A single-domain antibody against pd-1

Abstract

The present application relates to the technical field of biotechnology, and particularly relates to a single-domain antibody against PD-1. The present application provides a single-domain antibody against PD-1, wherein the complementarity determining region of the single-domain antibody against PD-1 comprises CDR1 with an amino acid sequence as shown in any one of SEQ ID No. 5-6, CDR2 with an amino acid sequence as shown in any one of SEQ ID No. 9-12, and CDR3 with an amino acid sequence as shown in any one of SEQ ID No. 17-21. The single-domain antibody against PD-1 provided by the present application has specific binding capacity to PD-1, and can be used to further construct a fusion protein and the like, and the obtained fusion protein can further improve the expression of IFN-gamma and / or IL-2 in T lymphocytes, and can effectively inhibit the growth of tumors, and has good industrialization prospect.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a single-domain antibody against PD-1. BACKGROUND

[0002] Programmed death receptor-1 (PD-1) is an important immunosuppressive molecule, which, when combined with its ligand, inhibits T cell activation. PD-1 is mainly expressed on the surface of activated CD4+, CD8+ T cells, natural killer cells (NK), macrophages, B cells and some tumor cells.

[0003] The ligands of PD-1 include programmed death ligand 1 (PD-L1) and programmed death ligand 2 (PD-L2), of which PD-L1 is the main ligand.

[0004] During tumor development, cancer cells can induce apoptosis of T cells by up-regulating PD-L1 expression, thereby avoiding elimination by the immune system, leading to disease progression. In recent years, the use of monoclonal antibody drugs targeting PD-1 / PD-L1 proteins has been used to block the binding of PD-1 / PD-L1, thereby promoting the activation and proliferation of T cells in the body, and achieving the purpose of killing tumor cells. It has been used in the treatment of various tumors such as melanoma, lymphoma, bladder cancer, non-small cell lung cancer, head and neck cancer, colon cancer, etc., and has achieved remarkable curative effect. Therefore, the PD1 / PD-L1 pathway has become an important target for anti-tumor drug research. At present, antibody drugs that inhibit the PD1 / PD-L1 pathway have achieved great success in clinical practice. Among them, Nivolumab of BMS, Pemrolizumab of Merck, Atezolizumab of Roche, Avelumab of Merck, Durvalumab of AstraZeneca and Cemiplimab of Regeneron have been marketed. Antibody drugs targeting the PD1 / PD-L1 pathway have become the most promising field in the tumor treatment market.

[0005] Compared with large molecule monoclonal antibodies, single domain antibodies (VHH), especially single domain antibodies derived from llamas, are gradually becoming a rising star in the field of tumor treatment. This is due to the unique properties of llama-derived single domain antibodies: 1) high sequence homology with human VH family 3 and 4, making it weakly immunogenic; 2) small molecular weight, only about 15 kDa, simple structure, easy to express in microorganisms in large quantities, and easy to purify. The unique properties and low cost of single domain antibodies greatly expand their application range and show their value in the treatment and diagnosis of diseases. However, in the prior art, it is still not easy to obtain single domain antibodies with high affinity, high specificity and industrialization prospects, because the screening of antibodies with only three complementarity determining regions (CDRs) to play a binding antigen role is much more difficult than that of antibodies with 6 CDRs to play a binding antigen role, which also makes the current mainstream antibodies that are truly commercialized or preclinical in research still large molecular weight monoclonal antibodies. SUMMARY

[0006] In view of the above-mentioned disadvantages of the prior art, the purpose of the present application is to provide a single domain antibody against PD-1 for solving the problems in the prior art.

[0007] To achieve the above-mentioned purpose and other related purposes, one aspect of the present application provides a single domain antibody against PD-1, wherein the complementarity determining region of the single domain antibody against PD-1 comprises CDR1 with an amino acid sequence as shown in any one of SEQ ID No. 5-6, CDR2 with an amino acid sequence as shown in any one of SEQ ID No. 9-12, and CDR3 with an amino acid sequence as shown in any one of SEQ ID No. 17-21.

[0008] Another aspect of the present application provides a fusion protein comprising a first domain and a second domain, wherein the first domain comprises the above-mentioned single domain antibody against PD-1, and the second domain comprises a domain with the function of prolonging the half-life in vivo and / or a domain with the function of binding to effector cells.

[0009] Another aspect of the present application provides an isolated polynucleotide encoding the above-mentioned single domain antibody against PD-1 or the above-mentioned fusion protein.

[0010] Another aspect of the present application provides a construct comprising the above-mentioned isolated polynucleotide.

[0011] Another aspect of the present application provides an antibody expression system comprising the above-mentioned construct or the genome integrated with the above-mentioned polynucleotide.

[0012] Another aspect of the present application provides a method for preparing the anti-PD-1 single-domain antibody or the fusion protein, comprising the following steps: culturing the expression system of the antibody or the fusion protein under conditions suitable for expressing the antibody or the fusion protein, thereby expressing the antibody or the fusion protein, and purifying and separating the antibody or the fusion protein.

[0013] Another aspect of the present application provides the use of the anti-PD-1 single-domain antibody or the fusion protein in the preparation of a medicament for treating tumors.

[0014] Another aspect of the present application provides a pharmaceutical composition comprising the anti-PD-1 single-domain antibody or the fusion protein. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 A schematic diagram showing the blocking curve of the Anti-PD1-Fc fusion protein on the PD-L1 / PD-1 interaction in Example 6 of the present application.

[0016] Figure 2 A schematic diagram showing the detection of the Anti-PD1-Fc fusion protein in vitro cell activity by the reporter gene method in Example 7 of the present application.

[0017] Figure 3 A schematic diagram showing the effect of the Anti-PD1-Fc fusion protein on the IL-2 secretion of mixed lymphocytes in Example 8 of the present application.

[0018] Figure 4 A schematic diagram showing the inhibitory effect of the Anti-PD1-Fc fusion protein on tumor growth in Example 9 of the present application. DETAILED DESCRIPTION

[0019] In order to make the purposes, technical solutions and beneficial technical effects of the present application clearer, the present application will be further described in detail below in combination with examples, and those skilled in the art can easily understand other advantages and effects of the present application from the contents disclosed in the present description.

[0020] The present inventors have unexpectedly found an anti-PD-1 single-domain antibody through a large number of exploratory researches, and the anti-PD-1 single-domain antibody has good specificity and can effectively block the PD-L1 / PD-1 interaction, and the present application is completed on this basis.

[0021] In the present application, the terms "programmed death receptor 1", "PD-receptor 1", "PD-1", "PD1", "CD279" can be used interchangeably, including variants, isoforms, homologs of different species, etc.

[0022] In the present application, the term "monoclonal antibody" refers to a preparation of antibody molecules of single molecular composition. Monoclonal antibodies display single binding specificity and affinity to a particular epitope.

[0023] In the present application, the term "domain" (of a polypeptide or protein) generally refers to a folded protein structure that is able to maintain its tertiary structure independently of the rest of the protein. Generally, a domain is responsible for a single functional property of the protein, and in most cases, the addition or removal of a particular domain does not affect the function of the rest of the polypeptide or protein and / or the domain.

[0024] In the present application, the term "single (structural) domain antibody (VHH)" generally refers to an immunoglobulin domain comprising four "framework regions" designated "framework region 1" or "FR1", "framework region 2" or "FR2", "framework region 3" or "FR3", and "framework region 4" or "FR4", respectively, in the art and herein, which are interrupted by three "complementarity determining regions" or "CDRs" designated "complementarity determining region 1" or "CDR1", "complementarity determining region 2" or "CDR2", and "complementarity determining region 3" or "CDR3", respectively. Thus, the general structure or sequence of a single domain antibody (VHH) can be represented as follows: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. A single domain antibody (VHH) confers specificity of an antibody to an antigen by having an antigen binding site.

[0025] In the present application, the terms "single domain antibody", "single domain antibody", "heavy chain single domain antibody", "VHH domain", "VHH", "VHH antibody fragment", and "VHH antibody" are used interchangeably.

[0026] In the present application, the term "IMGT numbering system" generally refers to an integrated information system specifically for immunoglobulins (IG), T cell receptors (TCR) and major histocompatibility complex (MHC) of human and other vertebrates, i.e. THE INTERNATIONAL IMMUNOGENETICS INFORMATION SYSTEM (Lafranc et al., 2003, Dev. Comp. Immunol. 27(1):55-77). Antibody light and heavy chain genes are analyzed, at the IMGT® website (http: / / www.imgt.org / IMGT_vquest), to determine the framework regions (FR) and complementarity determining regions (CDR) of the variable regions. The "location" of CDRs within the structure of immunoglobulin variable domains is conserved between species and occurs in structures called "loops," so CDR and framework residues are readily identified by using a numbering system that aligns variable domain sequences according to structural features. This information can be used to graft and replace CDR residues from an immunoglobulin of one species into an acceptor framework, often from a human antibody. Unless otherwise indicated, in the specification, claims and figures, single domain antibodies against PD-1 are numbered following the IMGT numbering system method to determine CDR regions and FR regions.

[0027] In the present application, the term "humanized antibody" generally refers to a molecule having an antigen binding site substantially from a non-human immunoglobulin, whose immunoglobulin structure is based on the structure and / or sequence of a human immunoglobulin. The antigen binding site can comprise the entire variable domain fused to a constant domain, or only the complementarity determining regions (CDRs) grafted into appropriate framework regions of the variable domain. The antigen binding site can be wild-type or modified by one or more amino acid substitutions, for example to more closely resemble a human immunoglobulin. Certain forms of humanized antibodies retain all of the CDR sequences (e.g., humanized single domain antibodies containing all three CDRs from a llama). Other forms have one or more CDRs that are altered relative to the original antibody.

[0028] In the present application, "sequence identity" between two polypeptide sequences generally indicates the percentage of identical amino acids between the sequences. "Sequence identity" indicates the percentage of amino acids that are identical amino acid substitutions. Methods for assessing the degree of sequence identity between amino acids or nucleotides are known to those of skill in the art. For example, amino acid sequence identity is typically measured using sequence analysis software. For example, the BLAST program of the NCBI database can be used to determine identity.

[0029] In the present application, an "effective amount" of an agent generally refers to the amount necessary to bring about a desired physiological change in cells or tissues to which it is administered. A "therapeutically effective amount" of an agent (e.g., a pharmaceutical composition) refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic or prophylactic result. For example, to eliminate, reduce, delay, minimize, or prevent adverse effects of a disease.

[0030] In the present application, an "individual" or "subject" is generally a mammal. Mammals can be domesticated animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats), and the like.

[0031] In the present application, the term "pharmaceutical composition" refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the composition would be administered.

[0032] In the present application, a "pharmaceutically acceptable carrier" refers to a component other than the active ingredient in a pharmaceutical composition that is not toxic to a subject. Pharmaceutically acceptable carriers include, but are not limited to, buffers, excipients, stabilizers, or preservatives.

[0033] In a first aspect of the present application, there is provided an anti-PD-1 single-domain antibody. The single-domain antibody generally refers to a type of antibody molecule in which the light chain is missing, and only the heavy chain variable region is present. The antigen-binding property of an antibody is generally determined by three complementarity determining regions (CDRs), which can be arranged in order with FR regions that do not directly participate in the binding reaction. These CDRs can form a loop structure, and the beta sheet formed by the FRs therebetween is close in spatial structure, constituting the antigen binding site of the antibody. The complementarity determining region (CDR) of the anti-PD-1 single-domain antibody described above can include a CDR1 having an amino acid sequence as set forth in any one of SEQ ID Nos. 5-6, a CDR2 having an amino acid sequence as set forth in any one of SEQ ID Nos. 9-12, and a CDR3 having an amino acid sequence as set forth in any one of SEQ ID Nos. 17-21.

[0034] In a specific embodiment of the present application, the complementarity determining region of the anti-PD-1 single-domain antibody includes a CDR1 having an amino acid sequence as set forth in SEQ ID No. 5, a CDR2 having an amino acid sequence as set forth in SEQ ID No. 9, and a CDR3 having an amino acid sequence as set forth in SEQ ID No. 17.

[0035] In another specific embodiment of the present application, the complementarity determining region of the single-domain antibody against PD-1 comprises CDR1 with the amino acid sequence as shown in SEQ ID No. 6, CDR2 with the amino acid sequence as shown in SEQ ID No. 11, and CDR3 with the amino acid sequence as shown in SEQ ID No. 19.

[0036] In another specific embodiment of the present application, the complementarity determining region of the single-domain antibody against PD-1 comprises CDR1 with the amino acid sequence as shown in SEQ ID No. 6, CDR2 with the amino acid sequence as shown in SEQ ID No. 11, and CDR3 with the amino acid sequence as shown in SEQ ID No. 19.

[0037] In another specific embodiment of the present application, the complementarity determining region of the single-domain antibody against PD-1 comprises CDR1 with the amino acid sequence as shown in SEQ ID No. 6, CDR2 with the amino acid sequence as shown in SEQ ID No. 10, and CDR3 with the amino acid sequence as shown in SEQ ID No. 18.

[0038] In another specific embodiment of the present application, the complementarity determining region of the single-domain antibody against PD-1 comprises CDR1 with the amino acid sequence as shown in SEQ ID No. 6, CDR2 with the amino acid sequence as shown in SEQ ID No. 12, and CDR3 with the amino acid sequence as shown in SEQ ID No. 20.

[0039] In another specific embodiment of the present application, the complementarity determining region of the single-domain antibody against PD-1 comprises CDR1 with the amino acid sequence as shown in SEQ ID No. 6, CDR2 with the amino acid sequence as shown in SEQ ID No. 9, and CDR3 with the amino acid sequence as shown in SEQ ID No. 21.

[0040] The single-domain antibody against PD-1 provided by the present application can further comprise a framework region (FR). The framework region FR can comprise FR1 with the amino acid sequence as shown in any one of SEQ ID No. 1-3, FR2 with the amino acid sequence as shown in SEQ ID No. 7, FR3 with the amino acid sequence as shown in any one of SEQ ID No. 13-15, SEQ ID No. 28-29, and FR4 with the amino acid sequence as shown in any one of SEQ ID No. 31-32.

[0041] In another embodiment of the present application, the framework region FR includes FR1 of the amino acid sequence as shown in SEQ ID No. 1, FR2 of the amino acid sequence as shown in SEQ ID No. 7, FR3 of the amino acid sequence as shown in SEQ ID No. 14, and FR4 of the amino acid sequence as shown in SEQ ID No. 32.

[0042] In another embodiment of the present application, the framework region FR includes FR1 of the amino acid sequence as shown in SEQ ID No. 1, FR2 of the amino acid sequence as shown in SEQ ID No. 7, FR3 of the amino acid sequence as shown in SEQ ID No. 14, and FR4 of the amino acid sequence as shown in SEQ ID No. 32.

[0043] In another embodiment of the present application, the framework region FR includes FR1 of the amino acid sequence as shown in SEQ ID No. 1, FR2 of the amino acid sequence as shown in SEQ ID No. 7, FR3 of the amino acid sequence as shown in SEQ ID No. 15, and FR4 of the amino acid sequence as shown in SEQ ID No. 31.

[0044] In another embodiment of the present application, the framework region FR includes FR1 of the amino acid sequence as shown in SEQ ID No. 1, FR2 of the amino acid sequence as shown in SEQ ID No. 7, FR3 of the amino acid sequence as shown in SEQ ID No. 28, and FR4 of the amino acid sequence as shown in SEQ ID No. 31.

[0045] In another embodiment of the present application, the framework region FR includes FR1 of the amino acid sequence as shown in SEQ ID No. 2, FR2 of the amino acid sequence as shown in SEQ ID No. 7, FR3 of the amino acid sequence as shown in SEQ ID No. 28, and FR4 of the amino acid sequence as shown in SEQ ID No. 31.

[0046] In another embodiment of the present application, the framework region FR includes FR1 of the amino acid sequence as shown in SEQ ID No. 3, FR2 of the amino acid sequence as shown in SEQ ID No. 7, FR3 of the amino acid sequence as shown in SEQ ID No. 29, and FR4 of the amino acid sequence as shown in SEQ ID No. 31.

