An RNA delivery system for treating amyotrophic lateral sclerosis

Abstract

The present application provides an RNA delivery system for treating amyotrophic lateral sclerosis, which comprises a delivery carrier and an RNA fragment capable of treating amyotrophic lateral sclerosis carried on the delivery carrier, the delivery carrier is capable of enriching in the organ tissue of a host, and endogenously and spontaneously forming a complex structure containing the RNA fragment capable of treating amyotrophic lateral sclerosis in the organ tissue of the host, the complex structure is capable of delivering the RNA fragment into a target tissue, and achieving the treatment of amyotrophic lateral sclerosis. The safety and reliability of the RNA delivery system for treating amyotrophic lateral sclerosis have been fully verified, the drug property is very good, the universality is strong, and the economic benefits and application prospect are excellent.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and more specifically to an RNA delivery system for treating amyotrophic lateral sclerosis (ALS). Background Technology

[0002] Amyotrophic lateral sclerosis (ALS), also known as Lou Gehrig's disease, is a progressive neurodegenerative disease affecting major motor neurons in the cerebral cortex and spinal cord. It ultimately leads to severe muscle weakness and respiratory failure, a process described as the body gradually freezing, hence the nickname "ALS patients." The renowned physicist Stephen Hawking was a patient with this disease. ALS is generally divided into sporadic and familial ALS, typically developing in mid-adulthood, but can also begin in one's teens, twenties, or later in life. The average survival time is 3-4 years. Its incidence rate is 2-3 per 100,000 people in Europe and 0.7-0.8 per 100,000 people in Asia. The incidence rate in men is typically 1.2-1.5 times higher than in women. Statistics indicate that 15 million living people worldwide will die from ALS. Due to its high mortality rate and lack of effective treatment, ALS is listed by the World Health Organization as one of the five leading causes of death worldwide, alongside cancer, AIDS, leukemia, and rheumatoid arthritis.

[0003] To date, the pathogenesis of ALS is not fully understood. Known causes include: induction of endoplasmic reticulum stress and inhibition of protein degradation, excessive activation of microglia, reduced energy supply due to decreased monocarboxylate transporter 1 (MCT1), glutamate-mediated excitotoxicity, cytoskeleton disruption and impaired axonal transport, and RNA metabolism defects. Despite extensive research into the pathogenesis of ALS, there is still no effective treatment to reverse the rapid decline in muscle atrophy, and most patients only begin their death countdown after diagnosis.

[0004] Currently, two chemical drugs are widely used clinically to treat ALS. Riluzole, the first conventional drug approved by the FDA for treating ALS, inhibits the toxic damage of glutamate to neurons through various pathways. However, its efficacy is limited, only prolonging patients' survival by 2-3 months and not reversing the damage already caused to motor neurons. The other drug, edaravone (a free radical scavenger), can scavenge oxygen free radicals, including nitric oxide and peroxynitrite anions, but it can only slow the progression of early ALS and is currently only available in the United States and Japan. Both chemical drugs have strong side effects, causing patients to experience fatigue, stomach discomfort, and elevated plasma transaminase levels. Summary of the Invention

[0005] To address the aforementioned technical limitations, this invention proposes an RNA delivery system for treating amyotrophic lateral sclerosis (ALS), which overcomes the deficiencies and defects mentioned in the background art.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] The inventive point of this invention is to provide an RNA delivery system for treating amyotrophic lateral sclerosis (ALS). The system includes a delivery vector and an RNA fragment for treating ALS carried on the delivery vector. The delivery vector is capable of accumulating in the host's organ tissues and spontaneously forming a composite structure containing the RNA fragment for treating ALS in the host organ tissues. The composite structure is capable of delivering the RNA fragment into the target tissue to achieve treatment of ALS.

[0008] Optionally, in the above-described RNA delivery system for treating amyotrophic lateral sclerosis (ALS), the delivery vector is a plasmid vector or a viral vector; the RNA fragment contains one, two, or more specific RNA sequences of medical significance, wherein the RNA sequence is a medically significant siRNA, shRNA, or miRNA capable of inhibiting or hindering the development of ALS.

[0009] Optionally, in the above-described RNA delivery system for treating amyotrophic lateral sclerosis (ALS), the RNA sequence capable of treating ALS is 15-25 nucleotides in length, preferably siRNA of the SOD1 gene, or an RNA sequence with greater than 90% homology to the siRNA sequence of the SOD1 gene, or a nucleic acid molecule encoding the aforementioned RNA; more preferably, the siRNA of the SOD1 gene includes the sequence shown in SEQ ID No. 1, other sequences that inhibit SOD1 gene expression, and sequences with greater than 90% homology to the sequence shown in SEQ ID No. 1.

[0010] The siRNA sequence of the SOD1 gene, SEQ ID No. 1, is:

[0011] ACATCGGCCACAGCATCTT.

[0012] Optionally, in the aforementioned RNA delivery system for treating amyotrophic lateral sclerosis (ALS), the delivery vector includes a promoter and a targeting tag. The targeting tag is capable of forming a targeting structure of the composite structure in the host's organ tissue. The targeting structure is located on the surface of the composite structure, and the composite structure can locate and bind to the target tissue through the targeting structure, thereby delivering the RNA fragment into the target tissue.

[0013] Optionally, in the above-described RNA delivery system for treating amyotrophic lateral sclerosis (ALS), the delivery vector includes any one or a combination of the following circuits: promoter-RNA fragment, promoter-target tag, promoter-RNA fragment-target tag; each viral vector includes at least one RNA fragment and one target tag, wherein the RNA fragment and the target tag are located in the same circuit or in different circuits.

[0014] Optionally, in the RNA delivery system for treating amyotrophic lateral sclerosis described above, the delivery vector further includes flanking sequences, compensating sequences, and loop sequences that enable the circuit to fold into the correct structure and be expressed, wherein the flanking sequences include 5' flanking sequences and 3' flanking sequences;

[0015] The delivery vector includes any one or a combination of the following circuits: 5'-promoter-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence, 5'-promoter-target tag, 5'-promoter-target tag-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence.

[0016] Optionally, in the RNA delivery system for treating amyotrophic lateral sclerosis described above, the 5' flanking sequence is the sequence ggatcctggaggcttgctgaaggctgtatgctgaattc shown in SEQ ID No. 6 or a sequence with greater than 90% homology to it.

[0017] The loop sequence is the sequence gttttggccactgactgac shown in SEQ ID No.7 or a sequence with greater than 90% homology to it;

[0018] The 3' flanking sequence is the sequence accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag, as shown in SEQ ID No. 8, or a sequence with greater than 90% homology to it.

[0019] The compensation sequence is the reverse complementary sequence of the RNA fragment, with any 1-5 bases deleted.

[0020] Optionally, in the RNA delivery system for treating amyotrophic lateral sclerosis described above, when there are at least two types of circuits in the delivery vector, adjacent circuits are connected by a sequence consisting of SEQ ID No. 2-SEQ ID No. 4;

[0021] Among them, SEQ ID No. 2 is CAGATC, SEQ ID No. 3 is a sequence consisting of 5-80 bases TGGCCGCACTCGAGGTAGTGAGTCGACCAG, and SEQ ID No. 4 is TGGATC.

[0022] Optionally, in the RNA delivery system for treating amyotrophic lateral sclerosis described above, when at least two lines exist in the delivery vector, adjacent lines are linked by SEQ ID No. 5 or a sequence with greater than 90% homology to SEQ ID No. 5; wherein SEQ ID No. 5 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.

[0023] Optionally, in the above-described RNA delivery system for treating amyotrophic lateral sclerosis (ALS), the organ tissue is the liver, and the composite structure is an exosome.

