart tissues into a 1.5-mL EP tube, add a few drops of PBS solution, and cut the heart tissues in the EP tube with scissors. Cut until no visible tissue blocks larger than about 1 mm are left, which takes about 2 minutes.

[0059] (6) Transfer the minced heart tissues into a 15-mL sterile centrifuge tube, add 3 mL of PBS solution, pipette the heart tissues, let it stand, and discard the supernatant after the tissues have precipitated. Repeat this step 2 - 3 times until the supernatant is relatively clean and clear (thoroughly wash away the residual blood in the tissues to prevent a large number of blood cells from being contained in the extracted cardiomyocytes. In addition, the presence of serum in the blood will affect the digestion ability of type II collagenase in the subsequent steps).

[0060] (7) Add 3 mL of type II collagenase (Worthington Biochemical, LS004176) at 0.08% (m / v, filtered through a 0.22 μm filter after dissolving in PBS), pipette to mix well, and place in a 37°C constant temperature water bath for digestion for 2.5 min (it is best to place the 15 mL centrifuge tube at a certain angle to increase the contact area with the enzyme and facilitate sufficient digestion).

[0061] (8) At the end of the first digestion, transfer the 15 mL centrifuge tube to the laminar flow hood, pipette the cardiac tissue several times (to let the cells digested from the tissue surface fall off into the digestion solution), let it stand, wait for the tissue to precipitate, aspirate the supernatant into a 50 mL sterile centrifuge tube, and add 3 mL of 10% complete medium to terminate the digestion. Repeat steps (7) and (8) until the tissue presents white (no flesh color) flocculent substances, then the digestion can be terminated. It is probably necessary to repeat the digestion 8 to 10 times.

[0062] (9) Filter the collected supernatant through a 100 μm cell strainer, centrifuge at 1000 rpm at room temperature for 5 min, and discard the supernatant.

[0063] (10) After adding 8 mL of 10% complete medium, pipette to mix well, and add the obtained cell suspension to a 10 cm culture dish for differential attachment.

[0064] (11) Clean the workbench and irradiate with ultraviolet light. After 90 min, transfer the medium in the 10 cm culture dish (the medium contains non-attached cardiomyocytes and the bottom of the culture dish is attached fibroblasts) to a 15 mL / 50 mL centrifuge tube, and add 2 - 3 mL of complete medium to the 10 cm culture dish. Tilt the dish up and down, left and right (the movement must be gentle, and do not pipette with a pipette, otherwise the attached fibroblasts will be washed down) to completely rinse the remaining cardiomyocytes in the dish, aspirate the complete medium into the centrifuge tube, and repeat the rinsing process once more. Discard the 10 cm culture dish (for attached fibroblasts).

[0065] (12) Take out the 6-well plate coated with Laminin, discard the PBS, pipette the cardiomyocyte suspension collected in the centrifuge tube well, calculate the cell suspension for each well according to the number of wells in the 6-well plate (it is best not to exceed 3 mL, if less than 2 mL, supplement with complete medium after seeding the plate), use a 1 mL pipette to evenly seed the cell suspension into the 6-well plate, and gently shake the 6-well plate in a "rice" shape to make the cell seeding uniform. Place the 6-well plate back into the 37°C constant temperature incubator (in all the steps of pipetting the cell suspension with a pipette above, do not pipette violently and quickly during the operation, it must be slow suction and slow blowing).

[0066] (13) Replace the medium of cardiomyocytes after 48 h. Intervention can be started after changing the medium.

[0067] 1.2 Isolation and culture of adult mouse cardiac myocytes (AMCMs)

[0068] 1.2.1 Preparation of main solutions and related buffers

[0069] (1) Preparation of 100×dimethylglyoxime (=1 mol / L): Dissolve 1.01 g of dimethylglyoxime (BDM, Sigma-Aldrich, B0753-100G) in 10 mL of ultrapure water. Shake in a 37°C water bath to accelerate dissolution. After dissolution, aliquot 500 μL into 1.5 mL EP tubes and store at -20°C for later use.

[0070] (2) Preparation of 5% bovine serum albumin (BSA): Dissolve 250 μg of BSA (Shanghai Viao Biotechnology Co., Ltd., WH1044) in 5 mL of PBS. Vortex to dissolve after preparation and use it freshly on the same day.

[0071] (3) Preparation of 50 mL of cell culture media (CM): 47 mL of 199 medium (Gibco, 12340-030), 1 mL of 5% BSA, 0.5 mL of 100×BDM, 0.5 mL of 100×ITS (ITS is a mixture of human recombinant insulin, human transferrin, and sodium selenite, Sigma-Aldrich, I3146-5ML), 0.5 mL of chemically defined lipid concentrate (CD lipid is a concentrated fat emulsion, Gibco, 11905031), 0.5 mL of P / S double antibody. Mix the medium thoroughly with a 20 mL syringe, filter through a 0.22 μm filter, and aliquot into 50 mL centrifuge tubes for storage at 4°C for later use.

[0072] (4) Preparation of 50 mL of plating media (PM): 46.5 mL of M199 (199 medium), 2.5 mL of FBS, 0.5 mL of 100×BDM, 0.5 mL of P / S double antibody. Mix the medium thoroughly with a 20 mL syringe, filter through a 0.22 μm filter, and aliquot into 50 mL centrifuge tubes for storage at 4°C for later use.

[0073] (5) Preparation of 100×Collagenase and 1000×Protease XIV stock solutions (=50 mg / mL): Dissolve 500 mg of Collagenase II (Worthington Biochemical, LS004176) and Collagenase IV (Worthington Biochemical, LS004188) separately in 10 mL of ultrapure water, vortex and mix well, centrifuge, and dispense 500 μL per tube into 1.5 mL EP tubes. Dissolve 50 mg of Protease XIV (Sigma-Aldrich, P5147) in 1 mL of ultrapure water, vortex and mix well, centrifuge, and dispense 50 μL per tube into 200 μL EP tubes. Store the above three kinds of enzymes in aliquots at -80 °C for later use.

