Application of SETD5 as a biomarker for the diagnosis and treatment of ovarian cancer
By using the SETD5 gene or protein as a diagnostic and therapeutic biomarker for ovarian cancer, and by employing SETD5 expression level detection and inhibition technology, the problem of the lack of effective diagnostic and treatment methods for ovarian cancer has been solved, enabling early diagnosis and effective treatment, and improving the treatment outcome of ovarian cancer.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-19
- Publication Date
- 2026-03-06
AI Technical Summary
Currently, there is a lack of effective diagnostic and treatment methods for ovarian cancer. The application scope and effectiveness of targeted drugs are insufficient. The molecular mechanisms of chemotherapy recurrence and metastasis are unclear, making it difficult to implement precision molecular therapy and lacking effective molecular therapy targets.
The SETD5 gene or protein can be used as a diagnostic and therapeutic biomarker for ovarian cancer. Ovarian cancer can be diagnosed by detecting the expression level of SETD5, and therapeutic drugs can be prepared by using reagents that inhibit or silence SETD5 expression, such as shRNA and siRNA, to inhibit the proliferation and migration of ovarian cancer cells.
To provide early diagnosis and treatment reference for ovarian cancer patients, improve survival rate, significantly reduce the cancer-promoting function of SETD5, provide new treatment methods, and improve the treatment effect of ovarian cancer.
Smart Images

Figure CN116814792B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of SETD5 as a biomarker for the diagnosis and treatment of ovarian cancer. Background Technology
[0002] Ovarian cancer lacks effective treatment methods, with 70% of patients diagnosed at an advanced stage, and its mortality rate has long been the highest among gynecological malignancies. Although novel molecularly targeted drugs have been developed in recent years, such as inhibitors of oncoproteins PARP, VEGF, and EGFR, as well as inhibitors of the immunosuppressive factor PD-L1, these targeted drugs can only slightly prolong disease-free survival. The reasons for this are: ① The scope and effectiveness of targeted drugs are far from meeting the needs of clinical treatment for ovarian cancer; ② The molecular mechanisms of ovarian cancer recurrence and metastasis after chemotherapy are unclear, lacking effective molecular therapeutic targets and making it difficult to implement precision molecular therapy strategies. Therefore, finding molecular targets for the diagnosis and treatment of ovarian cancer remains a challenge for clinicians and researchers.
[0003] Epigenetics is a new hot topic in tumor research, and studies have confirmed that epigenetic alterations are prevalent in malignant tumors and are closely related to tumor development and progression. SETD5 (SET domain containing 5) is an important factor in epigenetics. It has histone methyltransferase activity and can form complexes with G9a, HDAC3, etc., to methylate the 9th lysine residue of histone H3 (H3K9), thereby altering chromatin conformation and regulating various types of gene transcription. It plays an important role in embryonic development, metabolic-related diseases, neurodevelopment, and autism. Recent studies have shown that SETD5 is highly expressed in tissues and cells of esophageal squamous cell carcinoma, lung cancer, and prostate cancer, and its high expression is associated with poor prognosis in lung cancer. Knockdown of SETD5 expression can significantly inhibit the proliferation, invasion, and migration of esophageal squamous cell carcinoma and lung cancer cells. However, whether SETD5 has a related role in female reproductive system tumors has not yet been reported. Summary of the Invention
[0004] To address some technical problems existing in the diagnosis and treatment of ovarian cancer, this invention aims to provide a biomarker for the diagnosis and / or treatment of ovarian cancer. Experiments have demonstrated that this gene is positively correlated with the proliferation and migration ability of ovarian cancer cells and significantly negatively correlated with the prognosis of ovarian cancer patients. This suggests that SETD5 holds promise as a therapeutic biomarker for ovarian cancer and can be used in the development of epigenetic drugs.
[0005] To achieve the above-mentioned technical objectives, the present invention provides the following technical means:
[0006] The present invention first provides a biomarker for diagnosing ovarian cancer, the biomarker comprising: the SETD5 gene or the SETD5 protein.
[0007] The SETD5 gene sequence information can be found in the NCBI accession number RefSeq: NM_001080517.
[0008] This invention also provides the application of the SETD5 gene or SETD5 protein as a biomarker for the diagnosis or treatment of ovarian cancer.