[0024] Optionally, in the aforementioned RNA delivery system for treating amyotrophic lateral sclerosis (ALS), the targeting tag is selected from targeting peptides or targeting proteins with targeting functions; the targeting peptides include RVG targeting peptide, GE11 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide, and MSP targeting peptide; the targeting proteins include RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, and MSP-LAMP2B fusion protein.

[0025] Optionally, in the above-described RNA delivery system for treating amyotrophic lateral sclerosis, the RNA sequence is 15-25 nucleotides in length.

[0026] Optionally, the above-described RNA delivery system for treating amyotrophic lateral sclerosis is a delivery system for use in mammals, including humans.

[0027] The second inventive point of this invention is to provide the application of the above-described RNA delivery system for treating amyotrophic lateral sclerosis in a pharmaceutical.

[0028] Optionally, in the above-described applications, the drug is a drug for treating amyotrophic lateral sclerosis (ALS) and related diseases, and the drug is administered via oral, inhalation, subcutaneous injection, intramuscular injection, or intravenous injection.

[0029] Compared with the prior art, the present invention has the following advantages:

[0030] The RNA delivery system for treating amyotrophic lateral sclerosis (ALS) provided by this invention uses plasmids or viruses as vectors. These vectors, as mature inoculants, have had their safety and reliability well-established and exhibit excellent drug-likeness. The RNA sequence that ultimately exerts its effect is delivered via endogenous exosomes, eliminating the need for any immune response and verification of the exosomes' safety. This delivery system can deliver various small RNA molecules, demonstrating strong versatility. Furthermore, the preparation of viral vectors is significantly cheaper than that of exosomes or proteins and peptides, making it more economical. After self-assembly in vivo, the RNA delivery system for treating ALS provided by this invention can tightly bind to AGO2 and accumulate into a complex structure (exosome), preventing premature degradation, maintaining its stability in circulation, and facilitating absorption by recipient cells, intracytoplasmic release, and lysosomal escape, requiring a low dosage.

[0031] The RNA delivery system for treating amyotrophic lateral sclerosis (ALS) provided by this invention, when applied to drugs, provides a drug delivery platform that can greatly improve the treatment effect of ALS. It can also form the basis for the research and development of more RNA-based drugs, which will greatly promote the research and development and use of RNA-based drugs. Attached Figure Description

[0032] Figure 1 The diagram shows the gene loop for ALS treatment according to the present invention, which mainly includes elements such as the CMV promoter, lamp2b-RVG exosome targeting peptide, multiple cloning sites such as EcoRI and AgeRI, and the selected siRNA sequence.

[0033] Figure 2 The image shows a comparison of SOD1 levels in successfully constructed mutant and wild-type HEK293T cell lines. A: Relative SOD1 mRNA content was determined by qRT-PCR; B: Cell protein extracts were measured by Western blot; C: GFP fluorescence expression in the cell lines was determined by fluorescence microscopy. The LV-control group consisted of HEK293T cells stably transfected with GFP alone, while the LV-SOD1G93A-GFP group consisted of HEK293T cells stably transfected with the successfully constructed SOD1-GFP fusion protein. The SOD1G93A-GFP protein size is approximately 45 kDa, the SOD1-WT protein size is approximately 18 kDa, and the GAPDH protein size is 37 kDa.

[0034] Figure 3 This section shows the screening and validation of siRNAs and the construction of gene loops; A: qRT-PCR analysis comparing the knockdown efficiency of five siRNA sequences on SOD1 mRNA; B: Western blot analysis comparing the knockdown efficiency of five siRNA sequences on SOD1 protein; SOD1G93A The bands are eGFP and SOD1 G93A The fusion protein is approximately 45 kDa; the control GAPDH protein is approximately 37 kDa. The efficiency of expressing nonsense scrR with five different siRNA sequences was compared.

[0035] Figure 4 The results show the in vitro knockdown efficiency of the gene loop; A: Gene loop transfection into HEK293T cells, SOD1 siRNA expression level detected by qRT-PCR; B: Gene loop transfection into stably transfected eGFP-SOD1 cells. G93A HEK293T cells were used to analyze the relative expression level of SOD1 mRNA using qRT-PCR; C: gene loop transfection into stably transfected eGFP-SOD1 G93A HEK293T cells were used for Western blot analysis of the relative expression level of SOD1 protein; PBS: untreated group; CMV-siRscrR: CMV promoter transcription nonsense siRNA sequence group; CMV-siRSOD1: CMV promoter transcription mutant SOD1 siRNA sequence group; CMV-RVG-siRSOD1: CMV promoter transcription mutant SOD1 siRNA sequence group with added RVG targeting peptide group.

[0036] Figure 5 The results show the characterization and qualitative analysis of plasma exosomes extracted from the tail vein injection gene loop; where A: NTA detection of the particle size of exosomes extracted from each group; B: Transmission electron microscopy analysis of the characteristic morphology of purified exosomes; C: Western blot detection of exosome marker proteins Alix, TSG101 and CD9.

[0037] Figure 6 The exosomes from the plasma of mice that had received a gene loop via tail vein injection were stained in vitro and then compared with those of mice stably transfected with eGFP-SOD1. G93A SHSY-5Y cells were co-cultured; where A: schematic diagram of mouse exosome in vitro labeling and cell co-culture; B: results of fluorescence expression detection by confocal microscopy; PKH67 staining is for exosomes, and DAPI labeling is for cell nuclei, shown as red and blue respectively.

[0038] Figure 7 The image shows the knockdown effect of plasma exosomes from mice co-cultured with cells after gene loop injection. The images also show the plasma exosomes extracted from mice after gene loop injection and the stable transgenic eGFP-SOD1 cells. G93ASHSY-5Y cells were co-cultured; where A: SOD1 siRNA level in cell supernatant exosomes; B: relative expression level of SOD1 mRNA analyzed by qRT-PCR; C: relative expression level of SOD1 protein analyzed by Western blot.

[0039] Figure 8 The results show the targeted tracing of in vivo delivery of exosomes that are self-assembled in vivo; the expression levels of siRNA in mouse plasma (A), cerebral cortex (B), and spinal cord (C) after injection of four gene loops: PBS, CMV-siRscrR, CMV-siRSOD1, and CMV-RVG-siRSOD1; exosomes extracted from mouse plasma were stained in vitro and injected into other mice, and fluorescence changes in the liver (D), cerebral cortex (E), and spinal cord (F) were observed by confocal microscopy.

[0040] Figure 9 This demonstrates the targeted tracing of in vivo delivery of exosomal siRNAs that are self-assembled in vivo. In the spinal cords of mice injected with PBS and three different gene loops, siRNA sequences designed into gene loops were specifically hybridized using DIG-labeled LNA probes, and fluorescence signals were detected by confocal microscopy.

[0041] Figure 10 The results show the differences in body weight, survival time, and motor performance between Tg(SOD1G93A) mice and wild-type mice; (A) tail identification results: the first 21 wells contain PCR products of the tail genome of SOD1 transgenic mice, and wells 22-24 contain PCR products of the tail genome of WT mice. The PCR cycle number was 35 cycles, and IL-2 was used as an internal control; (B) body weight change trend; (C) mouse survival time; (D) Rotarod rotator test: the rotator speed was uniformly accelerated from 0 rpm to 40 rpm within 3 min, and the mouse fall time was recorded. If it exceeded 180 s, it was recorded as 180 s. The measurement was performed 3 times, with an interval of 30 min between each measurement, and the maximum value among the 3 measurements was recorded; WT Female: n=4, WT Male: n=4, Tg(SOD1G93A) G93A Female: n=7, Tg(SOD1) G93A Male: n = 7, **** indicates p < 0.0001.