[0074] (6) Preparation of EDTA buffer (Solution E): 130 mmol / L sodium chloride (Shanghai Lingfeng Chemical Reagent Co., Ltd., 223102129), 5 mmol / L potassium chloride (Shanghai Aladdin Biochemical Technology Co., Ltd., P112143-100g), 0.5 mmol / L sodium dihydrogen phosphate, 10 mmol / L 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (Beijing Solarbio Science & Technology Co., Ltd., H8090-100g), 10 mmol / L glucose (Sigma-Aldrich, V900392-500G), 10 mmol / L BDM, 10 mmol / L taurine (Sinopharm Chemical Reagent Co., Ltd., 62021436), 5 mmol / L ethylenediaminetetraacetic acid (Shanghai Sangon Biotech Co., Ltd., A100322-0500). Make up to 1 L with ultrapure water, stir well, adjust the pH to 7.8 with sodium hydroxide, filter through a 0.22 μm filter, and dispense into 50 mL centrifuge tubes. Store at 4 °C for later use and it can be used within 1 month.

[0075] (7) Preparation of Perfusion buffer (Solution P): 130 mmol / L sodium chloride, 5 mmol / L potassium chloride, 0.5 mmol / L sodium dihydrogen phosphate, 10 mmol / L 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, 10 mmol / L glucose, 10 mmol / L BDM, 10 mmol / L taurine, 1 mmol / L magnesium chloride (Shanghai Aladdin Biochemical Technology Co., Ltd., M113687-250g). Make up to 1 L with ultrapure water, stir well, adjust the pH to 7.8 with sodium hydroxide, filter through a 0.22 μm filter, and dispense into 50 mL centrifuge tubes. Store at 4 °C for later use and it can be used within 1 month.

[0076] (8) Preparation of 50 mL Collagenase buffer: 49 mL of Solution P, 0.5 mL of 100× Collagenase II, 0.5 mL of 100× Collagenase IV, 50 μL of 1000× Protease XIV. Mix well by pipetting, filter through a 0.22 μm filter, and dispense into 50 mL centrifuge tubes. Preheat in a 37°C water bath for later use. Prepare and use it on the same day.

[0077] (9) Preparation of the digestion termination solution (i.e., 5% FBS): 47.5 mL of Solution P, 2.5 mL of FBS. Mix well by pipetting, filter through a 0.22 μm filter, and dispense into 50 mL centrifuge tubes. Prepare and use it on the same day.

[0078] (10) Preparation of 10 mL (calcium recovery solution): Calcium recovery solution 1 (7.5 mL of Solution P + 2.5 mL of CM), calcium recovery solution 2 (5 mL of Solution P + 5 mL of CM), calcium recovery solution 3 (2.5 mL of Solution P + 7.5 mL of CM). Mix well by pipetting. The total volume of each tube of calcium recovery solution is 10 mL. Prepare and use it on the same day.

[0079] 1.2.2 Extraction of AMCMs

[0080] (1) Plate laminin. The specific experimental operation steps are the same as in 1.1.2.

[0081] (2) Preheat Solution P, Solution E, and the prepared Collagenase buffer in a 37°C water bath in advance.

[0082] (3) Anesthetize each mouse with 0.2 mL of 1% sodium pentobarbital.

[0083] (4) Draw 17 mL of Solution E into a 20 mL syringe. Attach a 1 mL needle. Preheat on a heating pad.

[0084] (5) Draw 10 mL of Solution P into a 10 mL syringe. Attach a 1 mL needle. Preheat on a heating pad.

[0085] (6) Take out the anesthetized mouse, fix it with a foam board, and spray 75% ethanol.

[0086] (7) Cut open the chest skin of the mouse, expand the wound, and expose the heart. Cut the main blood vessel descending from the heart.

[0087] (8) Inject 7 mL of Solution E into the right ventricle. Control the depth of the needle to prevent piercing the interventricular septum. Observe the lungs filling with water and expanding, turning white in color, and a large amount of bloody water flowing out from the thoracic cavity (inject slightly faster, about 1 minute in duration, to prevent blood coagulation in the left cardiac cavity).

[0088] (9) Clamp the aortic arch with a curved hemostat, as far away from the heart base as possible, cut the connection, remove the heart, place it in a 6-cm Petri dish, and use a pipette to aspirate a small amount of Solution E to moisten and rinse the surface of the heart. Align the needle at a position 2 mm above the heart base and slowly inject 10 mL of Solution E into the left ventricle. At this time, the injection should be slow, lasting about 7 minutes. Observe the filling degree of the left and right auricles, especially the right auricle. If the right auricle is well filled, it indicates that successful in vitro perfusion has been established.

[0089] (10) Insert the needle into the original hole of the left ventricle and inject 3 mL of Solution P. The injection should be slow, lasting about 3 minutes.

[0090] (11) Replace the 6-cm Petri dish. Insert the needle into the original hole of the left ventricle and slowly inject 15 mL of the pre-warmed enzyme mixture. After completion, aspirate the enzyme mixture from the Petri dish and repeat 2 - 3 times. The injection should be slow, and each time should last about 10 minutes.

[0091] (12) Observe the morphology of the heart. Lift the hemostat and find that the heart droops and its texture becomes soft. Transfer the heart to another new 6-cm Petri dish, cut the connection between the heart and the hemostat, and at the same time cut off the left and right auricles.

[0092] (13) Aspirate 3 mL of the enzyme mixture and place it in the dish. Use fine forceps to separate the heart into small particles. If the digestion is good, this separation process will be quite easy without a sense of tissue fiber tearing.

[0093] (14) Slowly rinse the heart particles with a pipette for 3 minutes, and try to avoid the generation of bubbles during the rinsing process.

[0094] (15) Add 5 mL of the digestion termination solution and slowly rinse the heart with a pipette to terminate the digestion.

[0095] (16) Aspirate a drop of myocardial cell solution and observe the separation status of myocardial cells under a microscope.

[0096] (17) In a 50-mL centrifuge tube, filter the heart particle suspension through a 100-μm cell strainer, transfer it to a 15-mL centrifuge tube after filtration, let it stand for 30 minutes, and then discard the supernatant.

[0097] (18) Aspirate 2 mL of Calcium Recovery Solution 1 into the centrifuge tube, resuspend it, let it stand for 10 minutes, and then discard the supernatant.

[0098] (19) Aspirate 2 mL of Calcium Recovery Solution 2 into the centrifuge tube, resuspend it, let it stand for 10 minutes, and then discard the supernatant.

[0099] (20) Aspirate 2 mL of Calcium Recovery Solution 3 into the centrifuge tube, resuspend it, let it stand for 10 minutes, and then discard the supernatant.

[0100] (21) The cardiomyocytes complete the restoration of calcium ions. According to the amount of cell precipitation, determine how many wells to plate. Each well of a 6-well plate requires 1 mL of PM, and each well of a confocal dish requires 400 μL of PM. Add the calculated total PM to a centrifuge tube, resuspend it, and obtain the extracted cardiomyocyte suspension. Spread the prepared cardiomyocyte suspension onto the Laminin plate.