[0047] The anti-PD-1 single-domain antibody provided by the present application can be selected from: a) a single-domain antibody having an amino acid sequence comprising one of SEQ ID No. 34-39; or b) a single-domain antibody having an amino acid sequence having more than 80% sequence identity with one of SEQ ID No. 34-39 and having the function of the single-domain antibody defined in a). Specifically, the single-domain antibody in b) has an amino acid sequence obtained by substituting, deleting or adding one or more (specifically 1-50, 1-30, 1-20, 1-10, 1-5, or 1-3) amino acids to the amino acid sequence of one of SEQ ID No. 34-39, or adding one or more (specifically 1-50, 1-30, 1-20, 1-10, 1-5, or 1-3) amino acids to the N-terminus and / or C-terminus, and has the function of the single-domain antibody having an amino acid sequence of one of SEQ ID No. 34-39, such as the ability to specifically bind to PD-1, thereby specifically binding to cells expressing PD-1, the ability to block PD-L1 / PD-1 interaction, thereby blocking the PD-L1 / PD1 pathway (e.g., blocking the binding of PD-1 / PD-L1 on the surface of effector cells and target cells), the ability to increase IFN-γ and / or IL-2 expression in T lymphocytes, and the ability to inhibit tumor growth. The amino acid sequence of the single-domain antibody in b) can have more than 80%, 85%, 90%, 93%, 95%, 97%, or 99% identity with one of SEQ ID No. 42-49.

[0048] The anti-PD-1 single-domain antibody provided by the present application can be derived from a vicugna (Vicugna pacos), and the overall molecular weight can be about half of that of a single-chain antibody (scFv), thereby effectively reducing the molecular weight of the overall structure, thereby enhancing tissue penetration, more effectively reaching target tissues and organs, improving therapeutic effect, and this structure is easier to prepare than a structure having two scFv in series.

[0049] The anti-PD-1 single-domain antibody provided by the present application can be a humanized antibody. The humanized antibody can be obtained by humanizing the single-domain antibody described above, thereby further improving the drug safety and effectively reducing the immunogenicity of the antibody. Fully humanized heavy chain antibodies often face the problem of poor solubility leading to protein aggregation, thereby cannot be used in actual clinical practice. The decrease in solubility caused by humanization of the single-domain antibody can be due to the lack of light chains paired with the VHH domain of the natural Ig class monoclonal antibody (Front Immunol. 2017 Nov 22; 8: 1603). However, the humanized antibody provided by the present application, which is modified in the framework region, still maintains a high solubility, making it possible to be used in actual clinical practice. The framework region FR of the humanized anti-PD-1 single-domain antibody can include FR1 to FR4 with the amino acid sequences as shown below: the framework region FR includes FR1 with the amino acid sequence as shown in SEQ ID No. 4, FR2 with the amino acid sequence as shown in any one of SEQ ID Nos. 7 to 8, FR3 with the amino acid sequence as shown in SEQ ID No. 16, and FR4 with the amino acid sequence as shown in SEQ ID No. 33.

[0050] In a specific embodiment of the present application, the framework region FR includes FR1 with the amino acid sequence as shown in SEQ ID No. 4, FR2 with the amino acid sequence as shown in SEQ ID No. 7, FR3 with the amino acid sequence as shown in SEQ ID No. 16, and FR4 with the amino acid sequence as shown in SEQ ID No. 33.

[0051] In another specific embodiment of the present application, the framework region FR includes FR1 with the amino acid sequence as shown in SEQ ID No. 4, FR2 with the amino acid sequence as shown in SEQ ID No. 8, FR3 with the amino acid sequence as shown in SEQ ID No. 16, and FR4 with the amino acid sequence as shown in SEQ ID No. 33.

[0052] The anti-PD-1 single-domain antibody provided by the present application can be a humanized anti-PD-1 single-domain antibody, and can be selected from the group consisting of: c) a single-domain antibody having an amino acid sequence comprising one of SEQ ID No. 40-51; or d) a single-domain antibody having an amino acid sequence having more than 80% sequence identity with one of SEQ ID No. 40-51 and having the function of the single-domain antibody defined in c). Specifically, the single-domain antibody in d) above refers to a single-domain antibody having an amino acid sequence as one of SEQ ID No. 40-51 after substitution, deletion or addition of one or more (specifically 1-50, 1-30, 1-20, 1-10, 1-5, or 1-3) amino acids, or addition of one or more (specifically 1-50, 1-30, 1-20, 1-10, 1-5, or 1-3) amino acids at the N-terminus and / or C-terminus, and having the function of the single-domain antibody having an amino acid sequence as one of SEQ ID No. 40-51, for example, can be the specific binding ability to PD-1, so as to specifically bind to cells expressing PD-1, can block the PD-L1 / PD-1 interaction, so as to block the PD-L1 / PD1 pathway (for example, block the binding of PD-1 / PD-L1 on the surface of effector cells and target cells), can improve the expression of IFN-γ and / or IL-2 in T lymphocytes, and can inhibit tumor growth. The amino acid sequence of the single-domain antibody in d) can have more than 80%, 85%, 90%, 93%, 95%, 97%, or 99% identity with one of SEQ ID No. 40-51.

[0053] The second aspect of the present application provides a fusion protein comprising a first domain and a second domain, the first domain comprising the anti-PD-1 single-domain antibody provided by the first aspect of the present application, and the second domain comprising a domain having the effect of prolonging the half-life in vivo and / or a domain having the effect of binding to effector cells. The fusion protein can be a binding molecule, so as to specifically bind to cells expressing PD-1.

[0054] In the fusion protein provided by the present application, the domain having the effect of prolonging the half-life in vivo can include one or more of a combination of serum albumin (e.g., HSA of human origin, etc.) or a fragment thereof, a domain binding to serum albumin (e.g., an anti-serum albumin antibody, including a single domain antibody), polyethylene glycol, a polyethylene glycol-liposome complex, and the immunoglobulin Fc region is preferably a human immunoglobulin Fc region. The domain having the effect of binding to an effector cell can include an immunoglobulin Fc region, and the immunoglobulin Fc region is preferably a human immunoglobulin Fc region. The human immunoglobulin Fc region can further include a mutation for eliminating, weakening, or enhancing Fc-mediated effector functions, which can include one or more of a combination of CDC activity, ADCC activity, ADCP activity, etc. The above immunoglobulin can be one or more of a combination of IgG, IgA1, IgA2, IgD, IgE, IgM, etc., and IgG can be one or more of a combination of IgG1, IgG2, IgG3, or IgG4 subtype, etc. The immunoglobulin Fc region included in the single domain antibody fusion protein can allow the fusion protein to form a dimer, while prolonging the half-life of the fusion protein in vivo and increasing Fc-mediated related activities. The immunoglobulin Fc region can be an Fc region of human IgG1, and more specifically a wild type IgG1 Fc sequence, which can be introduced with a mutation for eliminating, weakening, or enhancing Fc-mediated effector functions, such as i) a mutation for eliminating, weakening, or enhancing Fc-mediated CDC activity; or, ii) a mutation for eliminating, weakening, or enhancing Fc-mediated ADCC activity; or, iii) a mutation for eliminating, weakening, or enhancing Fc-mediated ADCP activity. Such mutations are described in the following documents: Leonard G Presta, Current Opinion in Immunology 2008, 20:460-470; Esohe E. Idusogie et al., J Immunol 2000, 164:4178-4184; RAPHAEL A. CLYNES et al., Nature Medicine, 2000, Volume 6, Number 4:443-446; Paul R. Hinton et al., J Immunol, 2006, 176:346-356. In a specific embodiment of the present application, the amino acid sequence of the immunoglobulin Fc region includes one of the sequences shown in SEQ ID Nos. 52-53, 74-79.

[0055] In the fusion protein provided by the present application, a linker peptide can be further provided between the first domain and the second domain. The linker peptide can generally be a flexible polypeptide with appropriate length composed of glycine (G) and / or serine (S) and / or alanine (A) and / or threonine (T), which can maintain the correct folding of each domain of the bispecific antibody molecule and the flexibility between the domains. The length of the linker peptide can generally be 3-30, 3-6, 6-9, 9-12, 12-16, 16-20, 20-25, 25-30, 8, or 15 amino acids. For example, the amino acid sequence of the linker peptide fragment can include sequences such as (GS)n, (GGS)n, (GGSG)n, (GGGS)nA, (GGGGS)nA, (GGGGA)nA, (GGGGG)nA, etc., wherein n is an integer selected from 0-10, for example, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

[0056] In the fusion protein provided by the present application, the first domain and the second domain can be sequentially included from the N-terminus to the C-terminus. In a specific embodiment of the present application, the amino acid sequence of the fusion protein includes the amino acid sequence shown in any one of SEQ ID No. 58-69.

[0057] The third aspect of the present application provides an isolated polynucleotide encoding the single-domain antibody against PD-1 provided by the first aspect of the present application or the fusion protein provided by the second aspect of the present application. The polynucleotide can be RNA, DNA, or cDNA, etc. The method for providing the isolated polynucleotide should be known to those skilled in the art, for example, it can be prepared by automatic DNA synthesis and / or recombinant DNA technology, etc., and can also be isolated from suitable natural sources.

[0058] The fourth aspect of the present application provides a construct comprising the isolated polynucleotide of the third aspect of the present application. Methods for constructing the construct are known to those skilled in the art, for example, the construct can be constructed by in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombination techniques, and the like. More specifically, the construct can be constructed by inserting the isolated polynucleotide into a suitable vector, for example, a multiple cloning site of a vector. Those skilled in the art can select a suitable vector for constructing the construct. For example, the type of vector can be a bacterial plasmid, a bacteriophage, a yeast plasmid, a plant cell virus, a mammalian cell virus such as adenovirus, retrovirus, or other vectors, and the like. For another example, the vector can be an expression vector, or a cloning vector. The vector can further comprise one or more regulatory sequences operably linked to the polynucleotide sequence, which can include a suitable promoter sequence, a transcription terminator sequence, an enhancer sequence, and the like, and can further include a replication origin, convenient restriction sites, and one or more selectable markers, and the like. The promoter sequence is typically operably linked to the coding sequence of the amino acid sequence to be expressed. The promoter can be any nucleotide sequence that shows transcriptional activity in the host cell of choice including mutated, truncated, and hybrid promoters, and can be derived from genes either homologous or heterologous to the host cell. For example, the promoters can be the lac or trp promoters of E. coli; the PL promoter of bacteriophage lambda; eukaryotic promoters including the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, the promoters of retroviral genes, the promoters of the methanol oxidase gene of Pichia pastoris, and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses. The regulatory sequence can further include a suitable transcription terminator sequence, a sequence recognized by a host cell for termination of transcription. The terminator sequence is located 3' to the nucleotide sequence encoding the polypeptide and is functionally linked to the 3' end of the nucleotide sequence encoding the polypeptide. Any terminator that is functional in the host cell of choice can be used in the present application. The marker gene can be used to provide a phenotypic trait for selection of transformed host cells, for example, can be dihydrofolate reductase for eukaryotic cell culture, neomycin resistance, and green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli, and the like. The enhancer sequence can be included in the expression vector if the insertion of the enhancer sequence in the vector results in an increase in the transcription of the polynucleotide. Enhancers are cis-acting elements of DNA, usually about 10 to 300 base pairs in length, that act to increase the transcription of a gene.

[0059] The fifth aspect of the present application provides an expression system of the antibody, which comprises the construct or the genome of the fourth aspect of the present application, or the polynucleotide of the third aspect of the present application integrated into the genome, so as to express the single-domain antibody against PD-1 or the fusion protein. Any cell suitable for expression of the expression vector can be used as a host cell. For example, the host cell can be a prokaryotic cell such as a bacterial cell, a lower eukaryotic cell such as a yeast cell, a filamentous fungal cell, or a higher eukaryotic cell such as a mammalian cell. More specifically, the host cell can be, for example, a bacterial cell of Escherichia coli, Streptomyces, Salmonella typhimurium, a fungal cell such as yeast, filamentous fungi, a plant cell, an insect cell such as Drosophila S2 or Sf9, an animal cell such as CHO, COS, 293 cell, or Bowes melanoma cell, etc. Methods for constructing the expression system are known to those skilled in the art, for example, microinjection, gene gun, electroporation, virus-mediated transformation, electron bombardment, calcium phosphate precipitation, etc.

[0060] The sixth aspect of the present application provides a method for preparing the single-domain antibody against PD-1 of the first aspect of the present application or the fusion protein of the second aspect of the present application, which comprises the following steps: culturing the expression system of the antibody under conditions suitable for expression of the antibody or the fusion protein, so as to express the antibody or the fusion protein, and purifying and isolating the antibody or the fusion protein.

[0061] The seventh aspect of the present application provides use of the single-domain antibody of the first aspect of the present application or the fusion protein of the second aspect of the present application in the preparation of a medicament and / or a pharmaceutical agent for diagnosis, treatment of a disease related to a cell expressing PD-1. The single-domain antibody of the present application can specifically bind to PD-1, so as to specifically bind to a cell expressing PD-1 and block the interaction between PD-L1 and PD-1, and can also increase the expression of IFN-γ and / or IL-2 in T lymphocytes, so as to be used in the preparation of a medicament and / or a pharmaceutical agent.

[0062] In the use of the present application, the disease related to a cell expressing or not expressing PD-1 can be cancer, tumor entity, etc., and can be, for example, lung cancer, melanoma, gastric cancer, ovarian cancer, colon cancer, liver cancer, kidney cancer, bladder cancer, breast cancer, classical Hodgkin's lymphoma, hematological malignancies, head and neck cancer, and nasopharyngeal cancer, etc. These cancers can be early, intermediate or advanced, for example, metastatic cancer.

[0063] The ninth aspect of the present application provides a pharmaceutical composition comprising the anti-PD-1 single-domain antibody provided by the first aspect of the present application, the fusion protein provided by the second aspect of the present application, or the culture of the expression system provided by the fifth aspect of the present application. In the pharmaceutical composition, the anti-PD-1 single-domain antibody, the fusion protein, or the culture is generally in a therapeutically effective amount. The pharmaceutical composition can further comprise a pharmaceutically acceptable carrier. Such pharmaceutically acceptable carriers can include various excipients and diluents, which are not essential active ingredients themselves and have no excessive toxicity after administration. Suitable carriers are well known to those skilled in the art, for example, a full discussion of pharmaceutically acceptable carriers can be found in Remington's Pharmaceutical Sciences (Mack Pub. Co., N.J., 1991). In a preferred embodiment of the present application, the pharmaceutical composition can be administered by injection, and thus the pharmaceutical composition is preferably a powder injection (e.g., a freeze-dried powder injection) and a liquid preparation.

[0064] In the above-mentioned pharmaceutical, pharmaceutical composition, or the like, the above-mentioned substance (e.g., single-domain antibody, fusion protein, culture, or the like) can be a single pharmaceutical active ingredient or can be combined with other active ingredients.

[0065] The tenth aspect of the present application provides a treatment method comprising administering to an individual a therapeutically effective amount of the anti-PD-1 single-domain antibody provided by the first aspect of the present application, the fusion protein provided by the second aspect of the present application, the culture of the expression system of the antibody provided by the fifth aspect of the present application, or the pharmaceutical composition provided by the ninth aspect of the present application. The treatment method provided by the present application can be used to treat tumors and the like or other indications. The selection of a therapeutically effective amount is generally determined by those skilled in the art according to various factors (e.g., through clinical trials), for example, when the above-mentioned substance is administered to an individual, the growth, proliferation, recurrence, and / or metastasis of a tumor can be inhibited, more specifically, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the growth, proliferation, recurrence, and / or metastasis of a tumor is inhibited.

[0066] The anti-PD-1 single-domain antibody provided by the present application has specific binding ability to PD-1 and can be used to further construct a fusion protein and the like. The obtained fusion protein can further improve the expression of IFN-γ and / or IL-2 in T lymphocytes and can effectively inhibit the growth of tumors, and has good prospects for industrialization.

[0067] The application of the present application is further illustrated by the following examples, but the scope of the present application is not limited thereto.

[0068] Unless otherwise indicated, the experimental methods, detection methods, preparation methods disclosed in the present application all use conventional techniques in the field of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology and related fields. These techniques are well described in the existing literature, see Sambrook et al. MOLECULAR CLONING: A LABORATORY MANUAL, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel et al. CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and periodic updates; the series METHODS IN ENZYMOLOGY, Academic Press, San Diego; Wolffe, CHROMATIN STRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998; METHODS IN ENZYMOLOGY, Vol. 304, Chromatin (P. M. Wassarman and A. P. Wolffe, eds.), Academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol. 119, Chromatin Protocols (P. B. Becker, ed.) Humana Press, Totowa, 1999, etc.