[0009] This invention also provides the application of reagents for detecting the expression level of the SETD5 gene or SETD5 protein in the preparation of products for detecting, diagnosing, or treating ovarian cancer.
[0010] Furthermore, the application involves using the product to detect the expression level of the SETD5 gene or SETD5 protein in the subject's sample. If the expression level of the SETD5 gene or SETD5 protein in the subject's sample is high compared with that of a normal sample, the subject is diagnosed as an ovarian cancer patient or at high risk of developing ovarian cancer.
[0011] Furthermore, the product includes primers capable of amplifying the SETD5 gene or substances capable of binding the SETD5 protein; the primers can detect the expression level of the SETD5 gene, and the substances can detect the expression level of the SETD5 protein.
[0012] Preferably, the primers are as shown in SEQ ID No:1 and SEQ ID No:2; the substance capable of binding the SETD5 protein includes an antibody.
[0013] SEQ ID No:1: Upstream primer F: 5'-CTGCTGGATCAGACCCTGAAT-3';
[0014] SEQ ID No:2: Downstream primer R: 5'-GTTGTTCAAGCGCGTTCTGT-3'.
[0015] The present invention also provides a product for diagnosing or treating ovarian cancer, the product comprising a reagent capable of detecting the expression level of the SETD5 gene or SETD5 protein in a subject sample.
[0016] Furthermore, the reagent includes primers capable of amplifying the SETD5 gene or substances capable of binding the SETD5 protein; the primers can detect the expression level of the SETD5 gene, and the substances can detect the expression level of the SETD5 protein.
[0017] Preferably, the primers are as shown in SEQ ID No:1 and SEQ ID No:2; the substance capable of binding the SETD5 protein includes an antibody, and more particularly, the antibody includes a polyclonal antibody.
[0018] The present invention also provides reagents for inhibiting or silencing the expression level of the SETD5 gene or SETD5 protein, said reagents comprising at least one of shRNA that interferes with SETD5 expression, siRNA that interferes with SETD5 expression, and antisense oligonucleotide chains that interfere with SETD5 expression.
[0019] Furthermore, the shRNA includes:
[0020] shSETD5-1(SEQ ID No:5): TTGTGGGCAAACCTACTATTT,
[0021] shSETD5-2(SEQ ID No:6):AGCGTGTATTCCACTCATAAT、
[0022] Or shSETD5-3 (SEQ ID No:7): CAACCGTGCTGCATCTAAATA.
[0023] The present invention also provides the use of the reagent in the preparation of drugs for inhibiting or treating ovarian cancer.
[0024] Furthermore, the application includes inhibiting the proliferation or migration ability of ovarian cancer cells.
[0025] The beneficial effects of this invention include:
[0026] This invention reveals that SETD5 possesses the potential to serve as a diagnostic and therapeutic biomarker for ovarian cancer patients, providing a novel reference factor for early diagnosis of ovarian cancer, enabling early prevention and treatment, and improving patient survival rates. Furthermore, inhibiting SETD5 expression significantly reduces its oncogenic function, suggesting that SETD5 may serve as a potential therapeutic target for ovarian cancer. Based on this, this invention provides a drug for inhibiting ovarian cancer, offering a new treatment method for clinical ovarian cancer and possessing significant clinical and social benefits in improving the treatment efficacy of ovarian cancer. Attached Figure Description
[0027] Figure 1 Figure 1 shows the expression of SETD5 in different ovarian cancer cell lines in Example 1. In the figure, Figure A shows the expression level of SETD5 mRNA in different ovarian cancer cell lines detected by Q-PCR, *p<0.05, **p<0.01, ***p<0.001; Figure B shows the expression level of SETD5 protein in different ovarian cancer cell lines detected by Western blot.
[0028] Figures 2-4 This is the experimental result of the effect of knocking down SETD5 on the migration ability of ovarian cancer cells in Example 2.
[0029] Figure 2 To validate the results of knocking down SETD5 expression (SETD5-KD) in A2780 cells (which highly express SETD5).
[0030] Figure 3 The image shows the results of a Transwell assay to detect the migration ability of SETD5-KD-A2780 cells. The top image is a picture verifying the migration ability, and the bottom image is a quantitative analysis of the results in the top image.