[0042] Figure 11 The diagram shows the macroscopic phenotypic changes of mice in each group during and after the treatment period; where A: schematic diagram of the treatment period; B: trend of weight change of mice in each group; C: trend of grip strength change of mice in each group; D: trend of performance change of mice in each group on the rotarod fatigue tester; E: survival curve of mice in each group.

[0043] Figure 12The data shows a comparison of SOD1 mRNA and protein levels in the spinal cord of mice after each gene loop treatment cycle. A: qRT-PCR was used to determine the relative expression level of SOD1 mRNA in the spinal cord of each group of mice; B: Western blot was used to determine the relative expression level of SOD1 protein in each group.

[0044] Figure 13 The image shows immunofluorescence staining of SOD1 in the cerebral cortex and spinal cord of mice in each group after gene loop injection; where A: cerebral cortex; B: spinal cord (lumbar vertebrae L3-L5).

[0045] Figure 14 The figures show the relative expression levels of GFAP and CD68 in the cortex (A) and spinal cord (B) of mice in each group after gene loop injection; where GFAP marks astrocytes and CD68 marks activated microglia.

[0046] Figure 15 The image shows an assessment of the total number of neurons and motor neurons in the ventral horn of the gray matter of the mouse spinal cord; ChAT staining positivity represents motor neurons, and NeuN staining positivity represents total neurons.

[0047] Figure 16 The image shows the degree of hind limb muscle atrophy in mice after gene loop injection; where A: the degree of hind limb muscle atrophy in each group of mice; B: Lamanin-stained muscle fiber outlines, with the red-enclosed area representing the area of ​​each muscle fiber bundle.

[0048] Figure 17 The following are the blood and tissue safety indicators for mice treated with gene loop injection: A: platelet count (PLT); B: red blood cell count (RBC); C: white blood cell count (WBC); D: H&E staining of major organ sections. Detailed Implementation

[0049] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below. However, it should be understood that the description herein is merely illustrative and not intended to limit the scope of the invention.

[0050] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the specification is for the purpose of describing particular embodiments only and is not intended to limit the scope of the invention. All reagents and instruments used herein are commercially available, and the characterization methods involved are described in relevant prior art and will not be repeated herein.

[0051] To further understand the present invention, the present invention will be described in detail below with reference to the preferred embodiments.

[0052] Example 1

[0053] An RNA delivery system for treating amyotrophic lateral sclerosis (ALS) includes a delivery vector and an RNA fragment for treating ALS carried on the delivery vector. The delivery vector is enriched in a host organ or tissue and spontaneously and endogenously forms a composite structure containing the RNA fragment for treating ALS in the host organ or tissue. The composite structure delivers the RNA fragment into the target tissue to achieve treatment of ALS.

[0054] The delivery vector is a plasmid vector or a viral vector; the RNA fragment contains one, two or more specific RNA sequences with medical significance, which are siRNA, shRNA or miRNA that are medically significant and can inhibit or prevent the development of amyotrophic lateral sclerosis.

[0055] The RNA sequence capable of treating amyotrophic lateral sclerosis (ALS) is 15-25 nucleotides in length, preferably siRNA of the SOD1 gene, or an RNA sequence with greater than 90% homology to the siRNA sequence of the SOD1 gene, or a nucleic acid molecule encoding the above-mentioned RNA; more preferably, the siRNA of the SOD1 gene includes the sequence shown in SEQ ID No. 1, other sequences that inhibit SOD1 gene expression, and sequences with greater than 90% homology to the sequence shown in SEQ ID No. 1.

[0056] The siRNA sequence of the SOD1 gene, SEQ ID No. 1, is:

[0057] ACATCGGCCACAGCATCTT.

[0058] The delivery vector includes a promoter and a targeting tag. The targeting tag can form a targeting structure of the composite structure in the host's organ tissue. The targeting structure is located on the surface of the composite structure. The composite structure can find and bind to the target tissue through the targeting structure, and deliver the RNA fragment into the target tissue.

[0059] The delivery vector includes any one or a combination of the following circuits: promoter-RNA fragment, promoter-target tag, promoter-RNA fragment-target tag; each of the viral vectors includes at least one RNA fragment and one target tag, wherein the RNA fragment and the target tag are located in the same circuit or in different circuits.

[0060] The delivery carrier also includes flanking sequences, compensation sequences, and loop sequences that enable the circuit to be folded into the correct structure and expressed, the flanking sequences including 5' flanking sequences and 3' flanking sequences;

[0061] The delivery vector includes any one or a combination of the following circuits: 5'-promoter-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence, 5'-promoter-target tag, 5'-promoter-target tag-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence.

[0062] The 5' flanking sequence is the sequence ggatcctggaggcttgctgaaggctgtatgctgaattc shown in SEQ ID No. 6 or a sequence with greater than 90% homology to it;

[0063] The loop sequence is the sequence gttttggccactgactgac shown in SEQ ID No. 7 or a sequence with greater than 90% homology to it;

[0064] The 3' flanking sequence is the sequence shown in SEQ ID No. 8, accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag, or a sequence with greater than 90% homology to it.

[0065] The compensating sequence is the reverse complementary sequence of the RNA fragment, with any 1-5 bases deleted.

[0066] In the case where there are at least two types of circuits in the delivery carrier, adjacent circuits are connected by a sequence consisting of SEQ ID No. 2-SEQ ID No. 4;

[0067] Among them, SEQ ID No. 2 is CAGATC, SEQ ID No. 3 is a sequence consisting of 5-80 bases TGGCCGCACTCGAGGTAGTGAGTCGACCAG, and SEQ ID No. 4 is TGGATC.

[0068] In the case where at least two types of lines exist in the delivery carrier, adjacent lines are connected by SEQ ID No. 5 or a sequence that is more than 90% homologous to SEQ ID No. 5; wherein SEQ ID No. 5 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.

[0069] The organ tissue is the liver, and the complex structure is the exosome.

[0070] The targeting tag is selected from targeting peptides or targeting proteins with targeting functions; the targeting peptides include RVG targeting peptide, GE11 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide, and MSP targeting peptide; the targeting proteins include RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, and MSP-LAMP2B fusion protein.

[0071] RNA sequences are 15-25 nucleotides in length.

[0072] The delivery system is a delivery system for use in mammals, including humans.

[0073] The present invention also provides the application of the above-described RNA delivery system for treating amyotrophic lateral sclerosis in a pharmaceutical.

[0074] The medication is for the treatment of amyotrophic lateral sclerosis (ALS) and related diseases. It can be administered orally, by inhalation, subcutaneous injection, intramuscular injection, or intravenous injection.

[0075] Example 2

[0076] Design of synthetic biology elements and assembly of gene circuits targeting the central nervous system:

[0077] I. Regarding SOD1 G93A Screening for drugs with mutated siRNAs:

[0078] (1) Due to the unique nature of siRNA drug action, the existence of mRNA secondary structure, and the modification of various bases in the organism, the effectiveness of the siRNA corresponding to the mRNA of each gene cannot be screened solely by prediction using bioinformatics software, nor can the knockdown relationship be determined solely by complementary base pairing; in vitro experiments are required for verification. First, a lentivirus was constructed, and CMV was selected as the promoter, fused with overexpression of two proteins (GFP and mutated SOD1). G93A Because the patient's body contains SOD1, SOD1 G93A The protein coexists, but the HEK293T cells only contain wild-type SOD1, which cannot accurately simulate the patient's condition at the cellular level. Therefore, it is necessary to transfect the cells with a plasmid that can fuse and express the mutant protein.

[0079] During the construction of lentiviral plasmids, SOD1 is... G93A When fused with eGFP, the mutant fusion protein is approximately 45 kDa in size, which can be distinguished from the wild-type SOD1 protein (18 kDa).