[0101] (22) After culturing in a 37 °C constant temperature incubator for 2 h, take out the culture dish and replace the culture medium with pre-warmed CM.

[0102] (23) Complete the seeding of primary cardiomyocytes isolated from adult mice and prepare for other various experiments.

[0103] 1.3 Construction of an apoptosis model of cardiomyocytes induced by ischemia and hypoxia in NMVMs and AMCMs

[0104] Select neonatal mice (1 - 3 days after birth) to extract NMVMs or 8-week-old male C57BL / 6 mice weighing 18 - 25 g to extract AMCMs. Divide them into a normoxia group and an ischemia-hypoxia group according to different oxygen and culture medium conditions. Ischemia-hypoxia group: Replace the cultured NMVMs or AMCMs with ischemia buffer and place them in an anaerobic chamber (containing a mixed gas of 5% CO2, 94% N2, and 1% O2), and perform ischemia-hypoxia treatment for 12 h (for NMVMs) or 1 h (for AMCMs) in a 37 °C anaerobic dedicated incubator. Normoxia group: Replace the cultured NMVMs or AMCMs with complete culture medium and place them in a conventional 37 °C cell incubator.

[0105] Preparation of ischemia buffer: 118 mmol / L sodium chloride, 24 mmol / L sodium bicarbonate, 1.0 mmol / L sodium dihydrogen phosphate, 2.5 mmol / L calcium chloride, 1.2 mmol / L magnesium chloride, 20 mmol / L sodium lactate (Sinopharm Chemical Reagent Co., Ltd., 30168018), 16 mmol / L potassium chloride and 10 mmol / L 2-deoxy-D-glucose (Shanghai Yuanye Bio-Technology Co., Ltd., S11070). Make up to 500 mL with ultrapure water, stir well, adjust the pH to 6.2 with hydrochloric acid, filter through a 0.22 μm filter, and dispense into 50 mL centrifuge tubes for storage at 4 °C for later use, which can be used within 1 month.

[0106] 1.4 Detection of Nudt12 expression and NAD + / NADH cap modification level

[0107] Collect the NMVMs or AMCMs of the normoxia group and the ischemia-hypoxia group above, extract the total RNA (by Trizol method) and proteins of the above samples respectively, and use NAD-capQ to detect the changes in the overall modification levels of NAD + / NADH caps in NMVMs induced by ischemia-hypoxia and normoxic NMVMs. Use RT-qPCR and Western Blot to detect the changes in the mRNA and protein expression levels of Nudt12 in NMVMs, AMCMs induced by ischemia-hypoxia, and normoxic NMVMs, AMCMs. The specific steps are as follows:

[0108] 1.4.1 Preparation of protein samples

[0109] 1.4.1.1 Preparation of cell protein samples:

[0110] (1) Freshly prepare an appropriate amount of RIPA lysis buffer, and prepare it according to the volume ratio of RIPA (RIPA lysis buffer for cells (medium), Beyotime Biotechnology Co., Ltd., Jiangsu, P0013C), protease inhibitor, phosphatase inhibitor, phenylmethylsulfonyl fluoride (protease, phosphatase, phenylmethylsulfonyl fluoride triple pack, Shanghai Viao Biotechnology Co., Ltd., WB0122) of 100∶1∶1∶1.

[0111] (2) After the cardiomyocytes are treated under the corresponding conditions, wash them 2 times with PBS, suck out the residual liquid in the wells with a 200 μL pipette, add 120 μL of RIPA cell lysis buffer to each well of the 6-well plate, and place the 6-well plate on ice.

[0112] (3) Collect the cells with a cell scraper, transfer them into a 1.5 mL EP tube and make marks, and place the EP tube on ice.

[0113] (4) Go to step 1.4.1.2(4).

[0114] 1.4.1.2 Preparation of tissue protein samples:

[0115] (1) Freshly prepare an appropriate amount of RIPA lysis buffer, and prepare it according to the volume ratio of RIPA (RIPA lysis buffer for tissues (strong), Beyotime Biotechnology Co., Ltd., Jiangsu, P0013B), protease inhibitor, phosphatase inhibitor, PMSF of 100∶1∶1∶1.

[0116] (2) Take fresh or -80 °C frozen tissues and place them in a 1.5 mL EP tube (put 3 steel grinding beads in advance) and make marks. Add 120 μL of RIPA lysis buffer to every 5 mg of tissue, and place the EP tube on ice. Pre-cool the tissue grinder in advance.

[0117] (3) Put the EP tube into the tissue grinder for grinding: 60 Hz, run for 45 s, pause for 15 s, and the number of times is 15 times.

[0118] (4) Lyse on ice for 45 min, and shake every 5 min during this period to accelerate cell / tissue lysis.

[0119] (5) Centrifuge at 4°C and 12,000 rpm for 30 min, and carefully aspirate the supernatant into another new 1.5 mL EP tube.

[0120] (6) Use a BCA protein concentration assay kit (Beyotime Biotechnology Co., Ltd., Jiangsu, P0010) to measure the protein concentration.

[0121] 1.4.2 Detailed procedure of Western Blotting

[0122] (1) Wash the glass plates with dishwashing liquid, rinse with dd water, and place them on a rack to dry.

[0123] (2) Align the washed and dried long and short glass plates and place them in the rack, clamp them on both sides, and detect the sealing with dd water.

[0124] (3) Prepare the lower layer of gel according to the above method, and pour the prepared lower layer of gel along the glass plate with a pipette (fast at first and then slow) until the liquid level stops 1.8 cm below the upper edge of the short glass plate. Fill it with anhydrous ethanol for liquid sealing (place the pipette horizontally and slowly).

[0125] (4) Wait for the lower layer of gel to solidify (there is an obvious fold at the junction of ethanol and gel), about 20 min, pour off the ethanol, and blot it dry with filter paper.

[0126] (5) Prepare the upper layer of gel according to the above method, and pour the prepared upper layer of gel along the glass plate until the liquid level stops 2 mm below the upper edge of the short glass plate. Carefully insert the comb, and be sure to avoid the generation of air bubbles.

[0127] (6) Place the prepared gel plate into the electrophoresis tank, hold both ends of the comb with both hands, and gently pull out the comb with uniform force.