[0031] Figure 4 The results of the scratch assay were used to detect the migration ability of SETD5-KD-A2780 cells. The top image shows the migration ability verification, and the bottom image shows the quantitative analysis of the results in the top image.
[0032] Figures 5-7 The results show the effects of SETD5 overexpression on the migration ability of ovarian cancer cells in Example 2.
[0033] Figure 5 To validate the stable overexpression of SETD5 (SETD5-OE) in SKOV3 cells (which express low levels of SETD5).
[0034] Figure 6 The results of the Transwell assay for detecting the migration ability of SETD5-OE-SKOV3 cells are shown; the left image is the image verifying the migration ability, and the right image is the quantitative analysis of the results in the left image.
[0035] Figure 7 The results of the scratch assay were used to detect the migration ability of SETD5-OE-SKOV3 cells; the top image shows the migration ability verification, and the bottom image shows the quantitative analysis of the results in the top image.
[0036] Figures 8-10 This describes the effect of SETD5 knockdown on the proliferation ability of ovarian cancer cells as described in Example 3.
[0037] Figure 8 To verify the knockdown effect of SETD5-KD-A2780 cells using Western blot.
[0038] Figure 9 The results of the cell counting experiment were used to detect the proliferation capacity of SETD5-KD-A2780 cells; the top image shows the verification of proliferation capacity, and the bottom image shows the quantitative analysis of the results in the top image.
[0039] Figure 10 The results of the CCK8 assay were used to detect the proliferation capacity of SETD5-KD-A2780 cells.
[0040] Figures 11-13This refers to the effect of SETD5 overexpression on the proliferation ability of ovarian cancer cells as described in Example 3.
[0041] Figure 11 To verify the exogenous expression effect of SETD5-OE-SKOV3 cells using Western blot.
[0042] Figure 12 The results of the cell counting experiment were used to detect the proliferation capacity of SETD5-OE-SKOV3 cells; the top image shows the verification of proliferation capacity, and the bottom image shows the quantitative analysis of the results in the top image.
[0043] Figure 13 The results of the CCK8 assay were used to detect the proliferation capacity of SETD5-OE-SKOV3 cells. Detailed Implementation
[0044] To enable those skilled in the art to better understand the technical solutions of the present invention, the preferred embodiments of the present invention will be described in detail below. However, the following embodiments do not limit the scope of protection of the present invention.
[0045] In the embodiments of the present invention, unless otherwise described, conventional experimental methods were used. The processes involved in the embodiments, unless otherwise described, can be understood and easily implemented by those skilled in the art based on the product manual or basic knowledge in the field, and therefore will not be described in detail.
[0046] The DMEM culture medium (containing 10% fetal bovine serum (FBS)) formulation used in the examples is as follows:
[0047] Each 500 mL of DMEM culture medium (containing 10% fetal bovine serum (FBS)) includes:
[0048] DMEM high-glucose complete medium: 445 mL, Vincent Company, 319-005-CL;
[0049] Fetal bovine serum (FBS): 50 mL, Vicente Corporation, 086-005;
[0050] 100× penicillin-streptomycin solution: 5 mL, Beyotime Pharmaceutical Co., Ltd., C0222.
[0051] DMEM culture media with different levels of fetal bovine serum were prepared by adjusting the amount of fetal bovine serum used.
[0052] Example 1: Detection of SETD5 expression level in ovarian cancer cell lines
[0053] The cell lines used in this embodiment were: human ovarian granulosa cell line KGN, human ovarian cancer cell lines A2780, SKOV3, HeyA8, and ES-2, which were purchased from ATCC (Manassas, VA, USA).
[0054] The experimental steps for real-time quantitative polymerase chain reaction (Q-PCR) are as follows:
[0055] (1) Extraction of total RNA from cells
[0056] Total RNA was extracted from normal ovarian granulosa cells KGN and ovarian cancer cells A2780, SKOV3, Hey A8 and ES-2 using TRIzol reagent, and the concentration and purity of RNA were detected.
[0057] (2) Reverse transcription of total RNA
[0058] Reverse transcription was performed using the PrimeScript RT Reagent Kit (Takara). The starting amount of RNA was 2 μg, and the RNA reverse transcription was performed according to the kit instructions.