[0069] Example 1

[0070] Construction of single-domain antibody library against PD1

[0071] A fusion protein hPD1-HSA (SEQ ID NO: 54) composed of PD1 ectodomain sequence and human serum albumin sequence, 1 mg and 1 ml of Freund's complete adjuvant (Sigma) were mixed and emulsified, and a healthy alpaca (Vicugna pacos) was immunized, and then immunized again after 21 days, for a total of 3 times of immunization, to stimulate B cells to express antigen-specific single domain antibodies. One week after the 3 immunizations, 30 ml of alpaca blood was collected in a vacuum blood collection tube, and lymphocytes were separated by lymphocyte separation medium (Tianjin Haoyang Huake Biotechnology Co., Ltd.), and total RNA was extracted by Trizol method. 3 μg of total RNA was reverse transcribed into cDNA using a reverse transcription kit (Invitrogen) according to the instructions, and VHH was amplified by nested PCR. The target VHH nucleic acid fragment was recovered and digested with restriction enzyme SfiI (NEB), and inserted into the same enzyme-digested phage display vector pcomb3xss (Addgene plasmid #63890; RRID: Addgene_63890) and ligated by T4 ligase (Takara). The ligation product was transformed into electrocompetent cells ER2738 to construct a single domain antibody library against PD1. The library size was determined to be 1.5×10 8 At the same time, 25 clones were randomly picked for colony PCR detection, and the results showed that the insertion rate of the constructed library was 100%.

[0072] Example 2

[0073] Screening and identification of anti-PD1 single domain antibodies

[0074] 2.1 Screening of anti-PD1 single domain antibodies

[0075] The constructed anti-PD1 single domain antibody library was packaged with helper phage M13KO7 (NEB), and the recombinant phage titer of the display library was determined to be 8.5×10 12 PFU / ml. hPD1-HSA was diluted to 2 μg / ml with 100 mM NaHCO3 (pH 8.2) coating solution, added to an enzyme-labeled plate at 100 μL / well, and placed at 4°C overnight. The next day, PBST (containing 0.1% Tween 20 in PBS) was washed 5 times, 200 μL of 3% BSA was added for blocking at 37°C for 1 h, and then 100 μL of recombinant phage (about 1.5×10 11PFU / well, from the library constructed in Example 1), for 1 h at room temperature. After that, the non-specific binding phage was removed by washing with PBST for 5 times. The washed microplate wells were incubated with 1 ml of 0.1 M gly-HCl + 1 mg / ml BSA (pH 2.2) buffer for 10 min for elution, and neutralized with 1 M Tris-HCl, pH 8.0. The phage titer was determined to be 4.45 x 10 6 PFU / ml. The above phage eluate was amplified, and the titer was determined to be 1.6 x 10 13 PFU / ml. Using the fusion protein hPD1-Fc (SEQ ID NO: 56) composed of the PD-1 extracellular domain sequence and human IgG1 FC as the coating protein, 3% ovalbumin (OVA) for blocking, the same screening process was used for the second round of screening, and the phage titer of the second round of panning was determined to be 1.96 x 10 8 PFU / ml.

[0076] 2.2 Enzyme-linked immunoassay (ELISA) and TEPITOPE double screening

[0077] 400 single clones were picked from the second round of panning phage titer determination plate and cultured in 96-well plates, and infected with M13KO7 helper phage for packaging to obtain the accumulation of recombinant phage in the supernatant.

[0078] hPD1-Fc was coated at 200 ng / well and blocked with skimmed milk powder at room temperature for 1 h, and 100 ul / well of the supernatant of the single clone recombinant phage was added after being diluted 1-fold with PBS, and incubated at 37°C for 1 h. After washing with PBST for 3 times, 100 ul of Anti-M13 Antibody (HRP) (Yiqiao Shizhou) diluted 1:10,000 was added to each well, and incubated at 37°C for 1 h. After washing with PBST for 3 times, TMB color developing working solution (Beijing Kangwei Shijie Biotechnology Co., Ltd.) was added, and incubated at room temperature for 5 min for color development, then 1 M sulfuric acid was added to terminate the reaction, and OD450nm was read. Most of the OD450nm was greater than 3, indicating positive binding.

[0079] The monoclonal recombinant phage supernatant was mixed with 4 μg / mL of Bio-hPDL1-HSA (biotin-labeled, self-made) in a 96-well plate at the same ratio, and 100 μl / well was incubated in a 96-well plate pre-coated with 100 ng of hPD1-Fc; the Bio-hPDL1-HSA well without recombinant phage supernatant (diluted with PBS to 2 μg / mL) was used as a control, and incubated at 37°C for 1 hour. After washing with PBST for 3 times, 100 μl of Streptavidin-HRP (Jackson ImmunoResearch Inc) diluted 1:50000 was added to each well, and incubated at 37°C for 1 hour. After washing with PBS for 3 times, TMB color developing working solution (Beijing Kangwei Shijishe Biotechnology Co., Ltd.) was added, and incubated at room temperature for 5 minutes for color development, then 1M sulfuric acid was added to terminate the reaction, and OD450nm was read. Among them, the control well developed obviously (OD450nm value was 1.16), and the phage competition positive clone well developed weakly or basically not (OD450nm value was lower than 0.2). The competition positive clone was selected for sequencing, and the repeated sequences were removed.

[0080] The CDR3 sequence of the obtained high-affinity positive sequence was further subjected to immunogenicity analysis, and the scores of DRB1*03:01, DRB1*07:01, DRB1*15:01, DRB3*01:01, DRB3*02:02, DRB4*01:01 and DRB5*01:01 alleles closely related to human immunogenicity were calculated by a prediction tool TEPITOPE based on QAM method (Sturniolo T et al., Nat. Biotechnol. 17: 555-561), and the sequences with a total CDR3 TEPITOPE score higher than 4 were excluded, and a high humanization degree of the anti-PD-1 single domain antibody sequence was further screened. The CDR3 TEPITOPE total score of the anti-PD-1 single domain antibody finally obtained by the application was mostly <-2.0, which was significantly lower than that of the same anti-PD-1 single domain antibody, indicating that the anti-PD-1 single domain antibody of the application had a lower potential immunogenicity risk.

[0081] After several rounds of screening, the inventors finally selected 6 strong positive clones of anti-PD1 single domain antibody sequences with low TEPITOPE scores. The full-length sequences are shown in Table 1a, and the CDR regions marked by IMGT are shown in underlined.

[0082] Table 1a

[0083]

[0084] The framework region (FR) and the complementarity determining region (CDR region) of each antibody are shown in Table 1b.

[0085] Table 1b

[0086]

[0087] The CDR3 TEPITOPE score is shown in Table 1c.

[0088] Table 1c

[0089]

[0090] Note: Control 1 is derived from the single-domain antibody against PD-1 shown in US2019 / 0322747A1 (SEQ ID No. 14). Control 2 is derived from the single-domain antibody against PD-1 shown in CN110256562A (SEQ ID No. 9). Control 3 is derived from the single-domain antibody against PD-1 shown in CN110003336A (SEQ ID No. 6).

[0091] Example 3

[0092] Preliminary evaluation of the single-domain antibody against PD-1

[0093] 3.1 Expression and purification of the single-domain antibody in host E. coli

[0094] The specific positive sequence plasmid obtained in the screening was used as a template for PCR amplification with high-fidelity enzyme GVP8 (Universal Biological Systems (Anhui) Co., Ltd.) to introduce a histidine tag coding sequence at the 3' end of the sequence. The PCR product was electrophoresed and the approximately 600 bp band was recovered by gel cutting. The recovered PCR product was digested with endonuclease NdeI (NEB Company) and EcoRI (NEB Company) and recombined with the pET32a+ vector (Novagen) digested with the recombination kit (Coastal Protein Technology Co., Ltd.) to construct an E. coli expression plasmid. The E. coli competent Top10F' was transformed, plated on ampicillin-resistant plates, and incubated in an incubator at 37°C overnight. Clones on the ampicillin-resistant plates were picked and plasmid sequencing was performed to determine the correct insertion of the sequence in the pET32a+ vector. The sequencing-determined E. coli expression plasmid was transformed into the E. coli expression host Rosetta (DE3) to construct an E. coli expression strain. The recombinant clones were picked, cultured on ampicillin-resistant plates, and induced to express overnight at 30°C with 1 mM IPTG. The bacteria solution induced to express overnight was subjected to ultrasonic disruption, centrifuged at 12000g at 4°C for 10 minutes, and the supernatant was purified with a Ni column (Borgolon Biotechnology Co., Ltd.) to achieve a final protein purity of more than 90%.

[0095] 3.2 Confirmation of specific binding of the purified single-domain antibody against PD-1 recombinant protein to human and mouse PD-1

[0096] Human hPDl-HSA, mouse mPDl-HSA (SEQ ID NO: 57) or HSA (purchased from Sigma) 200 ng / well were coated at 4°C overnight, and blocked with 5% skim milk at room temperature for 1 hour. The purified anti-PD-1 single-domain antibody with a histidine tag was diluted to 1 μg / mL, 100 μL per well, and incubated at 37°C for 1 hour. After 3 PBST washes, 100 μl / well of 1:5000 diluted mouse anti-his tag antibody (R&D Systems, Inc) was added, and incubated at room temperature for 1 hour. After PBST washing, 100 μl / well of 1:10000 diluted HRP-Goat anti-mouse IgG antibody (Thermo Scientific) was added, and incubated at room temperature for 1 hour. After PBST washing, TMB color developing solution (Beijing Kangwei Century Biotech Co., Ltd.) was added for color development, and the OD value was detected at 450 nm.

[0097] The detection results are shown in Table 2, and the results show that the 6 clones screened specifically bind to human PD-1. When coated with mouse mPDl-HSA fusion protein, the OD value of the anti-PD-1 single-domain antibody has no significant difference with the blank control group without the anti-PD-1 single-domain antibody, indicating that the 6 clones screened do not bind to mouse PD-1 (results not shown).

[0098] Table 2

[0099]

[0100] 3.3 Specific binding confirmation of purified anti-PD-1 single-domain antibody recombinant protein to monkey PD-1

[0101] The monkey RhPDl-HSA fusion protein (SEQ ID No. 30) was coated at 200 ng / well at 4°C overnight, and blocked with 5% skim milk at room temperature for 1 hour. The purified anti-PD-1 single-domain antibody with a histidine tag was diluted to 1 μg / mL, 100 μL per well, and incubated at 37°C for 1 hour. After 3 PBST washes, 100 μl / well of 1:5000 diluted mouse anti-his tag antibody (R&D Systems, Inc) was added, and incubated at room temperature for 1 hour. After PBST washing, 100 μl / well of 1:10000 diluted HRP-Goat anti-mouse IgG antibody (Thermo Scientific) was added, and incubated at room temperature for 1 hour. After PBST washing, TMB color development was added, and the OD value was detected at 450 nm.

[0102] The results show that the OD value of the anti-PD1 single-domain antibody is significantly different from the blank control group without adding the anti-PD1 single-domain antibody, indicating that the six clones screened are all combined with monkey PD-1.

[0103] Table 3

[0104]

[0105] Example 4

[0106] Humanization of anti-PD-1 single-domain antibody

[0107] The humanization method is performed by VHH humanization framework grafting method (Vincke C, Loris R, Saerens D, Martinez-Rodriguez S, Muyldermans S, Conrath K. J Biol Chem. 2009; 284(5): 3273-3284). According to the sequence homology design, the universal humanization VHH framework h-NbBcII10FGLA (PDB number: 3EAK) is completed, the corresponding CDR region is replaced with the CDR region of the anti-PD-1 single-domain antibody, and the individual amino acids of the FR2 region are further humanized according to the sequence of the humanized antibody DP-47 (SEQ ID NO: 73). Each anti-PD-1 single-domain antibody obtains a variety of humanization variants, while introducing more human amino acids as much as possible, and selects the humanization scheme with high solubility and less aggregate formation. The humanized single-domain antibody is expressed and purified according to Example 3.1.

[0108] The preferred VHH amino acid sequence after humanization is SEQ ID NO: 40-51, as shown in Table 4a, wherein the CDR region is indicated by an underline.

[0109] Table 4a

[0110]

[0111]

[0112] The framework region (FR) and the complementarity determining region (CDR region) of each humanization variant are shown in Table 4b.

[0113] Table 4b

[0114]

[0115]

[0116] The degree of humanization of each humanized single-domain antibody (by comparison of sequence identity with the closest human genes and alleles) was analyzed by IMGT / 3Dstructure-DB (website http: / / www.imgt.org) and can be referenced in Use of Databases and Tools for Antibody Engineering and Humanization, Marie-Paule Lefranc et al., Methods Mol Biol, 907:3-37, 2012. The results are shown in Table 4c.

[0117] Table 4c

[0118]

[0119] Note: 1) Control 1 is derived from the single-domain antibody against PD-1 shown in US2019 / 0322747A1 (SEQ ID No. 14). Control 2 is derived from the single-domain antibody against PD-1 shown in CN110256562A (SEQ ID No. 9). Control 3 is derived from the single-domain antibody against PD-1 shown in CN110003336A (SEQ ID No. 6).

[0120] 2) Bevacizumab HCDR3 is the heavy chain CDR3 sequence of the marketed mAb Bevacizumab, and Adalimumab HCDR3 is the heavy chain CDR3 sequence of the marketed mAb Adalimumab. 3) In the code of the single-domain antibody against PD-1, V1 and V3 represent two different humanized sequences.

[0121] Example 5

[0122] Preparation of Anti-PD1-Fc fusion protein with mammalian cells

[0123] 5.1 Expression and purification of the single-domain antibody against PD-1 and Fc fusion protein (Anti-PD1-Fc)

[0124] The specific positive sequences (SEQ ID NO: 34-39) and humanized sequences (SEQ ID NO: 40-51) obtained by screening were converted into respective base sequences according to the codon bias of CHO cells, and the full-length DNA was obtained by gene synthesis (Nanjing Kingsriver Biotechnology Co., Ltd.). The DNA was used as a template, and PCR amplification was performed using high-fidelity enzyme GVP8 (Anhui General Biotechnology Co., Ltd.). The PCR product was electrophoresed and about 600 bp of the band was recovered by gel cutting. The recovered PCR product was recombined with a pCDNA3.1 vector containing a signal peptide and a human IgG Fc sequence (SEQ ID NO: 53) to construct a cell expression plasmid for expressing an anti-PD-1 single-domain antibody and human IgG4 Fc fusion protein (Anti-PD1-Fc). The cell expression plasmid of Anti-PD1-Fc was extracted using an endotoxin-free plasmid extraction kit (Biomiga). The plasmid was mixed with transfection reagent PEI (Polysciences, Inc.) at a ratio of 1:3, and then incubated for 30 min. Then, the mixture was added to HEK293F cells, which were cultured in a 37°C, 5% CO2 incubator for 7 days. The supernatant was collected by centrifugation. The supernatant was adjusted to pH 7.0 and then loaded onto a Protein A affinity chromatography column (Bogu Biotech Co., Ltd.). Elution was performed using 100% 0.1M Gly-HCl (pH 3.0). The eluate was pre-added with 10% 1M Tris-HCl (pH 8.5). The 100% eluate was diluted to a conductivity of 4 ms / cm, and then adjusted to pH 5.5. The solution was centrifuged (8000 rpm, 4°C, 10 min), and the supernatant was adjusted to pH 5.0 and loaded onto a DSP chromatography column (Bogu Biotech Co., Ltd.). Linear elution was performed using 0-60% eluent (20mM NaAc, 0.5M NaCl, pH 5.0) at a flow rate of 2 ml / min for 15 min. SEC-HPLC-UV analysis was used to detect the purity. Detector: Agilent 1100 LC; detection wavelength: 214 nm; mobile phase: 150mM pH7.0 PB+5% isopropanol; column: Superdex200Increase 5 / 150GL; run time: 15 minutes; column temperature: 25°C. The detection results showed that the purity was greater than 95%.

[0125] Example 6

[0126] Identification of the function of Anti-PD1-Fc fusion protein in vitro

[0127] 6.1 Identification of the binding ability of Anti-PD1-Fc fusion protein to human PD-1

[0128] hPD1-HSA was coated on plates at 200 ng / well at 4°C overnight, and blocked with 5% skim milk at room temperature for 1 hour. Anti-PD1-Fc fusion protein was diluted with 1% BSA at a gradient of 4 μg / mL, and mixed with an equal volume of biotin-labeled bio-hPDL1-FC (SEQ ID NO. 55) at 4 μg / mL. 100 μL of the mixture was taken and incubated in a 96-well plate at 37°C for 1 hour. After washing with PBST for 3 times, 100 μL of HRP-streptavidin (Jackson ImmunoResearch Inc.) diluted at 1:50,000 was added to each well, and incubated at room temperature for 1 hour. After washing with PBST for 3 times, TMB substrate was added, and incubated at 37°C. After color development for 5 minutes, the reaction was terminated by adding 1M sulfuric acid, and OD450nm was read. The results are shown in Table 6 and

[0129] Table 5

[0130]

[0131] Note: Keytruda is a marketed anti-PD1 mAb (Merck).