[0080] (2) First, HEK293T cells were subjected to antibiotic tolerance experiments with different concentrations of puromycin at 1 mg / mL. HEK293T cells were seeded into 12-well plates, and when the cell density reached approximately 80%, different volumes of 1 mg / mL puromycin were added to each well. Based on literature reports, the effective working concentration of puromycin for HEK293T cells is approximately 1 μg / mL. If the puromycin concentration is too low, neither successfully infected nor unsuccessfully infected cells will die. However, if the puromycin concentration is too high, even successfully infected cells will die due to the excessive concentration. Therefore, an effective concentration is needed, at which HEK293T transfected cells begin to die, but not all cells die due to excessively high concentrations. Based on the above principle, in the lentivirus stable transfection experiment, the working concentration of puromycin was designed to start from 0 μg / mL, increasing in increments of 0.5 μg / mL, with a maximum working concentration of 5.5 μg / mL, to screen for the optimal effective working concentration of puromycin for HEK293T transfected cells.

[0081] (3) Using the constructed Lv-eGFP-SOD1 G93A Cells were infected with plasmids, and after medium change, puromycin at the optimal effective concentration was added for 48 hours to select stable cell lines. Western blot and qRT-PCR were used to verify the successful construction of stable cell lines. Subsequently, five designed siRNA fragments were transfected into the successfully constructed stable eGFP-SOD1 cells using lipofectamine RNAiMAX. G93A In HEK293T cells, Western blot and qRT-PCR were used to detect the mutation of SOD1 after 48 hours. G93A The siRNA sequence with the best knockdown effect ( Figure 3 ).

[0082] The five siRNA sequences are as shown in SEQ ID No. 9-SEQ ID No. 13:

[0083] siRNAG93A.1 (SEQ ID No. 9):

[0084] AUCGGCCACAGCAUCUUUGUC;

[0085] siRNAG93A.2 (SEQ ID No. 10):

[0086] ACAUCGGCCACAGCAUCUU;

[0087] siRNAG93A.3 (SEQ ID No. 11):

[0088] GACACAUCGGCCACAGCAUC;

[0089] siRNA G93A.4 (SEQ ID No. 12):

[0090] CGUAAUUUCCUGACUGACU;

[0091] siRNA G93A.5 (SEQ ID No. 13):

[0092] ACUCAAACCUCUAUUAUGC.

[0093] II. Assembly of gene loops:

[0094] First, select the SOD1 G93A The siRNA sequence was embedded into the pre-miR-155 backbone to form the siRNA expression element: the empty vector plasmid backbone was digested with restriction endonucleases EcoRI and AgeI, and the linear plasmid was recovered by gel excision; a pair of long primers containing the above-mentioned screening siRNA sequence were designed:

[0095] SEQ ID No. 14:

[0096] AATTCGACATCGGCCACAGCATCTTGTTTTGGCCACTGACTGACAAGATGCTGTGG CCGATGTCA;

[0097] SEQ ID No. 15:

[0098] CCGGTGACATCGGCCACAGCATCTTGTCAGTCAGTGGCCAAAACAAGATGCTGTG GCCGATGTCG;

[0099] After annealing, a short double-stranded DNA fragment was obtained. The empty linear plasmid recovered from the gel and the annealed double-stranded DNA were ligated using T4 ligase. The ligation product was transformed into competent E. coli and plated on spectinomycin-resistant LB solid medium. Single colonies were selected the next day for molecular cloning and product sequencing to confirm the correctness of the product sequence.

[0100] Based on this, the RDP sequence of RVG-derived peptides is assembled into the gene loop, located after the CMV promoter and before the Lamp2b sequence, anchoring RVG to exosomes to achieve crossing the blood-brain barrier and targeting the central nervous system.

[0101] Gene loop diagrams are as follows Figure 1 As shown.

[0102] Example 3

[0103] In vitro efficacy validation of synthetic biological elements and gene circuits:

[0104] (1) In order to select the promoter element with the best transcription efficiency for siRNA, the transcription of SOD1 siRNA was driven in HEK293T cells using promoters such as CMV and U6. The expression level of SOD1 siRNA was detected by qRT-PCR and Northern blot to determine the optimal promoter element.

[0105] (2) In order to select a backbone structure that produces as many guide strands as possible and as few passenger strands as possible, the expression of SOD1 siRNA after embedding into the promoter was compared between the pre-miRNA backbone (matching the CMV promoter) and the shRNA backbone (matching the U6 promoter). The ratio of SOD1 siRNA guide strands to passenger strands generated after gene loop transfection of HEK293T cells was compared to optimize the backbone structure of siRNA expression elements to the greatest extent.

[0106] (3) To detect the efficiency of gene loop transcription of SOD1 siRNA and verify whether the siRNA is effectively encapsulated in exosomes: 48 h after transfection of gene loop, the supernatant of HEK293T cells was collected, and exosomes were collected by differential ultracentrifugation. The content of SOD1 siRNA in exosomes and supernatant was detected by qRT-PCR to verify that the constructed gene loop can work stably in cells in vitro and enable cells to secrete exosome-encapsulated siRNA.

[0107] (4) In order to test whether the central nervous system targeting peptide RVG can be successfully loaded onto the exosome membrane surface, RVG was fused to the N-terminus of the exosome intrinsic membrane protein Lamp2b to tag the exosome membrane surface with RVG. Based on this design, the Flag-Lamp2b sequence, which replaces the expression of RVG-Lamp2b, was inserted into the gene loop and transfected into HEK293T cells. Exosomes in the culture supernatant of HEK293T cells were captured using Flag and CD63 antibodies. If the enrichment was successful, it would indicate that Flag (i.e. RVG) can be accurately located on the exosome membrane surface.

[0108] (5) The new system should not only select SOD1 G93A The siRNA sequence with the best knockdown effect (the screening experiment did not use a gene loop but directly transfected siRNA) needs to be verified. Further validation is needed regarding the effect of the selected siRNA on SOD1 after it is constructed into a gene loop. G93AMutations do indeed have a knockdown effect. Therefore, three gene loops were constructed: the CMV-siRscrR gene loop expressing nonsense siRNA; the CMV-siRSOD1 gene loop expressing an effective SOD1 siRNA sequence but without a target peptide; and the CMV-RVG-siRSOD1 gene loop containing the central nervous system target peptide RVG and an effective SOD1 siRNA sequence. Using Lipofectamine 3000 transfection reagent, these three gene loops were transfected into successfully constructed stably transfected eGFP-SOD1G93AHEK293T cells. After 48 hours, qRT-PCR and Western blot were used to examine whether the constructed gene loops effectively knocked down SOD1. G93A .

[0109] (6) In order to detect the efficiency of the gene loop expressing multiple siRNAs and loading them into exosomes, two siRNA expression elements were tandemly connected in the gene loop to generate two kinds of siRNAs respectively. This gene loop was transfected into HEK293T cells, and exosomes in HEK293T cell culture medium were isolated and purified by ultracentrifugation. The levels of the two siRNAs in exosomes were detected by qRT-PCR and Northern blot.

[0110] To determine a suitable promoter element for efficient siRNA transcription, the efficiency of siRNA production and the ability to express eGFP protein and the target element (RVG-Lamp2b) were compared between two common siRNA transcription promoters, CMV and U62, in HEK293T cells. The results showed no significant difference in guide strand efficiency between the two promoters. However, the CMV promoter did not express a passenger strand, while the U6 promoter produced a large number of passenger strands (which could easily lead to off-target effects). Furthermore, only the CMV promoter had the ability to transcribe both eGFP and RVG-Lamp2b. Therefore, to reduce off-target effects and ensure normal expression of the target element, the CMV promoter was selected as the optimized promoter element for this gene loop.