[0128] (7) Fill the inner and outer tanks with 1× electrophoresis buffer. Thaw the protein samples, mix them well by vortex oscillation, load the samples according to the pre-calculated volume, add 6 μL of marker to the left sample well and 3 μL of marker to the right sample well on the sample side (mark the loading order).

[0129] (8) Connect the power supply and start electrophoresis: ① Constant voltage of 60 V for 40 min; ② Constant voltage of 110 V for 60 min, and stop electrophoresis when the bromophenol blue reaches the bottom of the lower layer of gel. Take out the electrophoresis tank, recover the electrophoresis buffer, rinse the electrophoresis tank under running water to wash away the foam, and remove the glass plates (if the protein samples in each glass plate are different, be sure to make good marks).

[0130] (9)Break the ice in the washbasin, prepare 1× transfer buffer, and soak the PVDF membrane in methanol. Prepare an enamel tray, pour the transfer buffer into it, and place the transfer sandwich (including sponge pads and filter paper), forceps, gel scraping spatula, and glass plate into it. Gently pry open the glass plate with the gel scraping spatula to separate the gel, lay the gel flat on the transfer sandwich, then cover the activated PVDF membrane on the gel, and gently use the gel scraping spatula to drive away all the air bubbles between the membrane and the gel.

[0131] (10)Close the clamp and place the clamp into the transfer tank (the transfer tank is placed in a washbasin filled with ice). Pay attention to the order, make the white side of the transfer sandwich face the red side of the transfer tank, and the black side of the transfer sandwich face the black side of the transfer tank. A large amount of heat will be generated during the transfer. Place two ice boxes on the empty side of the tank and fill the tank with pre-cooled transfer buffer.

[0132] (11)Connect the power supply and start the transfer: constant current 0.3A, 80 min (the specific transfer time needs to be determined according to the molecular weight of the target protein). Pay attention to observing the voltage at this time. If the voltage is too high (>160V), it may be that the lid of the box is in poor contact with the transfer tank. If the voltage is too low, below 90V, it may be that the transfer buffer has been reused too many times. At this time, it is necessary to replace the freshly prepared 1× transfer buffer. The initial voltage is preferably between 110 - 120V.

[0133] (12)After the transfer is completed, recover the transfer buffer, take out the PVDF membrane, make a mark on the front of the membrane (cut off a corner of the membrane), wash it once with TBST for 5 min, discard the TBST, pour in 5% BSA blocking solution to cover the membrane surface, shake and block it on a shaker at room temperature for 1 h, recover the BSA (it can be reused 3 times), and wash it once with TBST for 5 min.

[0134] (13)Prepare the primary antibodies, dilute them with the primary antibody dilution solution. Most antibodies are diluted at 1:1000. Information of the primary antibodies: ① HRP-labeled β-Actin high-quality internal reference, Shandong Kangcheng Bioengineering Co., Ltd., KC-5A08, diluted 1:4000 with TBST. ② NUDT12 Polyclonal Antibody, Wuhan Sanying Biotechnology Co., Ltd., 17487-1-AP, diluted 1:1000 with the primary antibody dilution solution (Jiangsu Beyotime Biotechnology Co., Ltd., P0023A-500mL). ③ Bax Antibody, CST, USA, 2772S, diluted 1:1000 with the primary antibody dilution solution. ④ Bcl2 Polyclonal antibody, Wuhan Sanying Biotechnology Co., Ltd., 26593-1-AP, diluted 1:1000 with the primary antibody dilution solution. ⑤ Caspase 3 / p17 / p19 Polyclonalantibody, Wuhan Sanying Biotechnology Co., Ltd., 19677-1-AP, diluted 1:1000 with the primary antibody dilution solution.

[0135] (14) Cut the strip according to the molecular weight of the target protein (make the strip as wide as possible, and at most 3 proteins with different molecular weights can be cut on one membrane). Put the cut strip into the corresponding primary antibody solution and incubate overnight on a shaker at 4°C.

[0136] (15) The next day, warm it to room temperature for 30 min, recover the primary antibody, wash it 3 times with TBST, 10 min each time, and use a shaker.

[0137] (16) Incubate the target protein strip with the secondary antibody for 1 h, use a shaker. Do not incubate the β-Actin strip with the secondary antibody and it can be developed directly. Information of the secondary antibody: HRP-labeled goat anti-rabbit IgG (H+L), Shanghai Viao Biotechnology Co., Ltd., WB0177, diluted 1:4000 with TBST.

[0138] (17) After incubation, recover the secondary antibody, wash it 3 times with TBST, 10 min each time, and use a shaker.

[0139] (18) Develop and collect images: Put the strip into the Bio-Rad imaging system, dry the liquid on the membrane with filter paper, evenly add an appropriate amount of developer, and obtain the development result. Analyze the gray value of the strip using Image Lab.

[0140] 1.4.3 RNA Extraction (Trizol Method) and Purification

[0141] 1.4.3.1 Cell RNA Extraction:

[0142] (1) After the cardiomyocytes are treated under the corresponding conditions, wash them 2 times with PBS, suck the residual liquid in the wells clean with a 200 μL pipette, add 1 mL of Trizol (Gibco, 15596018) to each well of the 6-well plate, and pipette more than 10 times to collect the cells into a 1.5 mL EP tube.

[0143] (2) Go to step 1.4.3.2(3).

[0144] 1.4.3.2 Tissue RNA Extraction:

[0145] (1) Take the fresh or -80°C frozen tissue and place it in a 1.5 mL enzyme-free EP tube (put 3 enzyme-free zirconia grinding beads in advance, pick up the beads with forceps, do not touch them with your hands) and make a mark. Add 1 mL of Trizol to every 25 mg (if less than 25 mg, calculate as 25 mg) of tissue, and place the EP tube on ice. Pre-cool the grinder 20 min in advance.

[0146] (2) Put the EP tube into the tissue grinder for grinding: 60 Hz, run for 45 s, pause for 15 s, 15 times.

[0147] (3) Incubate at room temperature for 10 min with one oscillation during this period to accelerate cell / tissue lysis. Pre-cool the centrifuge in advance.

[0148] (4) Add 200 μL of chloroform (Trizol∶chloroform = 5∶1) to each RNase-free EP tube, shake vigorously for 30 s until it becomes pinkish-white and milky, then place at room temperature for 15 min, with one oscillation every 3 min during this period to facilitate the full extraction of RNA by chloroform. Centrifuge at 4°C and 12,000 rpm for 20 min. After centrifugation, the sample can be seen to be divided into three layers: the upper layer is the aqueous phase, the middle and lower layers are the organic phases, and the RNA is in the upper aqueous phase.