[0132] 6.2 Identification of the blocking effect of Anti-PD1-Fc fusion protein on hPD-L1 / PD-1 interaction (competitive ELISA method)

[0133] hPD1-HSA was coated on plates at 200 ng / well at 4°C overnight, and blocked with 5% skim milk at room temperature for 1 hour. Anti-PD1-Fc fusion protein was diluted with 1% BSA at a gradient of 4 μg / mL, and mixed with an equal volume of biotin-labeled bio-hPDL1-FC (SEQ ID NO. 55) at 4 μg / mL. 100 μL of the mixture was taken and incubated in a 96-well plate at 37°C for 1 hour. After washing with PBST for 3 times, 100 μL of HRP-streptavidin (Jackson ImmunoResearch Inc.) diluted at 1:50,000 was added to each well, and incubated at room temperature for 1 hour. After washing with PBST for 3 times, TMB substrate was added, and incubated at 37°C. After color development for 5 minutes, the reaction was terminated by adding 1M sulfuric acid, and OD450nm was read. The results are shown in Table 6 and Figure 1 .

[0134] Table 6

[0135] Sample Code IC50 (nM) Sample Name IC50 (nM) Anti-PD1-1A4-Fc 1.454 Anti-PD1-hu2C4V1-Fc 1.212 Anti-PD1-1A9-Fc 1.554 Anti-PD1-hu2D9V1-Fc 1.032 Anti-PD1-1H1-Fc 1.535 Anti-PD1-hu1A4V3-Fc 2.43 Anti-PD1-1D3-Fc 1.486 Anti-PD1-hu1A9V3-Fc 2.842 Anti-PD1-2C4-Fc 1.549 Anti-PD1-hu1H1V3-Fc 1.121 Anti-PD1-2D9-Fc 1.437 Anti-PD1-hu1D3V3-Fc 0.8777 Anti-PD1-hu1A4V1-Fc 0.965 Anti-PD1-hu2C4V3-Fc 1.193 Anti-PD1-hu1A9V1-Fc 0.955 Anti-PD1-hu2D9V3-Fc 1.146 Anti-PD1-hu1H1V1-Fc 1.125 Keytruda 1.721 Anti-PD1-hu1D3V1-Fc 1.101

[0136] Note: Keytruda is a marketed anti-PD1 mAb (Merck).

[0137] The above results show that the Anti-PD1-Fc fusion protein of the present application has a very significant blocking effect on hPDL-1 / PD-1 interaction.

[0138] Example 7

[0139] Identification of Anti-PD1-Fc fusion protein in human T lymphocyte cell line

[0140] 7.1 Construction of cell detection strain

[0141] Synthetic CD5L-OKT3scFv-CD14 (GenBank: ADN42857.1) and cut with HindIII-EcoRI (Takara) enzyme, inserted into vector pCDNA3.1, to construct pCDNA3.1-antiCD3TM. Take human PD-L1 (GenBank: NM_014143.2) as template, high-fidelity amplification to obtain PD-L1 fragment recombinant connection to insert pCDNA3.1-antiCD3TM, to construct pCDNA3.1-antiCD3TM-PDL1. Transfect CHO cells (Thermo), and then select with G418 for 10-14d to produce stable cell line CHO-antiCD3TM-PDL1.

[0142] Take human PD1 (GenBank: NP_005009.2) as template to amplify the obtained fragment, and recombine with PB513B1-dual-puro vector (UbiBios) cut with HindIII-BamHI (Takara) enzyme to construct plasmid pB-PD1. Take pGL4.30 (UbiBios) as template for high-fidelity amplification, recover the obtained fragment, and recombine with pB-PD1 vector cut with SfiI-XbaI (Takara) enzyme to construct pB-NFAT-Luc2p-PD1 plasmid. After successful construction of the plasmid, use endotoxin-free plasmid extraction kit (Biomiga) to extract the plasmid for transfection of Jurkat cells (Chinese Academy of Sciences Stem Cell Bank). According to the method in patent CN107022571A, treat Jurkat cells into a relatively adherent state by using 0.1mg / ml poly-D-lysine, and then transfect Jurkat cells according to the transfection instructions in the liposome transfection reagent kit (Lipofectamine 3000; invitrogen); on the third day, pressurize screening with RPMI1640 medium (Thermo) containing 10% FBS and 2.5μg / ml puromycin; thereafter, add medium every other time, and gradually increase the content of puromycin to 4μg / ml after the cell survival rate recovers. Finally, obtain monoclonal Jurkat-NFAT-Luc2p-PD1 cell strain.

[0143] 7.2 Identification of the function of Anti-PD1-FC fusion protein in blocking hPD-L1 / PD1 pathway

[0144] CHO-CD3TM-PD-L1 and Jurkat-NFAT-Luc2p-PD-1 cells were collected and counted, and the cell density was adjusted to 4×10⁻⁶. 6 / ml, add 25μl of each cell to each well of a 96-well plate; in this experiment, the Anti-PD1-Fc fusion protein, the positive control Keytruda (Merck), and the negative isotype control were serially diluted with 1% BSA, and 50μl of the above antibody was added to the cells to make the final antibody concentrations 280, 93.3, 31.1, 10.4, 3.5, 1.2, 0.4, and 0.1 nM respectively; after co-culturing at 37℃ and 5% CO2 for 6 h, 10μl of luciferase substrate (Promega, E2620) was added to each well, and the plate was shaken for 2 min and the readings were taken. The procedure was as per the kit instructions.

[0145] Figure 2 The results showed that the addition of Anti-PD1-Fc fusion protein could block the binding of hPD-1 / PD-L1 on the surface of effector cells and target cells, and exhibited a characteristic dose-response curve; at the same time, it was specific, and the negative isotype control could not block the binding of hPD-L1 and PD1 pathway.

[0146] Depend on Figure 2 It can also be seen that the blocking effect of the Anti-PD1-Fc fusion protein obtained by the present invention on the binding ability of target cell surface hPD-1 / PD-L1 is comparable to that of the positive control Keytruda.

[0147] Example 8

[0148] Identifying the activation effect of the Anti-PD1-Fc fusion protein on PBMCs

[0149] Recombinant anti-CD3 monoclonal antibody (5 μg / ml, Nearshore Protein Technology Co., Ltd., catalog number GMP-A018) was plated at 50 μl / well overnight at 4°C. Peripheral blood monoclonal cells (PBMCs) were isolated from healthy individuals using lymphocyte separation medium (Sigma) and diluted to 2 × 10⁶ cells with recombinant CD28 monoclonal antibody (2 μg / ml, Nearshore Protein Technology Co., Ltd., catalog number GMP-A063). 6 / ml. Discard the supernatant from the ELISA plate coated with recombinant anti-CD3 monoclonal antibody, wash twice with 200 μl / well of PBS, add 200 μl of cells to each well, and after activating the cells for 24 h, add 5 nM Keytruda and 5 nM Anti-PD1-Fc fusion protein for stimulation. After 3 days of stimulation, collect the supernatant after 1500 rpm for 5 min, and use the supernatant to detect cytokine IL2 according to the kit instructions (purchased from Dakota).

[0150] See results Figure 3, Anti-PD1-Fc fusion protein can enhance the secretion of IL2 by PBMC, and the secretion of IL2 is significantly higher than that of positive control Keytruda.

[0151] Example 9

[0152] Study on the tumor inhibition activity of Anti-PD1-Fc fusion protein

[0153] To study the tumor inhibition activity of Anti-PD1-Fc fusion protein, a colon cancer tumor model was established by subcutaneously transplanting MC38 cells expressing human PD-L1 (MC38-hPDL1) into humanized PD-1 C57 mice.

[0154] The experimental design is as follows: 6-8 week old humanized PD-1 C57 mice were subcutaneously inoculated with 1x10 6 MC38-hPDL1 cells on the right front leg back. After inoculation, according to the tumor size, 50-70mm 3 mice were randomly divided into 6 groups, 6 mice in each group. After grouping, Keytruda (2mg / kg), anti-PD1-hu1A4V3-Fc, anti-PD1-hu1A9V3-Fc, anti-PD1-hu2D9V3-Fc (1mg / kg each) and human IgG1 isotype control (2mg / kg) were injected intraperitoneally, twice a week, for a total of 8 times, and PBS was injected in parallel groups as negative control. Tumor volume was measured twice a week.

[0155] Tumor volume measurement: The maximum long axis (L) and maximum wide axis (W) of the tumor were measured with a vernier caliper, and the tumor volume was calculated according to the following formula: V = L x W 2 / 2.

[0156] The experimental results are shown in Figure 4 As time goes on, the mice given anti-PD1-hu1A4V3-Fc, anti-PD1-hu1A9V3-Fc, and anti-PD1-hu2D9V3-Fc have their tumor volumes well controlled and do not show significant increase, indicating that Anti-PD1-Fc fusion protein has obvious tumor inhibition effect.

[0157] Example 10

[0158] Study on the solubility of Anti-PD1-Fc fusion protein

[0159] The purified 100 mg single-domain antibody was ultrafiltered with an ultrafiltration tube (Merck Millipore Ltd.), the replacement solution was 5 mM phosphate buffer (pH 7.2) or 5 mM sodium acetate (pH 5.5), 25°C, 3500g ultrafiltration concentration, and the replacement solution was replaced twice, and the concentrated solution was concentrated to the point where it could not be concentrated (the volume did not change significantly after centrifugation for 20 minutes), and the protein content was determined after centrifugation at 8000g for 10 min, and the concentration was the solubility under the condition.

[0160] Table 7

[0161] Code SEQ ID No. Solubility (mg / ml) Anti-PD1-hu1A4V3-Fc 64 154.1 Anti-PD1-hu1A9V3-Fc 65 204.6 Anti-PD1-hu1H1V3-Fc 66 187.2 Anti-PD1-hu1D3V3-Fc 67 173.6 Anti-PD1-hu2C4V3-Fc 68 227.8 Anti-PD1-hu2D9V3-Fc 69 100.4

[0162] According to Table 7, the humanized Anti-PD1-Fc fusion protein obtained by optimization of the application has good solubility. The single-domain antibody of Anti-PD-1 in this embodiment is humanized from the hydrophilic amino acids at positions 44 and 45 of the original FR2 region to the conservative hydrophobic residues G and L of ordinary human antibodies (Table 4a), but it does not affect the solubility.

[0163] In summary, the application effectively overcomes the shortcomings of the prior art and has high industrial utilization value.