[0059] (3) Real-time quantitative PCR
[0060] PCR amplification was performed using the SsoFast EvaGreen Supermix (Bio-Rad) kit (primer sequences are shown in Table 1). The amplification was performed on a Bio-Rad CFX96 system using 2... -ΔΔCt The value (Ct represents the cycle threshold) indicates the relative expression level of the gene.
[0061] In this embodiment, the target gene fragment amplified is SETD5, with accession number RefSeq: NM_001080517 in the database, and the internal reference is GAPDH (GenBank: BC083511).
[0062] Table 1. Primer sequences for quantitative real-time detection of genes.
[0063]
[0064] The steps for Western blot are as follows:
[0065] (1) Extraction of total cell protein
[0066] Cells were lysed for 30 min using a protein lysis buffer containing protease inhibitors; then centrifuged at 12,000×g for 15 min at 4°C, and the supernatant was used as the protein sample, and the protein concentration was then determined.
[0067] (2) Protein electrophoresis
[0068] Protein samples were separated by 10% SDS-PAGE gel, first at 80V for 30 min, then at 110V for 100 min.
[0069] (3) Transfer membrane
[0070] The protein was transferred onto a PVDF membrane using a constant current of 300mA for 130 minutes.
[0071] (4) Blocking and antibody incubation
[0072] After transfer, place the PVDF membrane in 2% BSA blocking buffer and block on a shaker at room temperature for 0.5-1 h. Prepare primary antibody dilution buffer (1:500) according to the SETD5 antibody (No. ab204363, Abcam) instructions, completely immerse the PVDF membrane in the corresponding antibody dilution buffer, and incubate overnight on a shaker at 4°C. The next day, recover the primary antibody and add 1×TBST buffer to wash the membrane while shaking on a shaker at room temperature for 7 min each time, repeating 4 times. Prepare goat anti-mouse or goat anti-rabbit secondary antibody according to the dilution ratio in the instructions. Add the prepared secondary antibody solution to the PVDF membrane after washing with 1×TBST buffer and incubate on a shaker at room temperature for 1-2 h.
[0073] (5) Film exposure
[0074] Place the PVDF film on the developing stage of the exposure machine, evenly drop the exposure solution onto the film, and set an appropriate exposure time to obtain the best exposure results.
[0075] Statistical analysis: SPSS 22.0 statistical software was used to analyze the statistical differences between experimental data. Mean ± SEM was used to represent the experimental data. The t-test was used to analyze the differences between two samples. P < 0.05 indicates that the difference is statistically significant.
[0076] Test results and analysis: such as Figure 1 As shown, compared with the human ovarian granulosa cell line KGN, the mRNA and protein expression levels of SETD5 were significantly upregulated in the four human ovarian cancer cell lines (P<0.05). Among them, SETD5 was expressed at the highest level in the A2780 cell line. The results of this example indicate that SETD5 can be used as a diagnostic marker for ovarian cancer.
[0077] Example 2: Effect of SETD5 on the migration ability of ovarian cancer cells
[0078] The cell lines used in this example were HEK293T cell line and human ovarian cancer cell lines A2780 and SKOV3, which were purchased from ATCC (Manassas, VA, USA).
[0079] The pHR'-CMV-8.2ΔVPR and pHR'-CMV-VSVG plasmids were donated by Professor Changdeng Hu of Purdue University (West Lafayette, IN, USA) and are both commonly used commercial plasmids.
[0080] pLKO.1 and pCDH-puro lentiviral expression vectors were purchased from Addgene (Cambridge, MA).
[0081] Construction of a cell model with stable SETD5 knockdown:
[0082] (1) Design of short hairpin RNAs targeting SETD5
[0083] Three to five shRNA sequences were designed targeting the SETD5 gene sequence (RefSeq: NM_001080517), and the three most effective shRNA sequences were selected and named shSETD5-1, shSETD5-2, and shSETD5-3, respectively. Their sequences are as follows:
[0084] shSETD5-1: TTGTGGGCAAACCTACTATTT (SEQ ID No: 5);
[0085] shSETD5-2:AGCGGTATTCCACTCATAAT(SEQ ID No:6);
[0086] shSETD5-3: CAACCGTGCTGCATCTAAATA (SEQ ID No: 7).