[0149] (5) Carefully pipette 200 μL of the upper aqueous phase into a new 1.5 mL RNase-free EP tube using a 200 μL pipette (do not aspirate any material from the middle layer, otherwise DNA contamination will occur), about 400 - 500 μL per tube. Add an equal volume of isopropanol, gently invert the EP tube up and down to mix for 30 s, then let it stand at room temperature for 10 min. Centrifuge at 4°C and 12,000 rpm for 10 min. After centrifugation, a white precipitate can be seen on the side and bottom of the tube (when centrifuging, the tail of the EP tube cap should face outwards to ensure that the precipitate in each EP tube is in the same position for easy observation). Slowly pour off the upper layer directly, leaving the white precipitate.

[0150] (6) Add 1 mL of 75% ethanol (prepared with absolute ethanol + DEPC water) along the wall of the tube, gently invert the EP tube up and down to mix for 15 s. Centrifuge at 4°C and 12,000 rpm for 5 min. After centrifugation, a white precipitate can be seen on the side and bottom of the tube (the precipitate is more obvious than before). Slowly pour off the upper layer directly, leaving the white precipitate. Use a 10 μL pipette to aspirate the remaining ethanol at the bottom and on the side wall of the EP tube (move slowly and do not aspirate the precipitate), invert the EP tube onto the filter paper and let the precipitate dry for about 10 min (observe at any time and the drying time can be shortened).

[0151] (7) Add 20 μL of DEPC water to each EP tube to dissolve the RNA, and shake moderately to ensure that the precipitate is fully dissolved.

[0152] (8) Measure the RNA concentration using a ultra-micro ultraviolet / visible spectrophotometer (prepare a 2 μL pipette, pipette tips, and DEPC water).

[0153] 1.4.4 Detailed procedure of RT-qPCR

[0154] (1) The reverse transcription kit (RR036A) was purchased from TaKaRa Company, Japan, and the reaction system is 20 μL. The total RNA sample loading amount required for reverse transcription reaction is 1000 ng.

[0155] (2) Set the reverse transcription PCR reaction program: 37°C, 15 min → 85°C, 5 s → 4°C, stand still.

[0156] (3) After reverse transcription is completed, 80 μL of DEPC water is added to the cDNA sample for dilution and stored at -20 °C for later use.

[0157] (4) Prepare the PCR reaction solution according to the following RT-qPCR reaction system: 5 μL of SYBR Green (Yeasen Biotechnology Co., Ltd., Shanghai, 11201ES08), 0.5 μL of forward / reverse primer (Beijing Tsingke Biotechnology Co., Ltd.), 1 μL of cDNA, and 3 μL of DEPC water.

[0158] Mouse, β-Actin forward primer, SEQ ID NO.2: CATGGATGACGATATCGCTG;

[0159] Mouse, β-Actin reverse primer, SEQ ID NO.3: GTCCTTCTGACCCATTCCC;

[0160] Mouse, Nudt12 forward primer, SEQ ID NO.4: ATCACTTGTCAATAAAGCGAGGC;

[0161] Mouse, Nudt12 reverse primer, SEQ ID NO.5: CTTCCCACCTTTTGCATTTGC.

[0162] (5) Load the sample, attach the sealing film, centrifuge the PCR plate to remove air bubbles, and perform on-machine detection.

[0163] (6) Set the RT-qPCR amplification program (two-step method): 95 °C, 5 min (pre-denaturation) → 95 °C, 10 s (denaturation) → 60 °C, 30 s (annealing / extension) → 95 °C, 5 s → 60 °C, 1 min → 95 °C, 0.1 °C / s (melting).

[0164] (7) Export and analyze the data, normalize using β-Actin as the housekeeping gene, and analyze the relative expression levels of the target genes by the 2 -△△ -ΔΔCT method (both the control group and the treatment group require 3 biological replicates).

[0165] 1.4.5 Detailed procedure of NAD-capQ

[0166] (1) Extract the total RNA of cells / tissues by the above Trizol method until the precipitate dries.

[0167] (2) Add 400 μL of solution A (2 M urea + 10 mM Tris-HCl solution) to each tube of RNA and incubate at 65 °C for 2 min (to remove residual NAD + ).

[0168] (3) Add 350 μL of 8.57 M ammonium acetate solution and 750 μL of isopropanol to each tube (after mixing, the final concentration of ammonium acetate is 2 M). Slowly invert the EP tube up and down to mix and shake for 30 s, then let it stand at room temperature for 10 min. Centrifuge at 4 °C and 12,000 rpm for 10 min. Slowly pour off the upper layer directly, leaving a white precipitate.

[0169] (4) Add 1 mL of 75% ethanol (prepared with absolute ethanol + DEPC water) along the tube wall. Slowly invert the EP tube up and down to mix and shake for 15 s. Centrifuge at 4 °C and 12,000 rpm for 5 min. Slowly pour off the upper layer directly, leaving a white precipitate. Use a 10-μL pipette to aspirate the remaining ethanol at the bottom and on the side wall of the EP tube (move slowly and do not aspirate the precipitate). Invert the EP tube onto filter paper and let the precipitate dry for about 10 min.

[0170] (5) Add 25 μL of Solution B (20 μM ZnCl₂ + 10 mM Tris-HCl solution) to each EP tube to dissolve the RNA, shake moderately to dissolve it completely (at this time, dissolve the RNA in 2 tubes of 6 cm under the same treatment conditions with 25 μL of Solution B and combine them into 1 tube).

[0171] (6) Measure the RNA concentration with a ultra-micro ultraviolet / visible spectrophotometer. Expect the RNA concentration > 2800 ng / μL.

[0172] (7) Aspirate 50 μg of RNA from each tube, calculate the required volume, transfer it to a new 200-μL enzyme-free EP tube, and make up the volume to 18 μL with DEPC water.

[0173] (8) Add 2 μL of nuclease P1 (Sigma-Aldrich, N8630-1VL) to each tube, mix well to obtain a 20-μL system, and digest at 37 °C for 30 min to release all the NAD + / NADH caps linked to the 5' end of the RNA. After digestion, place the EP tube on ice.

[0174] (9) The free NAD + / NADH obtained after digestion is detected by the NAD + / NADH detection kit (S0175) produced by Jiangsu Beyotime Biotechnology Co., Ltd.