[0164] The above examples are only illustrative of the principles and effects of the application, and are not intended to limit the application. Any person skilled in the art can modify or change the above examples without departing from the spirit and scope of the application. Therefore, all equivalent modifications or changes made by those skilled in the art without departing from the spirit and technical ideas disclosed by the application should be covered by the claims of the application. SEQUENCE LISTING <110> Zhejiang Daol Bio-technology Co., Ltd. <120> A single-domain antibody against PD-1 <160> 91 <170> SIPOSequenceListing 1.0 <210> 1 <211> 25 <212> PRT <213> Artificial Sequence (Artificial Sequence) <400> 1 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Asn Leu Ser Cys Val Ala Ser 20 25 <210> 2 <211> 25 <212> PRT <213> Artificial Sequence <400> 2 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Arg Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser ​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​<213> Artificial Sequence <400> 5 Gly Asn Val Phe Ile Ile Asp Val 1 5 <210> 6 <211> 8 <212> PRT <213> Artificial Sequence <400> 6 Gly Ser Val Phe Ile Ile Asp Val 1 5 <210> 7 <211> 17 <212> PRT <213> Artificial Sequence <400> 7 Met Ala Trp Tyr Arg Gin Ala Pro Gly Lys Gin Arg Glu Leu Val Ala 1 5 10 15 Gln <210> 8 <211> 17 <212> PRT <213> Artificial Sequence <400> 8 Met Ala Trp Tyr Arg Gin Ala Pro Gly Lys Gly Leu Glu Leu Val Ala 1 5 10 15 Gln <210> 9 <211> 7 <212> PRT <213> Artificial Sequence <400> 9 Ile Ile Asn Gly Asp Ala Lys 1 5 <210> 10 <211> 7 <212> PRT <213> Artificial Sequence <400> 10 Ile Ile Asn Gly Gly Ala Thr 1 5 <210> 11 <211> 7 <212> PRT <213> Artificial Sequence <400> 11 Ile Ile Ser Gly Asp His Ala 1 5 <210> 12 <211> 7 <212> PRT <213> Artificial Sequence <400> 12 Tyr Tyr Val Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn 1 5 10 15 Thr Lys Thr Thr Leu Tyr Leu Gln Met Asn Ser Leu Lys Pro Asp Asp 20 25 30 Thr Ala Ile Tyr Tyr Cys 35 <210> 13 <211> 38 <212> PRT <213> Artificial Sequence <400> 13 Ile Ile Ser Gly Asp His Ala 1 5 <210> 14 <211> 38 <212> PRT <213> Artificial Sequence <400> 14 Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp 1 5 10 15 Thr Lys Thr Thr Leu Asn Leu Gln Met Asn Ser Leu Lys Pro Asp Asp 20 25 30 Thr Ala Val Tyr Tyr Cys 35 <210> 15 <211> 38 <212> PRT <213> Artificial Sequence <400> 15 Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn 1 5 10 15 Thr Lys Thr Thr Leu Phe Leu Gln Met Asn Ser Leu Lys Pro Ala Asp 20 25 30 Thr Ala Val Tyr Tyr Cys 35 <210> 16 <211> 38 <212> PRT <213> Artificial Sequence <400> 16 Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn 1 5 10 15 Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp 20 25 30 Thr Ala Val Tyr Tyr Cys 35 <210> 17 <211> 14 <212> PRT <213> Artificial Sequence <400> 17 Ser Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr Asn Phe 1 5 10 <210> 18 <211> 14 <212> PRT <213> Artificial Sequence <400> 18 Ser Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr His Phe 1 5 10 <210> 19 <211> 14 <212> PRT <213> Artificial Sequence <400> 19 Asn Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr Asn Phe 1 5 10 <210> 20 <211> 14 <212> PRT <213> Artificial Sequence <400> 20 Ser Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr Tyr Phe 1 5 10 <210> 21 <211> 14 <212> PRT <213> Artificial Sequence <400> 21 Ser Ala Glu Gin Phe Asn Pro Tyr Arg Asp Ser Thr Tyr Phe 1 5 10 <210> 22 <211> 348 <212> PRT <213> Artificial Sequence <400> 22 Gln Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Asn Leu Ser Cys Val Ala Ser Gly Asn Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gin Ala Pro Gly Lys Gin Arg Glu Leu Val 35 40 45 Ala Gin Ile Ile Asn Gly Asp Ala Lys Tyr Tyr Val Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Thr Lys Thr Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Asp Asp Thr Ala Ile Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr Asn Phe Trp Gly Gin 100 105 110 Gly Thr Gin Val Thr Val Ser Ser Glu Ser Lys Tyr Gly Pro Pro Cys 115 120 125 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 130 135 140 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 145 150 155 160 Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln 165 170 175 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 180 185 190 Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 195 200 205 Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 210 215 220 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 225 230 235 240 Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 245 250 255 Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 260 265 270 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln 275 280 285 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 290 295 300 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln 305 310 315 320 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 325 330 335 His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly 340 345 <210> 23 <211> 348 <212> PRT <213> Artificial Sequence <400> 23 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Asn Leu Ser Cys Val Ala Ser Gly Asn Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Gln Ile Ile Asn Gly Gly Ala Thr Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asp Thr Lys Thr Thr Leu Asn Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Asp Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr His Phe Trp Gly Gln 100 105 110 Gly Thr Gln Val Thr Val Ser Ala Glu Ser Lys Tyr Gly Pro Pro Cys 115 120 125 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 130 135 140 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 145 150 155 160 Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln 165 170 175 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 180 185 190 Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 195 200 205 Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 210 215 220 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 225 230 235 240 Ala Lys Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser 245 250 255 Gln Glu Glu Met Thr Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys 260 265 270 Gly Phe Tyr Pro Ser Asp He Ala Val Glu Trp Glu Ser Asn Gly Gin 275 280 285 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 290 295 300 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gin 305 310 315 320 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 325 330 335 His Tyr Thr Gin Lys Ser Leu Ser Leu Ser Leu Gly 340 345 <210> 24 <211> 348 <212> PRT <213> Artificial Sequence <400> 24 Gln Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Asn Leu Ser Cys Val Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gin Ala Pro Gly Lys Gin Arg Glu Leu Val 35 40 45 Ala Gin He He Asn Gly Gly Ala Ser Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr He Ser Arg Asp Asn Thr Lys Thr Thr Leu Phe Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Ala Asp Thr Ala Val Tyr Tyr Cys Asn 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr Asn Phe Trp Gly Gin 100 105 110 Gly Thr Gin Val Thr Val Ser Ser Glu Ser Lys Tyr Gly Pro Pro Cys 115 120 125 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 130 135 140 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met He Ser Arg Thr Pro Glu 145 150 155 160 Val Thr Cys Val Val Val Asp Val Ser Gin Glu Asp Pro Glu Val Gin 165 170 175 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 180 185 190 Pro Arg Glu Glu Gin Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 195 200 205 Thr Val Leu His Gin Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 210 215 220 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 225 230 235 240 Ala Lys Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser 245 250 255 Gln Glu Glu Met Thr Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys 260 265 270 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gin 275 280 285 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 290 295 300 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gin 305 310 315 320 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 325 330 335 His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly 340 345 <210> 25 <211> 348 <212> PRT <213> Artificial Sequence <400> 25 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Asn Leu Ser Cys Val Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Gln Ile Ile Asn Gly Gly Ala Thr Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asp Thr Lys Thr Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Asp Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr His Phe Trp Gly Gln 100 105 110 Gly Thr Gln Val Thr Val Ser Ser Glu Ser Lys Tyr Gly Pro Pro Cys 115 120 125 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 130 135 140 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 145 150 155 160 Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln 165 170 175 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 180 185 190 Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 195 200 205 Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 210 215 220 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 225 230 235 240 Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 245 250 255 Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 260 265 270 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln 275 280 285 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 290 295 300 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln 305 310 315 320 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 325 330 335 His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly 340 345 <210> 26 <211> 348 <212> PRT <213> Artificial Sequence <400> 26 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Arg Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Gln Ile Ile Ser Gly Asp His Ala Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asp Thr Lys Thr Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Asp Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr Tyr Phe Trp Gly Gln 100 105 110 Gly Thr Gln Val Thr Val Ser Ser Glu Ser Lys Tyr Gly Pro Pro Cys 115 120 125 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 130 135 140 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 145 150 155 160 Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln 165 170 175 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 180 185 190 Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 195 200 205 Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 210 215 220 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 225 230 235 240 Ala Lys Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser 245 250 255 Gln Glu Glu Met Thr Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys 260 265 270 Gly Phe Tyr Pro Ser Asp He Ala Val Glu Trp Glu Ser Asn Gly Gin 275 280 285 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 290 295 300 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gin 305 310 315 320 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 325 330 335 His Tyr Thr Gin Lys Ser Leu Ser Leu Ser Leu Gly 340 345 <210> 27 <211> 348 <212> PRT <213> Artificial Sequence <400> 27 Gln Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gin Ala Pro Gly Lys Gin Arg Glu Leu Val 35 40 45 Ala Gin He He Asn Gly Asp Ala Lys Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr He Ser Arg Asp Asn Thr Lys Thr Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Asp Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Gin Phe Asn Pro Tyr Arg Asp Ser Thr Tyr Phe Trp Gly Gin 100 105 110 Gly Thr Gin Val Thr Val Ser Ser Glu Ser Lys Tyr Gly Pro Pro Cys 115 120 125 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 130 135 140 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met He Ser Arg Thr Pro Glu 145 150 155 160 Val Thr Cys Val Val Val Asp Val Ser Gin Glu Asp Pro Glu Val Gin 165 170 175 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 180 185 190 Pro Arg Glu Glu Gin Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 195 200 205 Thr Val Leu His Gin Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 210 215 220 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 225 230 235 240 Ala Lys Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser 245 250 255 Gln Glu Glu Met Thr Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys 260 265 270 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gin 275 280 285 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 290 295 300 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gin 305 310 315 320 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 325 330 335 His Tyr Thr Gin Lys Ser Leu Ser Leu Ser Leu Gly 340 345 <210> 28 <211> 38 <212> PRT <213> Artificial Sequence <400> 28 Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp 1 5 10 15 Thr Lys Thr Thr Leu Tyr Leu Gin Met Asn Ser Leu Lys Pro Asp Asp 20 25 30 Thr Ala Val Tyr Tyr Cys 35 <210> 29 <211> 38 <212> PRT <213> Artificial Sequence <400> 29 Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn 1 5 10 15 Thr Lys Thr Thr Leu Tyr Leu Gin Met Asn Ser Leu Lys Pro Asp Asp 20 25 30 Thr Ala Val Tyr Tyr Cys 35 <210> 30 <211> 737 <212> PRT <213> Artificial Sequence <400> 30 Leu Glu Ser Pro Asp Arg Pro Trp Asn Ala Pro Thr Phe Ser Pro Ala 1 5 10 15 Leu Leu Leu Val Thr Glu Gly Asp Asn Ala Thr Phe Thr Cys Ser Phe 20 25 30 Ser Asn Ala Ser Glu Ser Phe Val Leu Asn Trp Tyr Arg Met Ser Pro 35 40 45 Ser Asn Gln Thr Asp Lys Leu Ala Ala Phe Pro Glu Asp Arg Ser Gln 50 55 60 Pro Gly Gln Asp Cys Arg Phe Arg Val Thr Arg Leu Pro Asn Gly Arg 65 70 75 80 Asp Phe His Met Ser Val Val Arg Ala Arg Arg Asn Asp Ser Gly Thr 85 90 95 Tyr Leu Cys Gly Ala Ile Ser Leu Ala Pro Lys Ala Gln Ile Lys Glu 100 105 110 Ser Leu Arg Ala Glu Leu Arg Val Thr Glu Arg Arg Ala Glu Val Pro 115 120 125 Thr Ala His Pro Ser Pro Ser Pro Arg Pro Ala Gly Gln Phe Gln Gly 130 135 140 Gly Gly Gly Ser Gly Gly Gly Gly Asp Ala His Lys Ser Glu Val Ala 145 150 155 160 His Arg Phe Lys Asp Leu Gly Glu Glu Asn Phe Lys Ala Leu Val Leu 165 170 175 Ile Ala Phe Ala Gln Tyr Leu Gln Gln Cys Pro Phe Glu Asp His Val 180 185 190 Lys Leu Val Asn Glu Val Thr Glu Phe Ala Lys Thr Cys Val Ala Asp 195 200 205 Glu Ser Ala Glu Asn Cys Asp Lys Ser Leu His Thr Leu Phe Gly Asp 210 215 220 Lys Leu Cys Thr Val Ala Thr Leu Arg Glu Thr Tyr Gly Glu Met Ala 225 230 235 240 Asp Cys Cys Ala Lys Gln Glu Pro Glu Arg Asn Glu Cys Phe Leu Gln 245 250 255 His Lys Asp Asp Asn Pro Asn Leu Pro Arg Leu Val Arg Pro Glu Val 260 265 270 Asp Val Met Cys Thr Ala Phe His Asp Asn Glu Glu Thr Phe Leu Lys 275 280 285 Lys Tyr Leu Tyr Glu Ile Ala Arg Arg His Pro Tyr Phe Tyr Ala Pro 290 295 300 Glu Leu Leu Phe Phe Ala Lys Arg Tyr Lys Ala Ala Phe Thr Glu Cys 305 310 315 320 Cys Gin Ala Ala Asp Lys Ala Ala Cys Leu Leu Pro Lys Leu Asp Glu 325 330 335 Leu Arg Asp Glu Gly Lys Ala Ser Ser Ala Lys Gin Arg Leu Lys Cys 340 345 350 Ala Ser Leu Gin Lys Phe Gly Glu Arg Ala Phe Lys Ala Trp Ala Val 355 360 365 Ala Arg Leu Ser Gin Arg Phe Pro Lys Ala Glu Phe Ala Glu Val Ser 370 375 380 Lys Leu Val Thr Asp Leu Thr Lys Val His Thr Glu Cys Cys His Gly 385 390 395 400 Asp Leu Leu Glu Cys Ala Asp Asp Arg Ala Asp Leu Ala Lys Tyr Ile 405 410 415 Cys Gin Asn Gin Asp Ser Ile Ser Ser Lys Leu Lys Glu Cys Cys Glu 420 425 430 Lys Pro Leu Leu Glu Lys Ser His Cys Ile Ala Glu Val Glu Asn Asp 435 440 445 Glu Met Pro Ala Asp Leu Pro Ser Leu Ala Ala Asp Phe Val Glu Ser 450 455 460 Lys Asp Val Cys Lys Asn Tyr Ala Glu Ala Lys Asp Val Phe Leu Gly 465 470 475 480 Met Phe Leu Tyr Glu Tyr Ala Arg Arg His Pro Asp Tyr Ser Val Val 485 490 495 Leu Leu Leu Arg Leu Ala Lys Thr Tyr Glu Thr Thr Leu Glu Lys Cys 500 505 510 Cys Ala Ala Ala Asp Pro His Glu Cys Tyr Ala Lys Val Phe Asp Glu 515 520 525 Phe Lys Pro Leu Val Glu Glu Pro Gln Asn Leu Ile Lys Gln Asn Cys 530 535 540 Glu Leu Phe Glu Gln Leu Gly Glu Tyr Lys Phe Gln Asn Ala Leu Leu 545 550 555 560 Val Arg Tyr Thr Lys Lys Val Pro Gln Val Ser Thr Pro Thr Leu Val 565 570 575 Glu Val Ser Arg Asn Leu Gly Lys Val Gly Ser Lys Cys Cys Lys His 580 585 590 Pro Glu Ala Lys Arg Met Pro Cys Ala Glu Asp Tyr Leu Ser Val Val 595 600 605 Leu Asn Gln Leu Cys Val Leu His Glu Lys Thr Pro Val Ser Asp Arg 610 615 620 Val Thr Lys Cys Cys Thr Glu Ser Leu Val Asn Arg Arg Pro Cys Phe 625 630 635 640 Ser Ala Leu Glu Val Asp Glu Thr Tyr Val Pro Lys Glu Phe Asn Ala 645 650 655 Glu Thr Phe Thr Phe His Ala Asp Ile Cys Thr Leu Ser Glu Lys Glu 660 665 670 Arg Gln Ile Lys Lys Gln Thr Ala Leu Val Glu Leu Val Lys His Lys 675 680 685 Pro Lys Ala Thr Lys Glu Gln Leu Lys Ala Val Met Asp Asp Phe Ala 690 695 700 Ala Phe Val Glu Lys Cys Cys Lys Ala Asp Asp Lys Glu Thr Cys Phe 705 710 715 720 Ala Glu Glu Gly Lys Lys Leu Val Ala Ala Ser Gln Ala Ala Leu Gly 725 730 735 Leu <210> 31 <211> 11 <212> PRT <213> Artificial Sequence <400> 31 Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 1 5 10 <210> 32 <211> 11 <212> PRT <213> Artificial Sequence <400> 32 Trp Gly Gin Gly Thr Gin Val Thr Val Ser Ala 1 5 10 <210> 33 <211> 11 <212> PRT <213> Artificial Sequence <400> 33 Trp Gly Gin Gly Thr Leu Val Thr Val Ser Ser 1 5 10 <210> 34 <211> 120 <212> PRT <213> Artificial Sequence <400> 34 Gln Val Gin Leu Val Gin Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Asn Leu Ser Cys Val Ala Ser Gly Asn Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gin Ala Pro Gly Lys Gin Arg Gin Leu Val 35 40 45 Ala Gin Ile Ile Asn Gly Asp Ala Lys Tyr Tyr Val Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Gin Gin Thr Gin Gin Gin Gin Gin Gin Gin 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Asp Asp Thr Ala Ile Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr Asn Phe Trp Gly Gln 100 105 110 Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 35 <211> 120 <212> PRT <213> Artificial Sequence <400> 35 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Asn Leu Ser Cys Val Ala Ser Gly Asn Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Gln Ile Ile Asn Gly Gly Ala Thr Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asp Thr Lys Thr Thr Leu Asn Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Asp Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr His Phe Trp Gly Gln 100 105 110 Gly Thr Gin Val Thr Val Ser Ala 115 120 <210> 36 <211> 120 <212> PRT <213> Artificial Sequence <400> 36 Gln Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Asn Leu Ser Cys Val Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gin Ala Pro Gly Lys Gin Arg Glu Leu Val 35 40 45 Ala Gin Ile Ile Asn Gly Gly Ala Ser Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Thr Lys Thr Thr Leu Phe Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Ala Asp Thr Ala Val Tyr Tyr Cys Asn 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr Asn Phe Trp Gly Gin 100 105 110 Gly Thr Gin Val Thr Val Ser Ser 115 120 <210> 37 <211> 120 <212> PRT <213> Artificial Sequence <400> 37 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Asn Leu Ser Cys Val Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gin Ala Pro Gly Lys Gin Arg Glu Leu Val 35 40 45 Ala Gin Ile Ile Asn Gly Gly Ala Thr Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asp Thr Lys Thr Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Asp Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr His Phe Trp Gly Gin 100 105 110 Gly Thr Gin Val Thr Val Ser Ser 115 120 <210> 38 <211> 120 <212> PRT <213> Artificial Sequence <400> 38 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Arg Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gin Ala Pro Gly Lys Gin Arg Glu Leu Val 35 40 45 Ala Gin He He Ser Gly Asp His Ala Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr He Ser Arg Asp Asp Thr Lys Thr Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Asp Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr Tyr Phe Trp Gly Gin 100 105 110 Gly Thr Gin Val Thr Val Ser Ser 115 120 <210> 39 <211> 120 <212> PRT <213> Artificial Sequence <400> 39 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Arg Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Gln Ile Ile Asn Gly Asp Ala Lys Tyr Tyr Ala Asp Ser Val Lys<000116**1**>50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Thr Lys Thr Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Asp Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Gln Phe Asn Pro Tyr Arg Asp Ser Thr Tyr Phe Trp Gly Gln 100 105 110 Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 40 <211> 120 <212> PRT <213> Artificial Sequence ​​​​​​​​​​Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Gln Ile Ile Asn Gly Asp Ala Lys Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95[[ID=1'5]] Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr Asn Phe Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 41 <211> 120 <212> PRT <213> Artificial Sequence <400> 41 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asn Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Gin lie lie Asn Gly Gly Ala Thr Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr His Phe Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 42 <211> 120 <212> PRT <213> Artificial Sequence <400> 42 Gln Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Val Phe lie lie Asp 20 25 30 Val Met Ala Trp Tyr Arg Gin Ala Pro Gly Lys Gin Arg Glu Leu Val 35 40 45 Ala Gin lie lie Asn Gly Gly Ala Ser Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Asn 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr Asn Phe Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 43 <211> 120 <212> PRT <213> Artificial Sequence <400> 43 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Gln Ile Ile Asn Gly Gly Ala Thr Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr His Phe Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 44 <211> 120 <212> PRT <213> Artificial Sequence <400> 44 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 [[ID=3४]]Ala Gln Ile Ile Ser Gly Asp His Ala Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr Tyr Phe Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 45 <211> 120 <212> PRT <213> Artificial Sequence <400> 45 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Gln Ile Ile Asn Gly Asp Ala Lys Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Gln Phe Asn Pro Tyr Arg Asp Ser Thr Tyr Phe Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 46 <211> 120 <212> PRT <213> Artificial Sequence (Artificial Sequence) <400> 46 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asn Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gly Leu Glu Leu Val 35 40 45 Ala Gln Ile Ile Asn Gly Asp Ala Lys Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr Asn