[0087] (2) Construction of the SETD5 gene knockdown vector
[0088] The designed SETD5 shRNA sequence was synthesized as a palindromic DNA sequence by Shanghai Sangon Biotech Co., Ltd. After annealing, the sequence was cloned into the linearized pLKO.1 plasmid vector (digested with AgeI and EcoRI). The recombinant plasmid vectors were amplified, extracted, and identified by double enzyme digestion, electrophoresis, and sequencing analysis. Three vector plasmids were obtained: pLKO.1-shSETD5-1, pLKO.1-shSETD5-2, and pLKO.1-shSETD5-3.
[0089] (3) Producing viruses
[0090] On the first day, HEK293T cells (80%-90%) that had grown to passage 3-5 were resuspended and seeded in 6cm culture dishes containing 4mL of DMEM medium (containing 10% FBS) and cultured in a 37℃, 5% CO2 incubator.
[0091] On the second day, when the cell density reaches approximately 60%-70%, transfection is performed. The transfection mixture is prepared as follows:
[0092]
[0093] On the third day, change the medium, discard the original culture medium, add 4 mL of DMEM culture medium containing 10% FBS, and place it in an incubator to continue culturing.
[0094] On the fourth day, collect the virus solution into 15mL centrifuge tubes, label them, and store them at 4°C. Centrifuge the virus solution (approximately 12mL) collected in the first three days, filter it through a 0.45μM filter, aliquot the supernatant into 1mL EP tubes, and freeze them at -80°C.
[0095] (4) Viral infection of target cells
[0096] On the first day, the target cells (selected as the A2780 cell line with high expression of SETD5) were seeded in 4 mL of DMEM culture medium containing 10% FBS, ensuring a density of about 30%, and incubated overnight at 37°C in a 5% CO2 incubator.
[0097] On the second day, discard the old culture medium, add 2 mL of DMEM culture medium containing 10% FBS and 2 mL of aliquoted virus supernatant to each well, and then add 4 μL of polybrene. Incubate overnight at 37°C in a 5% CO2 incubator.
[0098] On the third day, repeat the above steps.
[0099] On the fourth day, discard the old culture medium and add 4 mL of DMEM culture medium containing 1 μg / mL puromycin and 10% FBS to each well. Incubate overnight at 37°C in a 5% CO2 incubator.
[0100] On day 5, discard the old culture medium and add 4 mL of DMEM culture medium containing 1 μg / mL puromycin and 10% FBS to each well, and maintain culture for 1 week. After drug screening, the knockdown effect was verified by Q-PCR and Western blot experiments, and A2780 cells with stable SETD5 knockdown (denoted as SETD5-KD-A2780) were established.
[0101] Construction of a cell model stably overexpressing SETD5:
[0102] (1) Construction of human SETD5 gene expression vector
[0103] Based on the SETD5 gene sequence (RefSeq: NM_001080517), a pair of primers with EcoRI and BamHI double restriction sites were designed:
[0104] pCDH-SETD5-1 (EcoRI restriction site, SEQ ID No:8):
[0105] AGAAGATTCTAGAGCTAGCgaattcATGAGCATTGCAATCCCTCTGGGA
[0106] pCDH-SETD5-2 (BamHI restriction site, SEQ ID No:9):
[0107] GCAGATCCTTCGCGGCCGCggatccTTAGGAAAGTCCCGTCTGAGT).
[0108] The full-length human SETD5 cDNA sequence (RefSeq: NM_001080517) was amplified using RT-PCR, purified, and then digested with EcoRI-BamHI before being inserted into the eukaryotic expression vector pCDH-puro to construct the recombinant plasmid pCDH-puro-SETD5. The recombinant plasmid was identified by PCR, double enzyme digestion analysis, and DNA sequencing. Simultaneously, after transient transfection, the expression of SETD5 in transfected HEK293T cells was detected using RT-PCR and Western blot.
[0109] (2) Producing viruses
[0110] On the first day, HEK293T cells (80%-90%) that had grown to passage 3-5 were resuspended and seeded in 6cm culture dishes containing 4mL of DMEM medium (containing 10% FBS) and cultured in a 37℃, 5% CO2 incubator.