[0111] In human diseases, mutated SOD1 abnormally accumulates in the central nervous system, forming SOD1 inclusion bodies, ultimately leading to ALS. To simulate the pathogenesis of the disease in vitro, Lv-eGFP-SOD1 was constructed. G93A Stable HEK293T cell line was constructed. After lentiviral infection and puromycin selection, the correctness of the stable cell line construction was verified by qRT-PCR and Western blot. Figure 2 As shown: the SOD1 mRNA level in the stable cell line was much higher than the SOD1 mRNA level in the normal HEK293T cell line. Figure 2A) Stable HEK293T cells successfully constructed after puromycin selection can overexpress SOD1 without affecting wild-type SOD1 expression. G93A The eGFP fusion protein has a molecular weight of approximately 45 kDa, which can be distinguished from the wild-type SOD1 protein of approximately 18 kDa. Figure 2 B); Compared with the normal HEK293T cells expressing GFP protein alone and showing a green fluorescent signal, the stable transfected cell lines stably express the GFP green fluorescent fusion protein (B); Figure 2 C), the results proved that the in vitro ALS mechanism model was successfully constructed.

[0112] Cell lines designed in this way have the following advantages:

[0113] 1. Stable overexpression of G93A mutant SOD1 protein to mimic the abnormal accumulation of SOD1 in the central nervous system;

[0114] 2. The G93A mutant SOD1 protein carried by the lentivirus is coupled to eGFP: due to the difference in protein size, the overexpressed mutant human SOD1 can be distinguished from the wild-type SOD1, and it is easy to observe during the infection process.

[0115] Using the established in vitro model, we began screening for siRNA sequences with good knockdown effects. Five siRNA sequences were designed using base pairing principles, bioinformatics prediction, and searching high-level journals. To verify whether these five double-stranded siRNA sequences could effectively knock down the G93A-mutated SOD1 protein, they were transfected with lipofectamine RNAiMAX reagent in a stably transfected eGFP-SOD1 model. G93A HEK293T cells were transfected into the cells when their density reached 60%-70%. Cells were collected 48 hours after transfection, and proteins and RNA were extracted for knockdown efficiency analysis. Results were based on qRT-PCR and Western blot analysis. Figure 3 A and B) found that SOD1-si-2 had the most significant knockdown effect on mutant SOD1 at both the protein and mRNA levels. Therefore, the si-2 sequence was preferred for embedding into the designed gene loop to knock down mutant SOD1 protein.

[0116] Long primers containing the miR-155 backbone and siRNA-2 sequence were synthesized. After annealing with complementary primers, a short oligonucleotide with sticky ends was produced. The empty vector plasmid backbone was then digested with restriction endonucleases EcoRI and AgeI, recovered via gel electrophoresis, and ligated together with the annealed long primer double strands using T4 ligase to obtain the gene loop. Figure 1 ).

[0117] To verify the function of the constructed gene loops in vitro, four groups—the constructed CMV-siRscrR gene loop, CMV-siRSOD1 gene loop, CMV-RVG-siRSOD1 gene loop, and the PBS control—were transfected into wild-type HEK293T cells. After 48 hours, cell supernatants were collected, exosomes were extracted, and RNA was further extracted from the exosomes. The relative content of SOD1 siRNA was detected by qRT-PCR. The results showed that the CMV-siRSOD1 and CMV-RVG-siRSOD1 gene loop groups yielded relatively abundant exosome-encapsulated SOD1 siRNA in the cell culture supernatant; however, after transfection into the control PBS and CMV-siRscrR groups, no effective SOD1 siRNA content was detected in the cell culture supernatant (e.g., σ0.05). Figure 4 (As shown in A). After confirming that the gene loop can be stably expressed in cells, it is necessary to further verify whether the gene loop can successfully knock down the mutant SOD1. This requires stable transduction of eGFP-SOD1. G93A HEK293T cells were transfected with PBS, CMV-siRScrR, CMV-siRSOD1, and CMV-RVG-siRSOD1 gene loops, respectively. After 48 hours, cells were harvested for protein and RNA extraction, and SOD1 knockdown was analyzed by Western blot and qRT-PCR. Results showed that the CMV-siRSOD1 and CMV-RVG-siRSOD1 gene loops were effective in knocking down SOD1 after transfection with stably transfected eGFP-SOD1. G93A After 48 hours, HEK293T cells showed significant knockdown of mutant SOD1 (e.g., at both the mRNA and protein levels). Figure 4 B, C).

[0118] Example 4

[0119] In vivo functional validation of synthetic biological elements and gene circuits:

[0120] (1) To verify that the composite gene loop consisting of the core gene loop (promoter element + SOD1 siRNA expression element) and the insertion element (targeting element RVG) can deliver SOD1 siRNA via exosomes in vivo: First, the CMV-siRSOD1 gene loop expressing only the SOD1 siRNA sequence was injected into mice via the tail vein. Plasma and plasma exosomes were separated, and major organs such as the liver, spleen, and kidneys of the mice were collected. The content of SOD1 siRNA was detected by qRT-PCR and Northern blot to demonstrate that the exosomal siRNA expressed in the liver is transported to various tissues and organs through blood circulation. The composite gene loop containing the central nervous system targeting peptide and SOD1 siRNA sequence (Flag was used to replace RVG for verification) was injected into mice via the tail vein. Plasma was separated, and exosomes were captured by Flag and CD63 antibody. The content of SOD1 siRNA in the exosomes was detected by qRT-PCR and Northern blot to demonstrate that this composite gene loop can generate exosomes containing external standard targeting peptides and siRNA at the in vivo level.

[0121] (2) The CMV-siRscrR gene loop expressing nonsense siRNA, the CMV-siRSOD1 gene loop expressing effective SOD1 siRNA sequence but without a target peptide, and the CMV-RVG-siRSOD1 gene loop containing the central nervous system target peptide RVG and the effective SOD1 siRNA sequence were injected into the tail vein of mice, respectively. Plasma exosomes were collected and reacted with Lv-eGFP-SOD1. G93A Lentiviral stably transfected SYSH-5Y cells were co-cultured to detect the knockdown effect of mouse plasma exosomes on SOD1 overexpression in the cell line. Changes in target siRNA and mRNA levels in cells were detected by qRT-PCR, and changes in SOD1 protein levels were detected by Western blot to further verify that the designed gene loop can function in treating mutant ALS. To mimic the abnormal accumulation of mutant SOD1 in the central nervous system, especially spinal cord neurons, in human ALS, Lv-eGFP-SOD1 was constructed. G93A The SHSY-5Y cell line, stably converted by lentivirus. The SHSY-5Y cell line is derived from human neuroblastoma and possesses certain characteristics of nervous system cells. Overexpression of mutant SOD1 in this cell line can be used to simulate the abnormal accumulation of mutant proteins in the central nervous system during the actual occurrence of the disease.

[0122] Lv-eGFP-SOD1 G93AThe lentivirally stable SYSH-5Y cell line was prepared as follows (similar to the preparation of the HEK293T stable cell line): Uninfected SHSY-5Y cells were seeded into 12-well plates. When the cell density reached approximately 80%, different volumes of 1 mg / mL puromycin were added to each well, increasing the final working concentration from 0 μg / mL in increments of 0.5 μg / mL, with the highest working concentration reaching 5.5 μg / mL (the literature reports that the effective working concentration of puromycin for SHSY-5Y cells is approximately 2 μg / mL). This preliminary experiment was used to screen for the optimal working concentration of this cell line. 48 hours after lentiviral infection, the medium was changed, and the optimal working concentration of puromycin was added to fresh culture medium for screening of stable cell lines, resulting in successfully infected Lv-eGFP-SOD1 cells. G93A The SHSY-5Y cell line of lentivirus.