Phe Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 47 <211> 120 <212> PRT <213> Artificial Sequence <400> 47 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asn Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gin Ala Pro Gly Lys Gly Leu Glu Leu Val 35 40 45 Ala Gin He He Asn Gly Gly Ala Thr Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr He Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr His Phe Trp Gly Gin 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 48 <211> 120 <212> PRT <213> Artificial Sequence <400> 48 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gin Ala Pro Gly Lys Gly Leu Glu Leu Val 35 40 45 Ala Gin He He Asn Gly Gly Ala Ser Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr He Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Asn 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr Asn Phe Trp Gly Gin 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 49 <211> 120 <212> PRT <213> Artificial Sequence <400> 49 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gin Ala Pro Gly Lys Gly Leu Glu Leu Val 35 40 45 Ala Gin He He Asn Gly Gly Ala Thr Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr He Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr His Phe Trp Gly Gin 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 50 <211> 120 <212> PRT <213> Artificial Sequence <400> 50 Gln Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gly Leu Glu Leu Val 35 40 45 Ala Gln Ile Ile Ser Gly Asp His Ala Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr Tyr Phe Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 51 <211> 120 <212> PRT <213> Artificial Sequence <400> 51 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gly Leu Glu Leu Val 35 40 45 Ala Gln Ile Ile Asn Gly Asp Ala Lys Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Gln Phe Asn Pro Tyr Arg Asp Ser Thr Tyr Phe Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 52 <211> 231 <212> PRT <213> Artificial Sequence <400> 52 Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala 1 5 10 15 Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro 20 25 30 Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val 35 40 45 Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val 50 55 60 Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin 65 70 75 80 Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin 85 90 95 Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala 100 105 110 Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro 115 120 125 Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr 130 135 140 Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser 145 150 155 160 Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr 165 170 175 Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr 180 185 190 Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe 195 200 205 Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys 210 215 220 Ser Leu Ser Leu Ser Pro Gly 225 230 <210> 53 <211> 228 <212> PRT <213> Artificial Sequence <400> 53 Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Phe 1 5 10 15 Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 20 25 30 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 35 40 45 Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val 50 55 60 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser 65 70 75 80 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu 85 90 95 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser 100 105 110 Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 115 120 125 Gln Val Tyr Thr Leu Pro Pro Ser Gin Glu Glu Met Thr Lys Asn Gin 130 135 140 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 145 150 155 160 Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr 165 170 175 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu 180 185 190 Thr Val Asp Lys Ser Arg Trp Gin Glu Gly Asn Val Phe Ser Cys Ser 195 200 205 Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser 210 215 220 Leu Ser Leu Gly 225 <210> 54 <211> 737 <212> PRT <213> Artificial Sequence (Artificial Sequence) <400> 54 Leu Asp Ser Pro Asp Arg Pro Trp Asn Pro Pro Thr Phe Ser Pro Ala 1 5 10 15 Leu Leu Val Val Thr Glu Gly Asp Asn Ala Thr Phe Thr Cys Ser Phe 20 25 30 Ser Asn Thr Ser Glu Ser Phe Val Leu Asn Trp Tyr Arg Met Ser Pro 35 40 45 Ser Asn Gln Thr Asp Lys Leu Ala Ala Phe Pro Glu Asp Arg Ser Gln 50 55 60 Pro Gly Gln Asp Cys Arg Phe Arg Val Thr Gln Leu Pro Asn Gly Arg 65 70 75 80 Asp Phe His Met Ser Val Val Arg Ala Arg Arg Asn Asp Ser Gly Thr 85 90 95 Tyr Leu Cys Gly Ala Ile Ser Leu Ala Pro Lys Ala Gln Ile Lys Glu 100 105 110 Ser Leu Arg Ala Glu Leu Arg Val Thr Glu Arg Arg Ala Glu Val Pro 115 120 125 Thr Ala His Pro Ser Pro Ser Pro Arg Pro Ala Gly Gln Phe Gln Gly 130 135 140 Gly Gly Gly Ser Gly Gly Gly Gly Asp Ala His Lys Ser Glu Val Ala 145 150 155 160 His Arg Phe Lys Asp Leu Gly Glu Glu Asn Phe Lys Ala Leu Val Leu 165 170 175 Ile Ala Phe Ala Gln Tyr Leu Gln Gln Cys Pro Phe Glu Asp His Val 180 185 190 Lys Leu Val Asn Glu Val Thr Glu Phe Ala Lys Thr Cys Val Ala Asp 195 200 205 Glu Ser Ala Glu Asn Cys Asp Lys Ser Leu His Thr Leu Phe Gly Asp 210 215 220 Lys Leu Cys Thr Val Ala Thr Leu Arg Glu Thr Tyr Gly Glu Met Ala 225 230 235 240 Asp Cys Cys Ala Lys Gln Glu Pro Glu Arg Asn Glu Cys Phe Leu Gln 245 250 255 His Lys Asp Asp Asn Pro Asn Leu Pro Arg Leu Val Arg Pro Glu Val 260 265 270 Asp Val Met Cys Thr Ala Phe His Asp Asn Glu Glu Thr Phe Leu Lys 275 280 285 Lys Tyr Leu Tyr Glu Ile Ala Arg Arg His Pro Tyr Phe Tyr Ala Pro 290 295 300 Glu Leu Leu Phe Phe Ala Lys Arg Tyr Lys Ala Ala Phe Thr Glu Cys 305 310 315 320 Cys Gln Ala Ala Asp Lys Ala Ala Cys Leu Leu Pro Lys Leu Asp Glu 325 330 335 Leu Arg Asp Glu Gly Lys Ala Ser Ser Ala Lys Gln Arg Leu Lys Cys 340 345 350 Ala Ser Leu Gin Lys Phe Gly Glu Arg Ala Phe Lys Ala Trp Ala Val 355 360 365 Ala Arg Leu Ser Gin Arg Phe Pro Lys Ala Glu Phe Ala Glu Val Ser 370 375 380 Lys Leu Val Thr Asp Leu Thr Lys Val His Thr Glu Cys Cys His Gly 385 390 395 400 Asp Leu Leu Glu Cys Ala Asp Asp Arg Ala Asp Leu Ala Lys Tyr Ile 405 410 415 Cys Glu Asn Gin Asp Ser Ile Ser Ser Lys Leu Lys Glu Cys Cys Glu 420 425 430 Lys Pro Leu Leu Glu Lys Ser His Cys Ile Ala Glu Val Glu Asn Asp 435 440 445 Glu Met Pro Ala Asp Leu Pro Ser Leu Ala Ala Asp Phe Val Glu Ser 450 455 460 Lys Asp Val Cys Lys Asn Tyr Ala Glu Ala Lys Asp Val Phe Leu Gly 465 470 475 480 Met Phe Leu Tyr Gin Tyr Ala Arg Arg His Pro Asp Tyr Ser Val Val 485 490 495 Leu Leu Leu Arg Leu Ala Lys Thr Tyr Glu Thr Thr Leu Glu Lys Cys 500 505 510 Cys Ala Ala Ala Asp Pro His Glu Cys Tyr Ala Lys Val Phe Asp Glu 515 520 525 Phe Lys Pro Leu Val Glu Glu Pro Gln Asn Leu Ile Lys Gln Asn Cys 530 535 540 Glu Leu Phe Glu Gln Leu Gly Glu Tyr Lys Phe Gln Asn Ala Leu Leu 545 550 555 560 Val Arg Tyr Thr Lys Lys Val Pro Gln Val Ser Thr Pro Thr Leu Val 565 570 575 Glu Val Ser Arg Asn Leu Gly Lys Val Gly Ser Lys Cys Cys Lys His 580 585 590 Pro Glu Ala Lys Arg Met Pro Cys Ala Glu Asp Tyr Leu Ser Val Val 595 600 605 Leu Asn Gln Leu Cys Val Leu His Glu Lys Thr Pro Val Ser Asp Arg 610 615 620 Val Thr Lys Cys Cys Thr Glu Ser Leu Val Asn Arg Arg Pro Cys Phe 625 630 635 640 Ser Ala Leu Glu Val Asp Glu Thr Tyr Val Pro Lys Glu Phe Asn Ala 645 650 655 Glu Thr Phe Thr Phe His Ala Asp Ile Cys Thr Leu Ser Glu Lys Glu 660 665 670 Arg Gin He Lys Lys Gin Thr Ala Leu Val Glu Leu Val Lys His Lys 675 680 685 Pro Lys Ala Thr Lys Glu Gin Leu Lys Ala Val Met Asp Asp Phe Ala 690 695 700 Ala Phe Val Glu Lys Cys Cys Lys Ala Asp Asp Lys Glu Thr Cys Phe 705 710 715 720 Ala Glu Glu Gly Lys Lys Leu Val Ala Ala Ser Gin Ala Ala Leu Gly 725 730 735 Leu <210> 55 <211> 459 <212> PRT <213> Artificial Sequence <400> 55 Phe Thr Val Thr Val Pro Lys Asp Leu Tyr Val Val Glu Tyr Gly Ser 1 5 10 15 Asn Met Thr He Glu Cys Lys Phe Pro Val Glu Lys Gin Leu Asp Leu 20 25 30 Ala Ala Leu He Val Tyr Trp Glu Met Glu Asp Lys Asn He He Gin 35 40 45 Phe Val His Gly Glu Glu Asp Leu Lys Val Gin His Ser Ser Tyr Arg 50 55 60 Gln Arg Ala Arg Leu Leu Lys Asp Gln Leu Ser Leu Gly Asn Ala Ala 65 70 75 80 Leu Gln Ile Thr Asp Val Lys Leu Gln Asp Ala Gly Val Tyr Arg Cys 85 90 95 Met Ile Ser Tyr Gly Gly Ala Asp Tyr Lys Arg Ile Thr Val Lys Val 100 105 110 Asn Ala Pro Tyr Asn Lys Ile Asn Gln Arg Ile Leu Val Val Asp Pro 115 120 125 Val Thr Ser Glu His Glu Leu Thr Cys Gln Ala Glu Gly Tyr Pro Lys 130 135 140 Ala Glu Val Ile Trp Thr Ser Ser Asp His Gln Val Leu Ser Gly Lys 145 150 155 160 Thr Thr Thr Thr Asn Ser Lys Arg Glu Glu Lys Leu Phe Asn Val Thr 165 170 175 Ser Thr Leu Arg Ile Asn Thr Thr Thr Asn Glu Ile Phe Tyr Cys Thr 180 185 190 Phe Arg Arg Leu Asp Pro Glu Glu Asn His Thr Ala Glu Leu Val Ile 195 200 205 Pro Glu Leu Pro Leu Ala His Pro Pro Asn Glu Arg Thr Asp Ile Glu 210 215 220 Gly Arg Met Asp Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro 225 230 235 240 Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro 245 250 255 Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr 260 265 270 Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn 275 280 285 Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg 290 295 300 Glu Glu Gln Tyr Ala Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val 305 310 315 320 Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser 325 330 335 Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys 340 345 350 Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp 355 360 365 Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe 370 375 380 Tyr Pro Ser Asp lie Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu 385 390 395 400 Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe 405 410 415 Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gin Gin Gly 420 425 430 Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr 435 440 445 Thr Gin Lys Ser Leu Ser Leu Ser Pro Gly Lys 450 455 <210> 56 <211> 381 <212> PRT <213> Artificial Sequence <400> 56 Leu Asp Ser Pro Asp Arg Pro Trp Asn Pro Pro Thr Phe Ser Pro Ala 1 5 10 15 Leu Leu Val Val Thr Glu Gly Asp Asn Ala Thr Phe Thr Cys Ser Phe 20 25 30 Ser Asn Thr Ser Glu Ser Phe Val Leu Asn Trp Tyr Arg Met Ser Pro 35 40 45 Ser Asn Gin Thr Asp Lys Leu Ala Ala Phe Pro Glu Asp Arg Ser Gin 50 55 60 Pro Gly Gin Asp Cys Arg Phe Arg Val Thr Gin Leu Pro Asn Gly Arg 65 70 75 80 Asp Phe His Met Ser Val Val Arg Ala Arg Arg Asn Asp Ser Gly Thr 85 90 95 Tyr Leu Cys Gly Ala Ile Ser Leu Ala Pro Lys Ala Gin Ile Lys Glu 100 105 110 Ser Leu Arg Ala Glu Leu Arg Val Thr Glu Arg Arg Ala Glu Val Pro 115 120 125 Thr Ala His Pro Ser Pro Ser Pro Arg Pro Ala Gly Gin Phe Gin Asp 130 135 140 Ile Glu Gly Arg Met Asp Pro Lys Ser Cys Asp Lys Thr His Thr Cys 145 150 155 160 Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu 165 170 175 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 180 185 190 Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys 195 200 205 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 210 215 220 Pro Arg Glu Glu Gln Tyr Ala Ser Thr Tyr Arg Val Val Ser Val Leu 225 230 235 240 Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 245 250 255 Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys 260 265 270 Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 275 280 285 Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 290 295 300 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln 305 310 315 320 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 325 330 335 Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln 340 345 350 Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 355 360 365 His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 370 375 380 <210> 57 <211> 739 <212> PRT <213> Artificial Sequence <400> 57 Leu Glu Val Pro Asn Gly Pro Trp Arg Ser Leu Thr Phe Tyr Pro Ala 1 5 10 15 Trp Leu Thr Val Ser Glu Gly Ala Asn Ala Thr Phe Thr Cys Ser Leu 20 25 30 Ser Asn Trp Ser Glu Asp Leu Met Leu Asn Trp Asn Arg Leu Ser Pro 35 40 45 Ser Asn Gln Thr Glu Lys Gln Ala Ala Phe Cys Asn Gly Leu Ser Gln 50 55 60 Pro Val Gln Asp Ala Arg Phe Gln Ile Ile Gln Leu Pro Asn Arg His 65 70 75 80 Asp Phe His Met Asn Ile Leu Asp Thr Arg Arg Asn Asp Ser Gly Ile 85 90 95 Tyr Leu Cys Gly Ala Ile Ser Leu His Pro Lys Ala Lys Ile Glu Glu 100 105 110 Ser Pro Gly Ala Glu Leu Val Val Thr Glu Arg Ile Leu Glu Thr Ser 115 120 125 Thr Arg Tyr Pro Ser Pro Ser Pro Lys Pro Glu Gly Arg Phe Gln Gly 130 135 140 Met Gly Gly Gly Gly Ser Gly Gly Gly Gly Asp Ala His Lys Ser Glu 145 150 155 160 Val Ala His Arg Phe Lys Asp Leu Gly Glu Glu Asn Phe Lys Ala Leu 165 170 175 Val Leu Ile Ala Phe Ala Gln Tyr Leu Gln Gln Cys Pro Phe Glu Asp 180 185 190 His Val Lys Leu Val Asn Glu Val Thr Glu Phe Ala Lys Thr Cys Val 195 200 205 Ala Asp Glu Ser Ala Glu Asn Cys Asp Lys Ser Leu His Thr Leu Phe 210 215 220 Gly Asp Lys Leu Cys Thr Val Ala Thr Leu Arg Glu Thr Tyr Gly Glu 225 230 235 240 Met Ala Asp Cys Cys Ala Lys Gln Glu Pro Glu Arg Asn Glu Cys Phe 245 250 255 Leu Gln His Lys Asp Asp Asn Pro Asn Leu Pro Arg Leu Val Arg Pro 260 265 270 Glu Val Asp Val Met Cys Thr Ala Phe His Asp Asn Glu Glu Thr Phe 275 280 285 Leu Lys Lys Tyr Leu Tyr Glu Ile Ala Arg Arg His Pro Tyr Phe Tyr 290 295 300 Ala Pro Glu Leu Leu Phe Phe Ala Lys Arg Tyr Lys Ala Ala Phe Thr 305 310 315 320 Glu Cys Cys Gln Ala Ala Asp Lys Ala Ala Cys Leu Leu Pro Lys Leu 325 330 335 Asp Glu Leu Arg Asp Glu Gly Lys Ala Ser Ser Ala Lys Gln Arg Leu 340 345 350 Lys Cys Ala Ser Leu Gln Lys Phe Gly Glu Arg Ala Phe Lys Ala Trp 355 360 365 Ala Val Ala Arg Leu Ser Gln Arg Phe Pro Lys Ala Glu Phe Ala Glu 370 375 380 Val Ser Lys Leu Val Thr Asp Leu Thr Lys Val His Thr Glu Cys Cys 385 390 395 400 His Gly Asp Leu Leu Glu Cys Ala Asp Asp Arg Ala Asp Leu Ala Lys 405 410 415 Tyr Ile Cys Glu Asn Gln Asp Ser Ile Ser Ser Lys Leu Lys Glu Cys 420 425 430 Cys Glu Lys Pro Leu Leu Glu Lys Ser His Cys Ile Ala Glu Val Glu 435 440 445 Asn Asp Glu Met Pro Ala Asp Leu Pro Ser Leu Ala Ala Asp Phe Val 450 455 460 Glu Ser Lys Asp Val Cys Lys Asn Tyr Ala Glu Ala Lys Asp Val Phe 465 470 475 480 Leu Gly Met Phe Leu Tyr Glu Tyr Ala Arg Arg His Pro Asp Tyr Ser 485 490 495 Val Val Leu Leu Leu Arg Leu Ala Lys Thr Tyr Glu Thr Thr Leu Glu 500 505 510 Lys Cys Cys Ala Ala Ala Asp Pro His Glu Cys Tyr Ala Lys Val Phe 515 520 525 Asp Glu Phe Lys Pro Leu Val Glu Glu Pro Gln Asn Leu Ile Lys Gln 530 535 540 Asn Cys Glu Leu Phe Glu Gln Leu Gly Glu Tyr Lys Phe Gln Asn Ala 545 550 555 560 Leu Leu Val Arg Tyr Thr Lys Lys Val Pro Gln Val Ser Thr Pro Thr 565 570 575 Leu Val Glu Val Ser Arg Asn Leu Gly Lys Val Gly Ser Lys Cys Cys 580 585 590 Lys His Pro Glu Ala Lys Arg Met Pro Cys Ala Glu Asp Tyr Leu Ser 595 600 605 Val Val Leu Asn Gin Leu Cys Val Leu His Glu Lys Thr Pro Val Ser 610 615 620 Asp Arg Val Thr Lys Cys Cys Thr Glu Ser Leu Val Asn Arg Arg Pro 625 630 635 640 Cys Phe Ser Ala Leu Glu Val Asp Glu Thr Tyr Val Pro Lys Glu Phe 645 650 655 Asn Ala Glu Thr Phe Thr Phe His Ala Asp Ile Cys Thr Leu Ser Glu 660 665 670 Lys Glu Arg Gin Ile Lys Lys Gin Thr Ala Leu Val Glu Leu Val Lys 675 680 685 His Lys Pro Lys Ala Thr Lys Glu Gin Leu Lys Ala Val Met Asp Asp 690 695 700 Phe Ala Ala Phe Val Glu Lys Cys Cys Lys Ala Asp Asp Lys Glu Thr 705 710 715 720 Cys Phe Ala Glu Glu Gly Lys Lys Leu Val Ala Ala Ser Gin Ala Ala 725 730 735 Leu Gly Leu <210> 58 <211> 348 <212> PRT <213> Artificial Sequence <400> 58 Gln Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asn Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gin Ala Pro Gly Lys Gin Arg Glu Leu Val 35 40 45 Ala Gin He He Asn Gly Asp Ala Lys Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr He Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr Asn Phe Trp Gly Gin 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Glu Ser Lys Tyr Gly Pro Pro Cys 115 120 125 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 130 135 140 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met He Ser Arg Thr Pro Glu 145 150 155 160 Val Thr Cys Val Val Val Asp Val Ser Gin Glu Asp Pro Glu Val Gin 165 170 175 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 180 185 190 Pro Arg Glu Glu Gin Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 195 200 205 Thr Val Leu His Gin Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 210 215 220 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 225 230 235 240 Ala Lys Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser 245 250 255 Gln Glu Glu Met Thr Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys 260 265 270 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gin 275 280 285 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 290 295 300 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gin 305 310 315 320 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 325 330 335 His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly 340 345 <210> 59 <211> 348 <212> PRT <213> Artificial Sequence <400> 59 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asn Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Gln Ile Ile Asn Gly Gly Ala Thr Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr His Phe Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Glu Ser Lys Tyr Gly Pro Pro Cys 115 120 125 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 130 135 140 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 145 150 155 160 Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln 165 170 175 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 180 185 190 Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 195 200 205 Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 210 215 220 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 225 230 235 240 Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 245 250 255 Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 260 265 270 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln 275 280 285 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 290 295 300 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln 305 310 315 320 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 325 330 335 His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly 340 345 <210> 60 <211> 358 <212> PRT <213> Artificial Sequence <400> 60 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Gln Ile Ile Asn Gly Gly Ala Ser Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Asn 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr Asn Phe Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly 115 120 125 Gly Ser Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro 130 135 140 Glu Phe Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys 145 150 155 160 Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val 165 170 175 Asp Val Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp 180 185 190 Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe 195 200 205 Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp 210 215 220 Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu 225 230 235 240 Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg 245 250 255 Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys 260 265 270 Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp 275 280 285 Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys 290 295 300 Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser 305 310 315 320 Arg Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser 325 330 335 Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser 340 345 350 Leu Ser Leu Ser Leu Gly 355 <210> 61 <211> 348 <212> PRT <213> Artificial Sequence <400> 61 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gin Ala Pro Gly Lys Gin Arg Glu Leu Val 35 40 45 Ala Gin He He Asn Gly Gly Ala Thr Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr He Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr His Phe Trp Gly Gin 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Glu Ser Lys Tyr Gly Pro Pro Cys 115 120 125 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 130 135 140 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met He Ser Arg Thr Pro Glu 145 150 155 160 Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln 165 170 175 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 180 185 190 Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 195 200 205 Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 210 215 220 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 225 230 235 240 Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 245 250 255 Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 260 265 270 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln 275 280 285 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 290 295 300 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln 305 310 315 320 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 325 330 335 His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly 340 345 <210> 62 <211> 348 <212> PRT <213> Artificial Sequence <400> 62 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Gln Ile Ile Ser Gly Asp His Ala Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr Tyr Phe Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Glu Ser Lys Tyr Gly Pro Pro Cys 115 120 125 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 130 135 140 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 145 150 155 160 Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln 165 170 175 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 180 185 190 Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 195 200 205 Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 210 215 220 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 225 230 235 240 Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 245 250 255 Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 260 265 270 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln 275 280 285 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 290 295 300 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln 305 310 315 320 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 325 330 335 His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly 340 345 <210> 63 <211> 348 <212> PRT <213> Artificial Sequence <400> 63 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Gin lie lie Asn Gly Asp Ala Lys Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Gin Phe Asn Pro Tyr Arg Asp Ser Thr Tyr Phe Trp Gly Gin 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Glu Ser Lys Tyr Gly Pro Pro Cys 115 120 125 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 130 135 140 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 145 150 155 160 Val Thr Cys Val Val Val Asp Val Ser Gin Glu Asp Pro Glu Val Gin 165 170 175 