[0111] On the second day, when the cell density reaches approximately 60%-70%, transfection is performed. The transfection mixture is prepared as follows:
[0112] name quantity Remark pCDH-puro-SETD5 2μg none pHR'-CMV-VSVG 0.5μg none pHR'-CMV-8.2ΔVPR 1.5μg none Lipo8000 6.4μL none DMEM high-glucose complete medium 250μL Vicente Corporation, 319-005-CL
[0113] On the third day, change the medium, discard the original culture medium, add 4 mL of DMEM culture medium containing 10% FBS, and place it in an incubator to continue culturing.
[0114] On the fourth day, collect the virus solution into 15mL centrifuge tubes, label them, and store them at 4°C. Centrifuge the virus solution (approximately 12mL) collected in the first three days, filter it through a 0.45μM filter, aliquot the supernatant into 1mL EP tubes, and freeze them at -80°C.
[0115] (3) Viral infection of target cells
[0116] On the first day, the target cells (selected as SKOV3 cell line with low SETD5 expression) were seeded in 4 mL of DMEM culture medium containing 10% FBS, ensuring a density of about 30%, and incubated overnight at 37°C in a 5% CO2 incubator.
[0117] On the second day, discard the old culture medium, add 2 mL of DMEM culture medium containing 10% FBS and 2 mL of aliquoted virus supernatant to each well, and then add 4 μL of polybrene. Incubate overnight at 37°C in a 5% CO2 incubator.
[0118] On the third day, repeat the above steps.
[0119] On the fourth day, discard the old culture medium and add 4 mL of DMEM culture medium containing 1 μg / mL puromycin and 10% FBS to each well. Incubate overnight at 37°C in a 5% CO2 incubator.
[0120] On the fifth day, discard the old culture medium and add 4 mL of DMEM culture medium containing 1 μg / mL puromycin and 10% FBS to each well, and maintain culture for 1 week. After drug screening, the overexpression effect was verified by Q-PCR and Western blot experiments, and SKOV3 cells stably overexpressing SETD5 were established (denoted as SETD5-OE-SKOV3).
[0121] Cell migration ability test:
[0122] A2780 cells infected with pLKO.1 empty plasmid vector lentivirus were used as the control group. In this example, A2780 cells are denoted as shNC group in the figure, which is the negative control group. SETD5-KD-A2780 is the experimental group.
[0123] SKOV3 cells infected with pCDH empty plasmid vector lentivirus were used as the control group. In this example, SKOV3 cells are denoted as the pCDH group, i.e., the negative control group, and SETD5-OE-SKOV3 is the experimental group.
[0124] (1) The migration ability of cells was detected using the Transwell chamber model: 200 μL of DMEM culture medium containing 1% FBS was used to detect the migration ability of cells at a concentration of 1.5–2 × 10⁻⁶ cells / mL. 5Cell suspensions (A2780, SETD5-KD-A2780, SKOV3, and SETD5-OE-SKOV3 cells were used for experiments respectively) were seeded in the upper chamber of a Transwell chamber, and 500 μL of DMEM culture medium containing 20% FBS was added to the lower chamber. The chambers were incubated at 37°C and 5% CO2 for 24 h. Unmigrated cells on the upper surface of the membrane were wiped away with a cotton swab. Cells that migrated to the lower surface were fixed with 4% paraformaldehyde for 30 min, stained with crystal violet at room temperature for 15 min, and observed under a microscope. Five fields of view were randomly selected from each Transwell chamber, and the stained cells were counted. The relative migration rate was calculated as: number of migrating cells / total number of cells in the Transwell chamber.
[0125] (2) The cell migration ability was detected by scratch assay: A2780, SETD5-KD-A2780, SKOV3 and SETD5-OE-SKOV3 cells were seeded in 6-well plates (each cell type is different, and the cells were ensured to grow to 100% overnight); the next day, after the cells were confluent, 100 μL pipette tip was used to scratch the wells, and the cells were washed 3 times with PBS to remove the scratched cells. Then, DMEM culture medium containing 10% FBS was added and the cells were cultured in a cell culture incubator for 24 h or 72 h. Photos were taken at different time points according to the experimental needs. Finally, the wound closure was analyzed using ImageJ software.
[0126] Statistical analysis: SPSS 22.0 statistical software was used to analyze the statistical differences between experimental data. Mean ± SEM was used to represent the experimental data. The t-test was used to analyze the differences between two samples. P < 0.05 indicates that the difference is statistically significant.