[0123] (3) In vitro functional verification of the targeting peptide: In order to prove that the exosomal siRNA generated by the gene loop containing the targeting peptide can cross the blood-brain barrier and have a greater affinity for neuronal cells, PBS, the CMV-siRscrR gene loop expressing nonsense siRNA, the CMV-siRSOD1 gene loop expressing effective SOD1 siRNA sequence without the targeting peptide, and the CMV-RVG-siRSOD1 gene loop containing the central nervous system targeting peptide RVG and effective SOD1 siRNA sequence were injected into the tail vein of four randomly divided wild-type C57 mice (n=5 per group). Nine hours after injection, the mice were anesthetized and blood was collected. Exosomes were extracted from the plasma of each group of mice by ultracentrifugation. At the same time, primary neurons were extracted from the hippocampus of the mice. The extracted exosomes and primary neurons were co-cultured. Then, the siRNA content in the cells was measured by qRT-PCR at different time points to explore whether exosomes with the targeting peptide are more likely to enter neuronal cells.

[0124] In the initial stages of constructing the gene loop, it was found that after tail vein injection of the gene loop in mice, expression of the SOD1 siRNA precursor scaffold was detected only in the liver. Mature siRNA was detected in multiple tissues, including the liver and lungs, indicating that the exogenously injected gene loop was expressed in the liver and then secreted into other tissues and organs. Furthermore, a large amount of siRNA was detected in plasma exosomes, further suggesting that the liver-expressed siRNA was encapsulated in exosomes and transported to various tissues and organs via blood circulation. After verifying that the gene loop designed based on synthetic biology elements could be successfully expressed in vitro and effectively knock down the mutant SOD1 protein, the knockdown ability of the designed gene loop was further verified in vivo. PBS, CMV-siRscrR, CMV-siRSOD1, and CMV-RVG-siRSOD1 gene loops were injected into mice via tail vein at a dose of 10 mg / kg, every two days for a total of two weeks. Exosomes were then extracted from the plasma of each group of mice by ultracentrifugation. The exosomes were identified by NTA, electron microscopy, and Western blot experiments. The results showed that the extracted exosomes conformed to the size range of exosomes (~100 nm), possessed the characteristic morphology of exosomes, and expressed exosome marker proteins Alix, TSG101, and CD9 (e.g., ...). Figure 5 Therefore, it is proven that the extracted exosomes have high purity.

[0125] To investigate whether exosomes generated by the gene loop can bind to target cells, exosomes were stained with PKH26 dye in vitro. Staining was then stopped with 1% FBS, followed by extraction of exosomes by ultracentrifugation at 120,000g for 90 min. The stained exosomes were then compared with those successfully infected with Lv-eGFP-SOD1. G93A Co-culture of SHSY-5Y cell lines (e.g.) Figure 6 A) Cells infected with Lv-eGFP-SOD1 G93A This further aligns with the actual situation of abnormal accumulation of mutant SOD1 in neurons under pathological conditions. Results showed that all stained exosomes could fuse with SHSY-5Y cells overexpressing mutant SOD1 (e.g., ...). Figure 6 B).

[0126] After confirming that in vitro stained exosomes can bind to target cells, in order to verify whether the siRNA encapsulated in exosomes can play a biological knockdown role, exosomes were extracted from the plasma of mice injected with each gene loop via tail vein and compared with those of stably transfected eGFP-SOD1. G93ASHSY-5Y cells were co-cultured, and after 48 hours, cell supernatants were collected. Cell proteins and mRNAs were extracted, and the levels of siRNA in exosomes of the cell supernatant and the knockdown of SOD1 in cells were analyzed by qRT-PCR and Western blot. The results showed that only the CMV-siRSOD1 and CMV-RVG-siRSOD1 gene loops showed high levels of siRNA in the cell supernatant after transfection. Similarly, only the CMV-siRSOD1 and CMV-RVG-siRSOD1 gene loops significantly knocked down mutant SOD1 (e.g., at both the mRNA and protein levels). Figure 7 ).

[0127] Example 5

[0128] In vivo delivery tracking of self-assembled exosomal siRNAs:

[0129] (1) Tracing the exosomes generated by self-assembly: PBS, the CMV-siRscrR gene loop expressing nonsense siRNA, the CMV-siRSOD1 gene loop expressing effective SOD1 siRNA sequence but without target peptide, and the CMV-RVG-siRSOD1 gene loop containing the central nervous system target peptide RVG and effective SOD1 siRNA sequence were injected into the tail vein of 4 groups of wild-type C57 mice (5 mice in each group) in randomized groups. The single injection dose was 10 mg / kg, and the total injection volume was ≤200 μL. Nine hours after injection, the mice were anesthetized with 1.5% aphthol and whole blood was collected and placed in EDTA anticoagulant tubes. Three hours after blood collection, whole blood was centrifuged at 500g for 10 min, 3000g for 20 min, 10000g for 60 min, and 120000g for 90 min to separate exosomes. The exosomes in the plasma of each group of mice were stained with the red fluorescent dye PKH26. PKH26 emits red fluorescence upon excitation, with a maximum excitation wavelength of 551 nm and an emission wavelength of 567 nm. After adding 1% fetal bovine serum (FBS) to stop staining, the exosomes were extracted again by ultracentrifugation at 120000g for 90 min.

[0130] Lv-eGFP-SOD1 G93ASuccessfully infected SYSH-5Y cells were cultured on poly-L-lysine-coated 12-well cell slides. When the cells reached a density of approximately 80%, the four groups of plasma exosomes stained in the previous step were added to the cell culture medium at a total amount of 10 μg per well for co-culture. After co-culture for 24 h, the slides were stained with DAPI, washed with PBS, inverted on glass slides, mounted, and the fluorescence was observed under a Leica TCS SP8-MP confocal microscope to detect whether the exosomes produced by each gene loop could bind to the neuroblastoma SHSY-5Y cells with abnormal accumulation of mutant SOD1 simulated in vitro.

[0131] Subsequently, PKH26-stained exosomes from the plasma of four groups of mice were prepared again following the steps described above. These exosomes were then injected via the tail vein into four groups of untreated wild-type C57 mice. Twelve hours later, organs such as the liver, brain, and spinal cord were harvested and their fluorescence was observed under a Leica TCS SP8-MP confocal microscope to detect whether the exosomes produced by the gene loop could reach the target organs.

[0132] (2) Tracing RNA transported by exosomes: Because gene loops constructed based on synthetic biology are diverse and variable, not only can elements expressing siRNA be constructed, but similarly, gene loops expressing Cre mRNA can also be constructed. This facilitates the observation of the transport and distribution of RNA expressed by gene loops in the body of loxP-DsRed-STOP-loxP-eGFP cassette transgenic mice. The designed and constructed Cre mRNA gene loop was injected into loxP-DsRed-STOP-loxP-eGFP cassette transgenic mice via the tail vein. Then, the conversion of red and green fluorescence in the major organs and tissues of the mice was observed to determine the transport and distribution of Cre mRNA transported by exosomes in various tissues and organs.

[0133] (3) Validation of siRNA encapsulated in exosomes: First, siRNA guide strands were artificially synthesized, and standard curves were prepared by qRT-PCR for artificially synthesized siRNA diluted to different concentration gradients to quantify the test samples. The CMV-siRscrR gene loop expressing nonsense siRNA, the CMV-siRSOD1 gene loop expressing effective SOD1 siRNA sequence but without target peptide, and the CMV-RVGsiRSOD1 gene loop containing the central nervous system target peptide RVG and effective SOD1 siRNA sequence were injected intravenously into wild-type C57 mice at a dose of 10 mg / kg. Nine hours later, exosomes were extracted from the liver, brain, and spinal cord of the mice under aphrodisiac anesthesia. The absolute content of siRNA drug (test sample) in each organ at specific time points was determined by qRT-PCR (standard curve quantification).