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 180 185 190 Pro Arg Glu Glu Gin Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 195 200 205 Thr Val Leu His Gin Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 210 215 220 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 225 230 235 240 Ala Lys Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser 245 250 255 Gln Glu Glu Met Thr Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys 260 265 270 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gin 275 280 285 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 290 295 300 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gin 305 310 315 320 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 325 330 335 His Tyr Thr Gin Lys Ser Leu Ser Leu Ser Leu Gly 340 345 <210> 64 <211> 348 <212> PRT <213> Artificial Sequence <400> 64 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asn Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gly Leu Glu Leu Val 35 40 45 Ala Gln Ile Ile Asn Gly Asp Ala Lys Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr Asn Phe Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Glu Ser Lys Tyr Gly Pro Pro Cys 115 120 125 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 130 135 140 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 145 150 155 160 Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln 165 170 175 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 180 185 190 Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 195 200 205 Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 210 215 220 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 225 230 235 240 Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 245 250 255 Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 260 265 270 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln 275 280 285 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 290 295 300 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln 305 310 315 320 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 325 330 335 His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly 340 345 <210> 65 <211> 348 <212> PRT <213> Artificial Sequence <400> 65 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asn Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gly Leu Glu Leu Val 35 40 45 Ala Gln Ile Ile Asn Gly Gly Ala Thr Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr His Phe Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Glu Ser Lys Tyr Gly Pro Pro Cys 115 120 125 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 130 135 140 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 145 150 155 160 Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln 165 170 175 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 180 185 190 Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 195 200 205 Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 210 215 220 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 225 230 235 240 Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 245 250 255 Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 260 265 270 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln 275 280 285 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 290 295 300 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln 305 310 315 320 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 325 330 335 His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly 340 345 <210> 66 <211> 348 <212> PRT <213> Artificial Sequence <400> 66 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gly Leu Glu Leu Val 35 40 45 Ala Gin lie lie Asn Gly Gly Ala Ser Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Asn 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr Asn Phe Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Glu Ser Lys Tyr Gly Pro Pro Cys 115 120 125 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 130 135 140 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 145 150 155 160 Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln 165 170 175 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 180 185 190 Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 195 200 205 Thr Val Leu His Gin Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 210 215 220 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 225 230 235 240 Ala Lys Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser 245 250 255 Gln Glu Glu Met Thr Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys 260 265 270 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gin 275 280 285 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 290 295 300 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gin 305 310 315 320 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 325 330 335 His Tyr Thr Gin Lys Ser Leu Ser Leu Ser Leu Gly 340 345 <210> 67 <211> 348 <212> PRT <213> Artificial Sequence <400> 67 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gly Leu Glu Leu Val 35 40 45 Ala Gln Ile Ile Asn Gly Gly Ala Thr Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr His Phe Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Glu Ser Lys Tyr Gly Pro Pro Cys 115 120 125 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 130 135 140 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 145 150 155 160 Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln 165 170 175 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 180 185 190 Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 195 200 205 Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 210 215 220 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 225 230 235 240 Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 245 250 255 Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 260 265 270 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln 275 280 285 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 290 295 300 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln 305 310 315 320 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 325 330 335 His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly 340 345 <210> 68 <211> 348 <212> PRT <213> Artificial Sequence <400> 68 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gly Leu Glu Leu Val 35 40 45 Ala Gln Ile Ile Ser Gly Asp His Ala Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Lys Phe Asn Pro Tyr Arg Asp Ser Thr Tyr Phe Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Glu Ser Lys Tyr Gly Pro Pro Cys 115 120 125 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 130 135 140 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 145 150 155 160 Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln 165 170 175 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 180 185 190 Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 195 200 205 Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 210 215 220 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 225 230 235 240 Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 245 250 255 Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 260 265 270 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln 275 280 285 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 290 295 300 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln 305 310 315 320 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 325 330 335 His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly 340 345 <210> 69 <211> 348 <212> PRT <213> Artificial Sequence <400> 69 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Val Phe Ile Ile Asp 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gly Leu Glu Leu Val 35 40 45 Ala Gin lie lie Asn Gly Asp Ala Lys Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Ala Glu Gin Phe Asn Pro Tyr Arg Asp Ser Thr Tyr Phe Trp Gly Gin 100 105 110 Gly Thr Leu Val Thr Val Ser Ser Glu Ser Lys Tyr Gly Pro Pro Cys 115 120 125 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 130 135 140 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 145 150 155 160 Val Thr Cys Val Val Val Asp Val Ser Gin Glu Asp Pro Glu Val Gin 165 170 175 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 180 185 190 Pro Arg Glu Glu Gin Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 195 200 205 Thr Val Leu His Gin Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 210 215 220 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 225 230 235 240 Ala Lys Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser 245 250 255 Gln Glu Glu Met Thr Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys 260 265 270 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gin 275 280 285 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 290 295 300 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gin 305 310 315 320 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 325 330 335 His Tyr Thr Gin Lys Ser Leu Ser Leu Ser Leu Gly 340 345 <210> 70 <211> 23 <212> PRT <213> Artificial Sequence <400> 70 Ala Ala Ala Val Leu Leu Asp Gly Ser Phe Ser Leu Leu Ala Pro Leu 1 5 10 15 Val Pro Tyr Lys Tyr Asp Tyr 20 <210> 71 <211> 18 <212> PRT <213> Artificial Sequence <400> 71 Asn Ala Glu Ala Ala Thr Trp Gly Gly Ser Ser Trp Tyr Gly Pro Tyr 1 5 10 15 Glu Tyr <210> 72 <211> 19 <212> PRT <213> Artificial Sequence <400> 72 Ala Arg Asp Glu Arg Val Tyr Ser Asp Ile Asp Phe Phe Arg Pro Phe 1 5 10 15 Asp Tyr Gly <210> 73 <211> 116 <212> PRT <213> Artificial Sequence <400> 73 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala He Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr He Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Ser Tyr Gly Ala Phe Asp Tyr Trp Gly Gin Gly Thr Leu Val 100 105 110 Thr Val Ser Ser 115 <210> 74 <211> 231 <212> PRT <213> Artificial Sequence (Artificial Sequence) <400> 74 Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala 1 5 10 15 Pro Glu Leu Leu Gly Gly Pro Asp Val Phe Leu Phe Pro Pro Lys Pro 20 25 30 Lys Asp Thr Leu Met He Ser Arg Thr Pro Glu Val Thr Cys Val Val 35 40 45 Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val 50 55 60 Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln 65 70 75 80 Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln 85 90 95 Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala 100 105 110 Leu Pro Ala Pro Glu Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro 115 120 125 Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr 130 135 140 Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser 145 150 155 160 Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr 165 170 175 Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr 180 185 190 Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe 195 200 205 Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys 210 215 220 Ser Leu Ser Leu Ser Pro Gly 225 230 <210> 75 <211> 231 <212> PRT <213> Artificial Sequence <400> 75 Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala 1 5 10 15 Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro 20 25 30 Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val 35 40 45 Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val 50 55 60 Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin 65 70 75 80 Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin 85 90 95 Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Trp Ala 100 105 110 Leu Pro Ala Pro lie Ser Lys Thr lie Ser Lys Ala Lys Gly Gin Pro 115 120 125 Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr 130 135 140 Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser 145 150 155 160 Asp lie Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr 165 170 175 Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr 180 185 190 Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe 195 200 205 Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys 210 215 220 Ser Leu Ser Leu Ser Pro Gly 225 230 <210> 76 <211> 231 <212> PRT <213> Artificial Sequence <400> 76 Glu Pro Lys Ser Ser Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala 1 5 10 15 Pro Glu Leu Leu Gly Gly Pro Asp Val Phe Leu Phe Pro Pro Lys Pro 20 25 30 Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val 35 40 45 Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val 50 55 60 Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln 65 70 75 80 Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln 85 90 95 Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala 100 105 110 Leu Pro Ala Pro Glu Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro 115 120 125 Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr 130 135 140 Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser 145 150 155 160 Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr 165 170 175 Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr 180 185 190 Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe 195 200 205 Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys 210 215 220 Ser Leu Ser Leu Ser Pro Gly 225 230 <210> 77 <211> 231 <212> PRT <213> Artificial Sequence <400> 77 Glu Pro Lys Ser Ser Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala 1 5 10 15 Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro 20 25 30 Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val 35 40 45 Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val 50 55 60 Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln 65 70 75 80 Tyr Ala Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin 85 90 95 Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala 100 105 110 Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro 115 120 125 Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr 130 135 140 Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser 145 150 155 160 Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr 165 170 175 Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr 180 185 190 Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe 195 200 205 Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys 210 215 220 Ser Leu Ser Leu Ser Pro Gly 225 230 <210> 78 <211> 231 <212> PRT <213> Artificial Sequence <400> 78 Glu Pro Lys Ser Ser Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala 1 5 10 15 Pro Glu Phe Glu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro 20 25 30 Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val 35 40 45 Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val 50 55 60 Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln 65 70 75 80 Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln 85 90 95 Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala 100 105 110 Leu Pro Ala Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro 115 120 125 Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr 130 135 140 Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser 145 150 155 160 Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr 165 170 175 Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr 180 185 190 Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe 195 200 205 Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys 210 215 220 Ser Leu Ser Leu Ser Pro Gly 225 230[[ID=2​​​​​​​​​​​​​​​​​​​​​​Ser Gin Glu Asp Pro Glu Val Gin Phe Asn Trp Tyr Val Asp Gly Val 50 55 60 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Phe Asn Ser 65 70 75 80 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu 85 90 95 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser 100 105 110 Ser lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro 115 120 125 Gln Val Tyr Thr Leu Pro Pro Ser Gin Glu Glu Met Thr Lys Asn Gin 130 135 140 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala 145 150 155 160 Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr 165 170 175 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu 180 185 190 Thr Val Asp Lys Ser Arg Trp Gin Glu Gly Asn Val Phe Ser Cys Ser 195 200 205 Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser 210 215 220 Leu Ser Leu Gly 225 <210> 80 <211> 360 <212> DNA <213> Artificial Sequence <400> 80 caggtgcagc tcgtggagtc tgggggaggc ttggtgcagc ctggggggtc tctgagactc 60 tcctgtgcag cctctggaaa tgtcttcatt atcgatgtca tggcctggta ccgccaggct 120 ccagggaagc agcgcgaatt ggtcgcgcaa atcatcaatg gtgatgcgaa atactatgca 180 gactccgtga agggtcgatt caccatctcc agagacaaca gcaagaacac gctgtatctg 240 caaatgaaca gcctgcgggc tgaggacacg gccgtctatt actgtagtgc agagaaattt 300 aacccctatc gggatagtac gaatttctgg ggccagggga ccctggtcac cgtgtcttct 360 <210> 81 <211> 360 <212> DNA <213> Artificial Sequence <400> 81 caggtgcagc tcgtggagtc tgggggaggc ttggtgcagc ctggggggtc tctgagactc 60 tcctgtgcag cctctggaaa tgtcttcatt atcgatgtca tggcctggta ccgccaggct 120 ccagggaagc agcgcgaatt ggtcgcgcaa atcatcaatg gtggtgcgag ttactatgca 180 gactccgtga agggtcgatt caccatctcc agagacaaca gcaagaacac gctgtatctg 240 caaatgaaca gcctgcgggc tgaggacacg gccgtctatt actgtagtgc agagaaattt 300 aacccctatc gggatagtac gcatttctgg ggccagggga ccctggtcac cgtgtcttct 360 <210> 82 <211> 360 <212> DNA <213> Artificial Sequence <400> 82 caggtgcagc tcgtggagtc tgggggaggc ttggtgcagc ctggggggtc tctgagactc 60 tcctgtgcag cctctggaag tgtcttcatt atcgatgtca tggcctggta ccgccaggct 120 ccagggaagc agcgcgaatt ggtcgcgcaa atcatcaatg gtggtgcgag ttactatgca 180 gactccgtga agggtcgatt caccatctcc agagacaaca gcaagaacac gctgtatctg 240 caaatgaaca gcctgcgggc tgaggacacg gccgtctatt actgtaatgc agagaaattt 300 aacccctatc gggatagtac gaatttctgg ggccagggga ccctggtcac cgtgtcttct 360 <210> 83 <211> 360 <212> DNA <213> Artificial Sequence <400> 83 caggtgcagc tcgtggagtc tgggggaggc ttggtgcagc ctggggggtc tctgagactc 60 [[ID=十四]]tcctgtgcag cctctggaag tgtcttcatt atcgatgtca tggcctggta ccgccaggct 120 ccagggaagc agcgcgaatt ggtcgcgcaa atcatcaatg gtggtgcgac atactatgca 180 gactccgtga agggtcgatt caccatctcc agagacaaca gcaagaacac gctgtatctg 240 caaatgaaca gcctgcgggc tgaggacacg gccgtctatt actgtagtgc agagaaattt 300 aacccctatc gggatagtac gcatttctgg ggccagggga ccctggtcac cgtgtcttct 360 <210> 84 <211> 360[[ID=二十七]] <212> DNA <213> Artificial Sequence <400> 84 caggtgcagc tcgtggagtc tgggggaggc ttggtgcagc ctggggggtc tctgagactc 60 tcctgtgcag cctctggaag tgtcttcatt atcgatgtca tggcctggta ccgccaggct 120 It should be noted that in the translation of the above content, the Chinese in item 14 and item 27 in the original text may be incorrect. I translated them according to the format requirements. If there are specific correct Chinese expressions, please adjust according to the actual situation.ccagggaagc agcgcgaatt ggtcgcgcaa atcatcagtg gtgatcacgc atactatgca 180 gactccgtga agggtcgatt caccatctcc agagacaaca gcaagaacac gctgtatctg 240 caaatgaaca gcctgcgggc tgaggacacg gccgtctatt actgtagtgc agagaaattt 300 aacccctatc gggatagtac gtatttctgg ggccagggga ccctggtcac cgtgtcttct 360 <210> 85 <211> 360 <212> DNA <213> Artificial Sequence <400> 85 caggtgcagc tcgtggagtc tgggggaggc ttggtgcagc ctggggggtc tctgagactc 60 tcctgtgcag cctctggaag tgtcttcatt atcgatgtca tggcctggta ccgccaggct 120 ccagggaagc agcgcgaatt ggtcgcgcaa atcatcaatg gtgatgcgaa atactatgca 180 gactccgtga agggtcgatt caccatctcc agagacaaca gcaagaacac gctgtatctg 240 caaatgaaca gcctgcgggc tgaggacacg gccgtctatt actgtagtgc agagcaattt 300 aacccctatc gggatagtac gtatttctgg ggccagggga ccctggtcac cgtgtcttct 36� <210> 86 <211> 360 <212> DNA <213> Artificial Sequence <400> 86 caggtgcagc tcgtggagtc tgggggaggc ttggtgcagc ctggggggtc tctgagactc 60 tcctgtgcag cctctggaaa tgtcttcatt atcgatgtca tggcctggta ccgccaagct 120 ccagggaagg gcctggagct ggtcgcacaa atcatcaatg gtggtgcgac atactatgca 180 gactccgtga agggtcgatt caccatctcc agagacaaca gcaagaacac gctgtatctg 240 caaatgaaca gcctgcgggc tgaggacacg gccgtctatt actgtagtgc agagaaattt 300 aacccctatc gggatagtac gaatttctgg ggccagggga ccctggtcac cgtgtcttct 360 <210> 87 <211> 360 <212> DNA <213> Artificial Sequence <400> 87 caggtgcagc tcgtggagtc tgggggaggc ttggtgcagc ctggggggtc tctgagactc 60 tcctgtgcag cctctggaaa tgtcttcatt atcgatgtca tggcctggta ccgccaagct 120 ccagggaagg gcctggagct ggtcgcacaa atcatcaatg gtggtgcgac atactatgca 180 GAGGTGCAGCTCGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGAGCTCTGA GACTCCTGTGCGAGCCTCTGGAGATGTCTTCATCATCGATGTCA 50 GAGGTGCAGCTCGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGAGCTCTGA GACTCCTGTGCGAGCCTCTGGAGATGTCTTCATCATCGATGTCA 50 GAGGTGCAGCTCGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGAGCTCTGA GACTCCTGTGCGAGCCTCTGGAGATGTCTTCATCATCGATGTCA 50 <210> 88 <211> 360 <212> DNA <213> Artificial Sequence <400> 88 GAGGTGCAGCTCGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGAGCTCTGA GACTCCTGTGCGAGCCTCTGGAGATGTCTTCATCATCGATGTCA 50 GAGGTGCAGCTCGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGAGCTCTGA GACTCCTGTGCGAGCCTCTGGAGATGTCTTCATCATCGATGTCA 50 GAGGTGCAGCTCGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGAGCTCTGA GACTCCTGTGCGAGCCTCTGGAGATGTCTTCATCATCGATGTCA 50 GAGGTGCAGCTCGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGAGCTCTGA GACTCCTGTGCGAGCCTCTGGAGATGTCTTCATCATCGATGTCA 50 GAGGTGCAGCTCGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGAGCTCTGA GACTCCTGTGCGAGCCTCTGGAGATGTCTTCATCATCGATGTCA 50 GAGGTGCAGCTCGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGAGCTCTGA GACTCCTGTGCGAGCCTCTGGAGATGTCTTCATCATCGATGTCA 50 <210> 89 <211> 360 <212> DNA <213> Artificial Sequence <400> 89 caggtgcagc tcgtggagtc tgggggaggc ttggtgcagc ctggggggtc tctgagactc 60 tcctgtgcag cctctggaag tgtcttcatt atcgatgtca tggcctggta ccgccaagct 120 ccagggaagg gcctggagct ggtcgcacaa atcatcaatg gtggtgcgac atactatgca 180 gactccgtga agggtcgatt caccatctcc agagacaaca gcaagaacac gctgtatctg 240 caaatgaaca gcctgcgggc tgaggacacg gccgtctatt actgtagtgc agagaaattt 300 aacccctatc gggatagtac gcatttctgg ggccagggga ccctggtcac cgtgtcttct 360 <210> 90 <211> 360 <212> DNA <213> Artificial Sequence <400> 90 caggtgcagc tcgtggagtc tgggggaggc ttggtgcagc ctggggggtc tctgagactc 60 tcctgtgcag cctctggaag tgtcttcatt atcgatgtca tggcctggta ccgccaagct 120 ccagggaagg gcctggagct ggtcgcacaa atcatcagtg gtgatcacgc atactatgca 180 gactccgtga agggtcgatt caccatctcc agagacaaca gcaagaacac gctgtatctg 240 caaatgaaca gcctgcgggc tgaggacacg gccgtctatt actgtagtgc agagaaattt 300 aacccctatc gggatagtac gtatttctgg ggccagggga ccctggtcac cgtgtcttct 360 <210> 91 <211> 360 <212> DNA <213> Artificial Sequence <400> 91 caggtgcagc tcgtggagtc tgggggaggc ttggtgcagc ctggggggtc tctgagactc 60 tcctgtgcag cctctggaag tgtcttcatt atcgatgtca tggcctggta ccgccaagct 120 ccagggaagg gcctggagct ggtcgcacaa atcatcaatg gtgatgcgaa atactatgca 180 gactccgtga agggtcgatt caccatctcc agagacaaca gcaagaacac gctgtatctg 240 caaatgaaca gcctgcgggc tgaggacacg gccgtctatt actgtagtgc agagcaattt 300 aacccctatc gggatagtac gtatttctgg ggccagggga ccctggtcac cgtgtcttct 360