[0127] Test results and analysis: such as Figure 2 As shown, shSETD5-1 and shSETD5-3 significantly reduced the expression level of SETD5 in A2780 ovarian cancer cells; compared with the control group (the control group in the figure is the shNC group, i.e., the negative control group: A2780 cells infected with pLKO.1 empty plasmid vector lentivirus), shSETD5-1 and shSETD5-3 significantly inhibited the migration ability of A2780 cells. Figure 3-4 Conversely, overexpression of SETD5 significantly promoted the migration ability of SKOV3 cells. Figure 5-7 The results suggest that SETD5 promotes the migration of ovarian cancer cells, opening up new directions for research on SETD5 in ovarian tumor metastasis, and potentially making it a new target.
[0128] Example 3: Effect of SETD5 on the proliferation ability of ovarian cancer cells
[0129] The cell lines used in this embodiment are: HEK293T cell line, and human ovarian cancer cell lines A2780, SETD5-KD-A2780, SKOV3, and SETD5-OE-SKOV3.
[0130] A2780 cells infected with pLKO.1 empty plasmid vector lentivirus were used as the control group. In this example, A2780 cells are denoted as shNC group in the figure, which is the negative control group. SETD5-KD-A2780 is the experimental group.
[0131] SKOV3 cells infected with pCDH empty plasmid vector lentivirus were used as the control group. In this example, SKOV3 cells are denoted as the pCDH group, i.e., the negative control group, and SETD5-OE-SKOV3 is the experimental group.
[0132] Cell proliferation capacity assay:
[0133] (1) Cell proliferation capacity was detected using the CCK8 assay: 8,000 cells (A2780, SETD5-KD-A2780, SKOV3, or SETD5-OE-SKOV3 cells, seeded at a density of 8,000 cells per type in 96-well plates, divided into 4 experimental groups for comparison and analysis between groups) were seeded in 96-well plates and cultured for 24, 48, 72, and 96 hours. At each time point, one group of cells (A2780 and SETD5-KD-A2780 cells; SKOV3 and SETD5-OE-SKOV3 cells; A2780 and SKOV3 cells served as control groups, and SETD5-KD-A2780 and SETD5-OE-SKOV3 cells served as experimental groups) were collected for CCK8 assay. Each well in all CCK8 experiments contained at least 1,000 cells, and each group had 5 replicates. The experimental methods followed the kit instructions. The absorbance (OD) value of each well was measured at a wavelength of 450 nm using an ELISA reader.
[0134] (2) Cell proliferation capacity was detected by cell counting: 2 × 10⁶ cells were seeded in each well of a 24-well plate. 4 Cells were cultured at 37°C and 5% CO2, with each well containing one cell (including A2780, SKOV3, SETD5-KD-A2780, or SETD5-OE-SKOV3 cells). Cell counts were then performed at 24h, 48h, 72h, and 96h. Finally, quantitative analysis was generated using Prism5 software.
[0135] Statistical analysis: SPSS 22.0 statistical software was used to analyze the statistical differences between experimental data. Mean ± SEM was used to represent experimental data. The t-test was used to analyze the differences between two samples, and the analysis of variance was used to analyze the differences between groups. P < 0.05 indicates that the difference is statistically significant.
[0136] Test results and analysis: such as Figure 8-10 As shown, knockdown of SETD5 significantly inhibited the proliferation of A2780 cells. Conversely, overexpression of SETD5 significantly promoted the proliferation of SKOV3 cells. Figure 11-13 The results suggest that SETD5 may serve as a novel therapeutic target for ovarian cancer, and agents capable of silencing the SETD5 gene could be used as therapeutic agents for ovarian cancer, which has significant clinical and social benefits in improving the efficacy of ovarian cancer treatment.
Claims
1. The use of an agent that inhibits the expression level of a SETD5 gene in the manufacture of a medicament for treating ovarian cancer, characterized in that, The agent includes an shRNA interfering with the expression of SETD5, the shRNA including: shSETD5-1: TTGTGGGCAAACCTACTATTT or shSETD5-3: CAACCGTGCTGCATCTAAATA.
2. Use according to claim 1, characterized in that, The application includes inhibiting the proliferation or migration ability of ovarian cancer cells.
Citation Information
Patent Citations
Compositions and methods for reactivating latent immunodeficiency virus
US20180002699A1