[0175] 1.5 Induce an acute myocardial infarction model by ligating the left anterior descending coronary artery of C57BL / 6 mice

[0176] Male C57BL / 6 mice at 8 weeks of age with a body weight of 18 - 25 g were selected. The selected mice were evenly divided into a sham operation group and a myocardial infarction group according to different surgical conditions. Myocardial infarction group: An acute myocardial infarction model in mice was established by ligating the left anterior descending branch with 6 - 0 surgical sutures using the cardiac extrusion method. Sham operation group: 6 - 0 surgical sutures were passed through the corresponding position without ligation, and the remaining treatments were the same as those in the operation group.

[0177] 1.6 Detection of Nudt12 expression and NAD + / NADH cap modification level in myocardial infarction specimens caused by ischemia

[0178] Tissues from the infarct border zone of the above - mentioned sham operation group and myocardial infarction model at 1 day, 3 days, and 7 days after modeling were collected. Total RNA and proteins of the above samples were extracted respectively. NAD + / NADH cap modification levels in the myocardial infarction junction zone tissues at 1 day, 3 days, and 7 days after AMI and in the sham operation group were detected using NAD - capQ. Changes in the mRNA and protein expression levels of Nudt12 in the myocardial infarction junction zone tissues at 1 day, 3 days, and 7 days after AMI and in the sham operation group were detected by RT - qPCR and Western blot.

[0179] 1.7 Detection of the functional effects of Nudt12 gene overexpression on NMVMs

[0180] NMVMs overexpressing Nudt12 (SEQ ID NO.1) with an adenovirus (Shanghai Hanheng Biotechnology Co., Ltd., GC20210916LCH - AD01) were constructed as the experimental group. At the same time, NMVMs infected with an adenovirus empty vector were used as the control group. Myocardial cell apoptosis was induced by ischemia - hypoxia according to the previous method. Until 12 h after ischemia - hypoxia treatment, NAD + / NADH cap modification level, mitochondrial morphological structure, mitochondrial reactive oxygen species level, mitochondrial membrane potential, intracellular ATP content, and cell apoptosis level in NMVMs were detected.

[0181] 1.7.1 Construction of adenovirus vector

[0182] The construction steps are as follows: (1) Vector digestion; (2) Obtaining the target fragment; (3) Ligation of the target fragment Nudt12 with the vector; (4) Transformation; (5) Identification by bacterial liquid PCR; (6) Sequencing; (7) Plasmid extraction; (8) Recombination of adenovirus vector. The cloning site of the adenovirus vector is KpnI (see Figure 11 ).

[0183] 1.7.2 Specific experimental steps for adenovirus transfection of NMVMs:

[0184] (1) Seed primary NMVMs evenly in 6-well plates or confocal dishes, and observe the cell adhesion of cardiomyocytes after 48 h. Collect the cells in 2 wells of 6-well plates or confocal dishes respectively and perform cell counting. Aspirate the culture medium from the remaining wells, wash twice with PBS, and then add 1 mL or 250 μL of fresh culture medium again.

[0185] (2) Take out the viruses (Ad-Ctrl group and Ad-Nudt12 overexpression group) and place them in the refrigerator at 4 °C to melt slowly. Calculate the volume of virus required for each well according to the explored MOI value (MOI = 100), add the virus to the NMVMs according to the calculated amount, shake well and then put them back into the incubator for continued culture. After 6 h, supplement the culture medium to 2 mL or 500 μL. After 24 h of infection, aspirate the culture medium containing the virus, wash twice with PBS, and replace it with fresh complete culture medium for continued culture for 24 h. Collect the cells for subsequent experiments.

[0186] 1.8 Detection of NAD + / NADH cap modification level

[0187] After 12 h of hypoxia, collect NMVMs with Trizol, extract RNA and perform RT-qPCR to detect the expression level of Nudt12. After 12 h of hypoxia, collect NMVMs with Trizol, extract RNA and perform NAD-capQ to detect the changes in NAD + / NADH cap modification.

[0188] 1.9 Detection of mitochondrial morphological structure of cardiomyocytes

[0189] After 12 h of hypoxia, collect NMVMs with a cell scraper, fix them with an electron microscopy fixative, and embed them in a conventional 812 embedding medium until sectioning. After the sections are made, observe the mitochondrial morphological structure with a transmission electron microscope.

[0190] 1.10 Detection of mitochondrial reactive oxygen species level in cardiomyocytes

[0191] After 12 h of hypoxia in NMVMs, add the working solution of MitoSOX indicator (Thermo Fisher, M36007) in the dark, incubate at 37 °C in the dark for 30 min, then add Hoechst live cell staining solution (Jiangsu Beyotime Biotechnology Co., Ltd., C1028), incubate at room temperature in the dark for 10 min, and then observe the changes in mitochondrial reactive oxygen species with an Olympus inverted laser confocal microscope.

[0192] 1.11 Detection of mitochondrial membrane potential in cardiomyocytes

[0193] After 12 h of hypoxia in NMVMs, the JC-1 staining working solution (Jiangsu Beyotime Biotechnology Co., Ltd., C2003S) was added in the dark. After incubation at 37 °C in the dark for 20 min, the changes in mitochondrial membrane potential were observed under an inverted fluorescence microscope.

[0194] 1.12 Detection of intracellular ATP content in cardiomyocytes

[0195] The enhanced ATP detection kit (Jiangsu Beyotime Biotechnology Co., Ltd., S0027) was used to detect intracellular ATP. NMVMs were collected by cell scraping after 12 h of hypoxia. After lysing the cells with ATP detection lysis buffer and centrifuging to collect the supernatant, the ATP detection working solution was added. The RLU value was detected using a multifunctional microplate reader, and the linear equation of the standard curve was plotted. The concentration of ATP in the sample to be measured was calculated according to the RLU value, and the protein concentration of the sample was measured using a BCA protein concentration assay kit. Finally, the ATP concentration was converted into the form of nmol / mg protein.

[0196] 1.13 Detection of cardiomyocyte apoptosis level

[0197] After 12 h of hypoxia in NMVMs, the cells were fixed with 4% paraformaldehyde. After cell membrane permeabilization with 0.3% Triton X-100 (Shanghai Viao Biotechnology Co., Ltd., WF0193), the TUNEL detection solution (Jiangsu Beyotime Biotechnology Co., Ltd., C1090) was added in the dark. After incubation at 37 °C in the dark for 60 min, a fluorescence quenching mounting medium containing DAPI (Jiangsu Beyotime Biotechnology Co., Ltd., P0131) was added for mounting, and the changes in cardiomyocyte apoptosis level were observed under an Olympus inverted laser confocal microscope. NMVMs were collected by cell scraping after 12 h of hypoxia, and proteins were extracted for Western blot to detect the changes in apoptosis-related protein levels.