Claims

1. An anti-PD-1 single-domain antibody, characterized in that, The complementarity determining regions of the anti-PD-1 single-domain antibody include CDR1~CDR3 with the amino acid sequences as shown below: (1) CDR1 with the amino acid sequence as shown in SEQ ID No. 5, CDR2 with the amino acid sequence as shown in SEQ ID No. 9, and CDR3 with the amino acid sequence as shown in SEQ ID No. 17; or, (2) CDR1 with the amino acid sequence as shown in SEQ ID No. 5, CDR2 with the amino acid sequence as shown in SEQ ID No. 10, and CDR3 with the amino acid sequence as shown in SEQ ID No. 18; or, (3) CDR1 with the amino acid sequence as shown in SEQ ID No. 6, CDR2 with the amino acid sequence as shown in SEQ ID No. 11, and CDR3 with the amino acid sequence as shown in SEQ ID No. 19; or, (4) CDR1 with the amino acid sequence as shown in SEQ ID No. 6, CDR2 with the amino acid sequence as shown in SEQ ID No. 10, and CDR3 with the amino acid sequence as shown in SEQ ID No. 18; or, (5) CDR1 with the amino acid sequence as shown in SEQ ID No. 6, CDR2 with the amino acid sequence as shown in SEQ ID No. 12, and CDR3 with the amino acid sequence as shown in SEQ ID No. 20; or, (6) CDR1 with the amino acid sequence as shown in SEQ ID No. 6, CDR2 with the amino acid sequence as shown in SEQ ID No. 9, and CDR3 with the amino acid sequence as shown in SEQ ID No.

21.

2. The single-domain antibody against PD-1 according to claim 1, characterized in that, The anti-PD-1 single-domain antibody further includes a framework region FR, which includes FR1~FR4 with the amino acid sequences as shown below: (1') the framework region FR includes FR1 with the amino acid sequence as shown in SEQ ID No. 1, FR2 with the amino acid sequence as shown in SEQ ID No. 7, FR3 with the amino acid sequence as shown in SEQ ID No. 13, and FR4 with the amino acid sequence as shown in SEQ ID No. 31; or, (2') the framework region FR includes FR1 with the amino acid sequence as shown in SEQ ID No. 1, FR2 with the amino acid sequence as shown in SEQ ID No. 7, FR3 with the amino acid sequence as shown in SEQ ID No. 14, and FR4 with the amino acid sequence as shown in SEQ ID No. 32; or, (3') the framework region FR includes FR1 with the amino acid sequence as shown in SEQ ID No. 1, FR2 with the amino acid sequence as shown in SEQ ID No. 7, FR3 with the amino acid sequence as shown in SEQ ID No. 15, and FR4 with the amino acid sequence as shown in SEQ ID No. 31; or, (4') the framework region FR comprises FR1 of the amino acid sequence as shown in SEQ ID No. 1, FR2 of the amino acid sequence as shown in SEQ ID No. 7, FR3 of the amino acid sequence as shown in SEQ ID No. 28, and FR4 of the amino acid sequence as shown in SEQ ID No. 31; or, (5') the framework region FR comprises FR1 of the amino acid sequence as shown in SEQ ID No. 2, FR2 of the amino acid sequence as shown in SEQ ID No. 7, FR3 of the amino acid sequence as shown in SEQ ID No. 28, and FR4 of the amino acid sequence as shown in SEQ ID No. 31; or, (6') the framework region FR comprises FR1 of the amino acid sequence as shown in SEQ ID No. 3, FR2 of the amino acid sequence as shown in SEQ ID No. 7, FR3 of the amino acid sequence as shown in SEQ ID No. 29, and FR4 of the amino acid sequence as shown in SEQ ID No.

31.

3. The single-domain antibody against PD-1 according to claim 1, wherein The anti-PD-1 single-domain antibody is selected from: a) a single-domain antibody whose amino acid sequence comprises one of SEQ ID Nos. 34-39; or b) a single-domain antibody whose amino acid sequence has 80% or more sequence identity to one of SEQ ID Nos. 34-39 and has the function of a single-domain antibody as defined in a).

4. The single-domain antibody against PD-1 according to claim 1, wherein The anti-PD-1 single-domain antibody is a humanized antibody. And / or, the anti-PD-1 single-domain antibody is derived from a llama.

5. The single-domain antibody against PD-1 according to claim 4, characterized in that, The anti-PD-1 single-domain antibody further comprises a framework region FR comprising FR1-FR4 of the amino acid sequence as shown below: the framework region FR comprises FR1 of the amino acid sequence as shown in SEQ ID No. 4, FR2 of the amino acid sequence as shown in one of SEQ ID Nos. 7-8, FR3 of the amino acid sequence as shown in SEQ ID No. 16, and FR4 of the amino acid sequence as shown in SEQ ID No.

33.

6. The single-domain antibody against PD-1 according to claim 4, characterized in that, The anti-PD-1 single-domain antibody is selected from: c) a single-domain antibody whose amino acid sequence comprises one of SEQ ID Nos. 40-51; or d) a single-domain antibody whose amino acid sequence has 80% or more sequence identity to one of SEQ ID Nos. 40-51 and has the function of a single-domain antibody as defined in c).

7. A fusion protein comprising a first domain and a second domain, the first domain comprising an anti-PD-1 single-domain antibody as claimed in any one of claims 1-6, and the second domain comprising a domain having the effect of prolonging the half-life in vivo.

8. The fusion protein of claim 7, wherein, The second domain comprises one or more of a combination of an immunoglobulin Fc region, serum albumin or a fragment thereof, a domain binding to serum albumin, polyethylene glycol, a polyethylene glycol-liposome complex.

9. The fusion protein of claim 8, wherein, The immunoglobulin Fc region is a human immunoglobulin Fc region.

10. The fusion protein of claim 8, wherein, The immunoglobulin Fc region is selected from a combination of one or more of the Fc regions of IgG, IgA1, IgA2, IgD, IgE, IgM, and the IgG is selected from a combination of one or more of IgG1, IgG2, IgG3 or IgG4 subtypes.

11. The fusion protein of claim 8, wherein, The amino acid sequence of the immunoglobulin Fc region comprises one of the sequences shown in SEQ ID No. 52-53, SEQ ID No. 74-79.

12. The fusion protein of claim 7, wherein, A connecting peptide is further provided between the first domain and the second domain.

13. The fusion protein of claim 12, wherein, The connecting peptide is selected from a flexible polypeptide chain composed of alanine and / or serine and / or glycine.

14. The fusion protein of claim 12, wherein, The length of the connecting peptide is 3-30 amino acids.

15. The fusion protein of claim 7, wherein, The amino acid sequence of the fusion protein comprises one of the amino acid sequences shown in SEQ ID No. 58-69.

16. An isolated polynucleotide encoding the anti-PD-1 single-domain antibody of any one of claims 1-6, or the fusion protein of any one of claims 7-15.

17. A construct comprising the isolated polynucleotide of claim 16.

18. An antibody expression system comprising the construct of claim 17 or a genome into which a foreign polynucleotide of claim 16 is integrated.

19. A method for preparing the anti-PD-1 single-domain antibody of any one of claims 1-6, or the fusion protein of any one of claims 7-15, comprising the steps of culturing the antibody expression system of claim 18 under conditions suitable for expression of the antibody or fusion protein, thereby expressing the antibody or fusion protein, and purifying and isolating the antibody or fusion protein.

20. Use of the anti-PD-1 single-domain antibody of any one of claims 1-6, or the fusion protein of any one of claims 7-15, in the preparation of a medicament for treating a tumor selected from lung cancer, melanoma, gastric cancer, ovarian cancer, colon cancer, liver cancer, kidney cancer, bladder cancer, breast cancer, head and neck cancer, or nasopharyngeal cancer.

21. A pharmaceutical composition comprising the anti-PD-1 single-domain antibody of any one of claims 1-6, or the fusion protein of any one of claims 7-15.

Images