[0134] (4) In vivo localization analysis of siRNA: The CMV-siRscrR gene loop expressing nonsense siRNA, the CMV-siRSOD1 gene loop expressing effective SOD1 siRNA sequence but without target peptide, and the CMV-RVG-siRSOD1 gene loop containing the central nervous system target peptide RVG and effective SOD1 siRNA sequence were injected intravenously into wild-type C57 mice at a dose of 10 mg / kg. Two weeks after injection, the spinal cord of the mice was collected and localization analysis was performed by in situ hybridization with DIG-labeled LNA probes complementary to siRNA.

[0135] (5) Design of GFP-related siRNA gene loops: GFP-related siRNA sequences were designed and inserted into gene loops. Similar to the SOD1 gene, three sets of gene loops were prepared: a CMV-siRscrR gene loop expressing nonsense siRNA, a CMV-siRGFP gene loop expressing an effective GFP siRNA sequence without a target peptide, and a CMV-RVG-siRGFP gene loop containing the central nervous system target peptide RVG and an effective GFP siRNA sequence. These loops were injected intravenously into GFP mice at a dose of 10 mg / kg. After one week of continuous injection, liver, brain, and spinal cord tissues from the mice were collected for green fluorescence measurement. The green fluorescence intensity of the control group was used as a control to detect whether the experimental gene loops could reduce the green fluorescence intensity in the tissues. If the fluorescence intensity decreased, it proved that the siRNA produced by the gene loops reached the target tissues and achieved knockdown of the target gene GFP.

[0136] For central nervous system diseases, especially neurodegenerative diseases, the blood-brain barrier has always been a significant challenge and obstacle. In this study, a gene loop with an added RVG targeting peptide was designed to investigate whether it could self-assemble onto the surface of exosomes encapsulating siRNA, delivering the exosome-encapsulated siRNA across the blood-brain barrier to target organs (mainly the cerebral cortex and spinal cord). Wild-type B6 mice were randomly divided into four groups, receiving a single intravenous injection of PBS, CMV-siRscrR, CMV-siRSOD1, and CMV-RVG-siRSOD1 gene loops, respectively. Six hours after injection, exosomes were extracted from mouse plasma, and siRNA levels in plasma, cortex, and spinal cord were measured. Results showed that only the CMV-siRSOD1 and CMV-RVG-siRSOD1 gene loop groups showed detectable high levels of siRNA in plasma among mice injected with the three gene loops. Figure 8 A), and only the CMV-RVG-siRSOD1 gene loop can transport siRNA to the cortex and spinal cord. Figure 8B, C). The extracted exosomes were then stained with PKH26 dye (staining was stopped with 1% FBS), and centrifuged again (120,000g, 90 min) to extract the exosomes. The stained exosomes were injected into another batch of mice via the tail vein. After 12 hours, the liver, cerebral cortex, and spinal cord of the mice were collected for fluorescence analysis. The stained plasma exosomes from each group reached the liver of another batch of wild-type mice (e.g., ...). Figure 8 D), but only exosomes injected with the CMV-RVG-siRSOD1 gene loop group could reach the cerebral cortex and spinal cord of another batch of mice (e.g., Figure 8 E, F), which proves that the designed RVG targeting peptide effectively and successfully allows exosomal siRNA to enter the central nervous system.

[0137] To further investigate whether exosome arrival at the central nervous system signifies targeted delivery of siRNA, wild-type B6 mice were randomly divided into four groups and injected via tail vein with PBS, CMV-siRscrR, CMV-siRSOD1, and CMV-RVG-siRSOD1 gene loops, respectively. Nine hours after each injection, spinal cord samples were harvested, and hybridization was performed using a DIG-labeled LNA probe (specifically binding to the positive strand of siRNA-2). The results showed that, at the same injection dose, only the CMV-RVG-siRSOD1 gene loop group showed hybridization of the SOD1 siRNA sequence in its spinal cord, exhibiting DIG fluorescence (e.g., sOD1 siRNA sequence). Figure 9 This indicates that the added RVG targeting peptide can indeed enable the siRNA encapsulated in exosomes to enter the central nervous system, especially the spinal cord, and exert its biological effects.

[0138] Example 6

[0139] In vivo self-assembled exosomal siRNA treats mutant SOD1-driven ALS by inhibiting SOD1:

[0140] (1) Design of the gene loop: The SOD1 siRNA sequence was inserted into the entire pcDNA6.2 backbone, along with the specific sequence of the targeting peptide RVG. Based on the principles of synthetic biology, the synthesized gene loop can cross the blood-brain barrier and enter the central nervous system.

[0141] (2) In vivo detection of the therapeutic effect of gene loop on B6.Cg-Tg(SOD1G93A)1Gur / J mice: First, according to the JAX website, Tg(SOD1G93A) mice were bred, with one male Tg(SOD1G93A) mouse and two wild-type B6 mice housed together. At 3 weeks of age, the newborn mice were separated by sex, their toes were clipped for numbering, and their tails were identified. The primer sequences and procedures used for tail identification were all from the JAX website (strain number 004435).

[0142] Experiments showed no significant difference in therapeutic efficacy or toxicology between PBS and the nonsense siRNA-expressing CMV-siRscrR gene loop in mice. Therefore, 10-week-old mice successfully expressing the siRNA were randomly divided into three groups: the CMV-siRscrR gene loop expressing nonsense siRNA, the CMV-siRSOD1 gene loop expressing an effective SOD1 siRNA sequence without a target peptide, and the CMV-RVG-siRSOD1 gene loop containing the central nervous system target peptide RVG and an effective SOD1 siRNA sequence. Mice were injected intravenously with Tg (SOD1) at a dose of 10 mg / kg. G93A Mice were injected twice a week for ten weeks. During these ten weeks, grip strength, body weight, and rotadore fatigue tests were performed on the three groups of mice. The disease progression in the mice was shown through the measurement of behavioral data and the recording of body weight curves.

[0143] In the later stages of the disease, three groups of mice were euthanized by cervical dislocation at 20 weeks of age. Brain, spinal cord, gastrocnemius muscle, and liver were harvested for immunofluorescence, immunohistochemistry, western blot, and qRT-PCR to detect SOD1 knockdown in various tissues, particularly the SOD1 siRNA content and SOD1 gene expression changes in the Mop-primary motor and Mos-secondary motor cortex and the spinal cord. Inflammation in the central nervous system and the number of motor neurons in the ventral horn of the lumbar spinal cord were also analyzed. Lamanin staining of the gastrocnemius muscle was used to calculate the average area of ​​gastrocnemius muscle fibers in each group to assess the degree of muscle atrophy. Because SOD1 mice exhibit paralysis, extensive skeletal muscle atrophy, and rapid weight loss in the later stages of the disease, spontaneous activity was recorded by video before anesthesia and euthanasia, and the hind limbs were photographed after anesthesia to assess the degree of muscle atrophy. Subsequently, another batch of mice successfully identified by tail vein analysis were injected intravenously with the same three gene circuits (grouping types were the same as the three groups in the grip strength test mentioned above), with the same injection dosage, frequency, and duration as the previous experiment. The survival curves of the mice were then statistically analyzed. Since the 50% survival period for Tg(SOD1G93A) mice in the C57BL / 6J genetic background is 157.1 + / - 9.3 days, within this range, mice nearing death (completely paralyzed, completely losing motor and feeding abilities) were euthanized, and tissue samples were collected for subsequent immunomolecular experiments to verify disease progression. The day of death was designated as the mouse's death date.