[0198] 1.14 Detection of the effect of Nudt12 gene overexpression on cardiac function in myocardial infarction mice

[0199] Adeno-associated virus vectors (Shanghai Hanheng Biotechnology Co., Ltd., HH20220319LCH-AAV01) were injected into the tail veins of mice. Among them, C57BL / 6 mice injected with the adeno-associated virus vector overexpressing Nudt12 (SEQ ID NO.1) were used as the experimental group, and C57BL / 6 mice injected with the adeno-associated virus empty vector were used as the control group. The left anterior descending coronary artery was ligated according to method 1.5 to induce an acute myocardial infarction model. At 3 days after myocardial infarction, the NAD + / NADH cap modification level, the apoptosis level of myocardial tissue in the early stage of myocardial infarction, and the changes in cardiac function of mice in the early stage of myocardial infarction were detected. At 28 days after myocardial infarction, the fibrosis degree of myocardial tissue in the late stage of myocardial infarction and the changes in cardiac function of mice in the late stage of myocardial infarction were detected.

[0200] 1.14.1 Construction of Adeno-associated Virus Vector

[0201] Specific steps: (1) Vector digestion; (2) Obtaining the target fragment; (3) Ligation of the target fragment Nudt12 with the vector; (4) Transformation; (5) Identification by colony PCR; (6) Sequencing; (7) Plasmid extraction. The cloning site of adeno-associated virus is KpnI (see Figure 12 ).

[0202] 1.14.2 Transfection of Adeno-associated Virus into C57 Mice

[0203] The specific experimental steps are as follows:

[0204] (1) Put on the laboratory coat, gloves, face shield and mask before virus infection, and pay attention to protection.

[0205] (2) Take out the virus (AAV-Ctrl group and AAV-Nudt12 overexpression group) and place it in the 4°C refrigerator to melt slowly. Dilute the virus. In this experiment, the virus titer of 1×10 12 vg / mL was used for tail vein injection of mice.

[0206] (3) Take 4-week-old C57BL / 6J male mice, fix the mice on the mouse tail vein injection instrument, and aspirate 100 μL of the above-mentioned titer virus solution with an insulin needle and inject it into the mice through the tail vein.

[0207] (4) After 4 weeks, collect the tissue samples and harvest the heart tissue. RT-qPCR experiment and Western Blot experiment were used to detect the overexpression of Nudt12 mediated by adeno-associated virus. If the overexpression was successful, the same method as above was used to construct Nudt12 myocardial-specific overexpression mice for subsequent experiments.

[0208] 1.15 Detection of NAD+ / NADH Cap Modification Level in Infarct Border Zone Tissue

[0209] Collect the infarct border zone tissue 3 days after myocardial infarction, extract RNA and perform RT-qPCR to detect the expression level of Nudt12. Collect the infarct border zone tissue 3 days after myocardial infarction, extract protein and perform Western blot to detect the expression level of Nudt12. Collect the infarct border zone tissue 3 days after myocardial infarction, extract RNA and perform NAD-capQ to detect the change of NAD + / NADH cap modification.

[0210] 1.16 Detection of Apoptosis Level in Myocardial Tissue

[0211] Collect the infarct border zone tissue 3 days after myocardial infarction, extract protein and perform Western blot to detect the change of apoptosis-related protein levels.

[0212] 1.17 Detection of changes in the mechanical properties of cardiomyocytes

[0213] Three days after myocardial infarction surgery, adult mouse cardiomyocytes (AMCMs) were isolated and extracted, and the mechanical properties of AMCMs were detected using the IonOptix myocyte contraction measurement system. Only one curve was measured for each cardiomyocyte, and 15 curves were measured for each mouse; in addition, each curve contained at least 5 consecutive complete contraction and relaxation peaks / troughs. For data analysis and statistics, the mechanical properties of AMCMs were mainly evaluated through the following indicators: resting cell length, maximum cell contraction length (PS), cell contraction time (TPS), time required to return to 90% of the resting cell length (TR90), and maximum speed of cell contraction / relaxation (±dL / dt).

[0214] 1.18 Detection of changes in cardiac function in mice at the early stage of myocardial infarction

[0215] Three days after myocardial infarction surgery, small animal ultrasound was performed to evaluate the geometric structure and function of the heart. The parasternal long-axis view was obtained, and the heart rate was recorded simultaneously (the heart rate of the mouse was preferably stabilized at 450 - 550 beats per minute). The following cardiac geometric shape and function indicators were obtained: ejection fraction (EF), fractional shortening (FS), left ventricular posterior wall thickness at end-diastole (LVPWd), left ventricular posterior wall thickness at end-systole (LVPWs), interventricular septum thickness at end-diastole (IVSd), interventricular septum thickness at end-systole (IVSs), left ventricular internal diameter at end-diastole (LVIDd), and left ventricular internal diameter at end-systole (LVIDs). Each measurement index was averaged over at least 5 consecutive cardiac cycles.

[0216] 1.19 Detection by staining of cardiac tissue specimens

[0217] Twenty-eight days after myocardial infarction surgery, the heart was harvested, thoroughly rinsed with normal saline, fixed with 4% paraformaldehyde, and subjected to routine paraffin embedding and sectioning. After the section preparation was completed, it was routinely dewaxed and hydrated, and HE and Masson staining were performed to observe the degree of myocardial tissue fibrosis.

[0218] 1.19.1 Specific steps of hematoxylin-eosin staining (HE)

[0219] (1) Dewaxing the paraffin section to water: The section was successively placed in xylene Ⅰ for 15 min → xylene Ⅱ for 15 min (both of the above two steps required a shaker) → absolute ethanol for 5 min → 95% ethanol for 5 min → 85% ethanol for 5 min → 80% ethanol for 5 min → 70% ethanol for 5 min (no shaker required) → rinsed with tap water for 5 min → washed with PBS 3 times, 5 min each time.

[0220] (2) Staining the cell nuclei with hematoxylin: Immerse the prepared sections in hematoxylin staining solution for 5 min, wash away the residual staining solution with dd water, differentiate for several seconds with differentiating solution (1% hydrochloric acid ethanol), and rinse with tap water for 10 min.

[0221] (3) Staining the cytoplasm with eosin: Transfer the rinsed sections into eosin staining solution and immerse for 3 min, then rinse with tap water for 2 min.

[0222] (4) Dehydration with gradient ethanol: Transfer the sections successively into 95% ethanol I for 2 min → 95% ethanol II for 4 min → absolute ethanol I for 5 min → absolute ethanol II for 5 min → xylene I for 10 min → xylene II for 10 min for dehydration and clearing.

[0223] (5) Sealing the slides: Take out the successfully dehydrated and cleared sections from the xylene solution, air-dry slightly, and seal with neutral balsam.

[0224] (6) Microscopic examination with a Leica upright optical microscope and image acquisition and analysis.

[0225] 1.19.2 Specific steps of Masson staining

[0226] (1) Deparaffinizing the paraffin sections to water: Successively immerse the sections in xylene I for 15 min → xylene II for 15 min (both of the above two steps require a shaker) → absolute ethanol for 5 min → 95% ethanol for 5 min → 85% ethanol for 5 min → 80% ethanol for 5 min → 70% ethanol for 5 min (no shaker required) → rinse with tap water for 5 min → wash with PBS 3 times, 5 min for each time.

[0227] (2) Immerse the prepared sections in the mordant solution and mordant overnight at room temperature. Rinse with running water for 10 min the next day.

[0228] (3) Air-dry the sections slightly and draw a circle around the tissue specimens on each glass slide with an immunohistochemistry pen.

[0229] (4) Dropwise add celestine blue staining solution (anti-acid, making the hematoxylin color not easy to fade and deepening the staining of cell nuclei), after incubating for 3 min, quickly wash 2 times with dd water, about 10 s for each time.

[0230] (5) Air-dry the sections slightly, dropwise add Mayer hematoxylin staining solution, after incubating for 3 min, quickly wash 2 times with dd water.

[0231] (6) Differentiate with acidic differentiating solution for several seconds until the tissue turns completely red, rinse with tap water for 10 min, and then wash the sections with dd water.

[0232] (7) Air-dry the sections slightly, dropwise add ponceau fuchsin staining solution, after incubating for 10 min, quickly wash 2 times with dd water.

[0233] (8) The sections were slightly air-dried, then phosphomolybdic acid solution was added dropwise. After incubation for 10 min, the sections were gently shaken to remove the excess solution, and then aniline blue staining solution was added directly. Incubate for 5 - 20 min (as the storage time of the reagent extends, the incubation time of aniline blue staining can be appropriately extended).

[0234] (9) The sections were washed with a weak acid solution to remove the added aniline blue, slightly air-dried, and then treated with a weak acid solution for 2 min.

[0235] (10) Gradient ethanol dehydration: The treated sections were successively transferred into 95% ethanol for 2 min → absolute ethanol I for 2 min → absolute ethanol II for 2 min → xylene I for 2 min → xylene II for 2 min for dehydration and clearing.

[0236] (11) Mounting: The sections that had been successfully dehydrated and cleared were taken out from the xylene solution, slightly air-dried, and then mounted with neutral balsam.

[0237] (12) Microscopic examination with a Leica upright optical microscope and image acquisition and analysis.

[0238] 1.20 Detection of long-term changes in cardiac function in mice with myocardial infarction

[0239] Twenty-eight days after myocardial infarction surgery, small animal ultrasound was performed to evaluate the geometric structure and function of the heart. The specific operation steps were the same as in 1.18.

[0240] 2 Experimental results

[0241] In the following figures, * indicates that after statistical analysis, there was a significant difference between the two groups, p < 0.05; ** indicates that after statistical analysis, there was a significant difference between the two groups, p < 0.01; *** indicates that after statistical analysis, there was a significant difference between the two groups, p < 0.001; **** indicates that after statistical analysis, there was a significant difference between the two groups, p < 0.0001.

[0242] As Figure 1 shown, the NAD + / NADH cap modification and the expression level of Nudt12 in NMVMs or AMCMs induced by ischemia and hypoxia were detected by NAD-capQ, RT-qPCR, and Western Blot respectively. It was found that the NAD + / NADH cap modification was significantly up-regulated in cardiomyocytes induced by ischemia and hypoxia, while the expression of Nudt12 was significantly down-regulated.

[0243] As Figure 2 shown, the NAD in ischemic myocardial tissue in an acute myocardial infarction model induced by ligation of the left anterior descending coronary artery was detected by NAD-capQ, RT-qPCR, and Western Blot respectively. + / NADH capping and the expression level of Nudt12, it was found that 3 days after myocardial infarction, NAD + / NADH capping began to gradually increase and remained at a high level, while the expression of Nudt12 began to gradually decrease and remained at a low level 3 days after myocardial infarction.

[0244] As Figures 3 - 5 shown, overexpression of Nudt12 could significantly improve the inhibitory effect of 12 h of ischemia and hypoxia on the functional phenotype of NMVMs, such as significantly reducing the damage of the mitochondrial microstructure of NMVMs, significantly reducing the production of mitochondrial MitoSOX in NMVMs, significantly increasing the mitochondrial membrane potential, significantly increasing the synthesis of cellular ATP, and significantly enhancing the anti-apoptotic ability of NMVMs.

[0245] As Figures 6 - 10 shown, overexpression of Nudt12 could significantly improve the inhibitory effect of ischemia on the functional phenotype of myocardial tissue, such as maintaining the contraction of cardiomyocytes in the tissue, significantly reducing apoptosis in myocardial tissue in the early stage of myocardial infarction and significantly improving the cardiac function of mice, significantly reducing the degree of myocardial fibrosis in the long term after myocardial infarction and significantly improving the cardiac function of mice.

[0246] In summary, by overexpressing Nudt12 to intervene in ischemia / hypoxia-induced apoptosis of NMVMs and ischemia-induced myocardial infarction, it can be concluded that after overexpression of Nudt12, the function of NMVMs induced by ischemia / hypoxia and the cardiac function of mice with ischemia-induced myocardial infarction can be significantly improved. Therefore, the present invention provides a new target and strategy for the clinical diagnosis and treatment of acute myocardial infarction caused by ischemia / hypoxia.

Claims

1. Use of a viral vector overexpressing the Nudt12 gene in the preparation of a medicament for treating acute myocardial infarction, characterized in that, The inserted sequence of the viral vector is SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The viral vector is an adenovirus vector or an adeno-associated virus vector.

3. The application according to claim 2, wherein The cloning site of the adenovirus vector is KpnI.

Images