[0144] Before evaluating and validating the therapeutic effect on gene circuitry using mouse models, tail identification, weight measurement, survival curve development, and statistical analysis of rotarod fatigue testing were performed on the mice to determine their exact genotype and disease progression. Results showed that, compared to wild-type mice, B6.Cg-Tg(SOD1) exhibited better therapeutic effects. G93A The number of human SOD1 copies in the genome of 1Gur / J transgenic mice was significantly increased. Figure 10 A), weight will decrease significantly around 116 days. Figure 10 B) may be due to muscle atrophy in the later stages of the disease, resulting in excessively low muscle mass in the mice. On the survival curve, B6.Cg-Tg(SOD1) G93A The median survival of 1Gur / J mice was 138 days. Figure 10 C) Their survival time was far shorter than that of wild-type mice. Furthermore, in the rotarod fatigue test, the transgenic mice showed a gradual decline in rotarod performance as their condition worsened, until they were unable to stand. Figure 10 D).

[0145] Under the premise of ensuring the correct copy number of mouse genotype and the correct disease model, transgenic mice were subjected to gene loop therapy. Tg(SOD1) was added to the transgenic mice. G93A Mice were randomly divided into three groups and injected via tail vein into the gene loops of CMV-siRscrR, CMV-siRSOD1, and CMV-RVG-siRSOD1, respectively. The injection dose was 10 mg / kg, and the injection period was between 10 and 20 weeks, with injections twice a week. The treatment cycle diagram is shown below. Figure 11 A. During and after the treatment period, mice underwent body weight measurement, limb grip strength testing, and Rotarod rotundus behavioral testing to record the disease progression, survival status, and efficacy evaluation of each treatment group. Results showed that the CMV-RVG-siRSOD1 gene loop significantly improved body weight loss in mice during disease development. Figure 11 B), which rescued the mice from the decline in grip strength in their limbs. Figure 11 C), and it can significantly increase the time mice spend exercising on the rotundus fatigue tester. Figure 11 D). More importantly, the CMV-RVG-siRSOD1 gene loop significantly improved the survival time of transgenic mice, extending it to 183 days compared to the median survival of the two control groups (CMV-siRscrR and CMV-siRSOD1) (146 and 148 days, respectively). Figure 11 E).

[0146] The designed gene loop was found to significantly improve Tg(SOD1) G93A Following the disease progression in mice, the molecular mechanism of its ameliorative effect on the condition was preliminarily verified. Following the aforementioned grouping and gene loop injection cycle, a series of in vivo treatment experiments were conducted. Ten weeks after injection, spinal cord, cerebral cortex, and gastrocnemius muscle samples were uniformly collected from the three groups of mice for molecular verification. The experiments revealed that, after 10 weeks of treatment, compared to the other two groups of mice, the CMV-RVG-siRSOD1 group had significantly higher levels of SOD1 mRNA in the spinal cord. Figure 12 A) and protein levels ( Figure 12 B) Significantly reduced, with a remarkable knockdown effect on the SOD1 mutant protein.

[0147] Subsequently, frozen sections of the mouse cerebral cortex and L3-L5 lumbar vertebrae were subjected to SOD1 immunofluorescence staining. The results showed that after 10 weeks of treatment, compared with the other two groups of mice, the CMV-RVG-siRSOD1 group mice had higher levels of SOD1 in the cerebral cortex. Figure 13 A) and spinal cord ( Figure 13 B) showed a significant decrease in SOD1 protein levels.

[0148] Motor neuron degeneration is often accompanied by a strong neuroinflammatory response, including the activation of active astrocytes and microglia. SOD1 mutant mice are often accompanied by immune cell infiltration in the central nervous system. Therefore, this study further verified the degree to which the designed gene circuit improved neuroinflammation. The results showed that in the mouse cortex and spinal cord (L3-L5 lumbar vertebrae), the fluorescence signal of both the astrocyte marker-GFAP and the microglia marker-CD68 (especially the latter) was significantly lower in the CMV-RVG-siRSOD1 group than in the other two groups. Figure 14 This study demonstrated that administration of CMV-RVG-siRSOD1 significantly alleviated the infiltration of inflammatory cells in the central nervous system of mice.

[0149] The most direct pathological feature of ALS in the traditional sense is the death of motor neurons in the spinal cord. Therefore, this study also verified whether the designed gene circuit could delay the death of motor neurons in the spinal cord of model mice. Currently, the most widely accepted marker for motor neurons is choline acetyltransferase (ChAT). Therefore, ChAT was used to perform immunofluorescence staining on the spinal cord of SOD1 mutant mice. The results showed that the overall number of neurons in the ventral horn of the gray matter of the spinal cord of mice in the CMV-RVG-siRSOD1 group did not change significantly (NeuN), but the number of motor neurons was significantly increased (ChAT). Figure 15 ).

[0150] In addition to experimental investigations into the pathogenesis, this study also verified relevant indicators of muscle symptoms in ALS. ALS patients eventually experience almost complete atrophy of skeletal muscles, and death is generally caused by diaphragmatic atrophy leading to respiratory failure. Therefore, the degree of muscle atrophy in mice also preliminarily verified the pathological severity and the efficacy of gene circuit therapy. The results showed that, in terms of macroscopic phenotype, compared to the other two groups of mice with severe hind limb muscle atrophy, the CMV-RVG-siRSOD1 group showed a significantly reduced degree of hind limb muscle atrophy. Figure 16 A), the average area of ​​gastrocnemius muscle fibers was significantly increased ( Figure 16 B).

[0151] Example 7

[0152] ALS treatment based on a multi-target knockout system using an in vivo self-assembled exosome siRNA delivery system:

[0153] Based on the design principle of an in vivo self-assembled exosome siRNA delivery system, the gene loop can freely assemble multiple effective siRNA sequences. Utilizing the liver as a biofactory, it can effectively express one or more siRNAs and automatically assemble them into exosomes for secretion into the bloodstream, achieving multi-target combined knockout therapy for ALS. The methods are divided into two types:

[0154] (1) Different siRNA sequences were designed targeting different coding sequences (CDS) of a single SOD1 mutant gene mRNA, and these siRNAs were tandemly embedded into the backbone of the siRNA expression element to achieve joint knockdown of multiple siRNAs of the same gene. Tg(SOD1) G93A Mice were randomly divided into four groups, and the following gene loops were used: CMV-siRscrR (expressing nonsense siRNA), CMV-siRSOD1 (expressing a single effective SOD1 siRNA sequence without a target peptide), CMV-RVG-siRSOD1 (expressing a single effective SOD1 siRNA sequence with a target peptide), and CMV-RVG-siRSOD1-mix (containing the central nervous system target peptide RVG and three effective SOD1 siRNA sequences). Mice were injected intravenously via the tail vein at a dose of 10 mg / kg, twice a week for ten weeks. During treatment, the mice's motor abilities and pathological progression were evaluated through weight monitoring and Rotarod fatigue tests. Furthermore, at the later stage of disease progression (15 weeks), the expression levels of siRNA in various tissues were labeled using immunofluorescence and Western blot analysis. Blot analysis was performed to detect the SOD1 content in the motor cortex and spinal cord of mice, and a series of indicators (including the degree of neuroinflammation in the spinal cord and the number of motor neurons in the anterior horn of the gray matter of the lumbar spinal cord) were detected to evaluate the degree of skeletal muscle atrophy in mice and assess the survival status of mice after treatment.

[0155] (2) Multi-gene, multi-target joint knockout: Since abnormal accumulation of UGCG and P62 also occurs in the SOD1 model and is related to disease development, a cell model with abnormal accumulation of UGCG and P62 mutations was constructed. HEK293T cells were transfected with an overexpression plasmid, and then five different siRNA sequences were designed based on the CDS region near the mutation site. After co-transfection of siRNA and overexpression plasmid, Western blot and qRT-PCR experiments were used to screen for the siRNA with the best knockdown effect on specific genes. Then, similar to SOD1 siRNA, the siRNAs of SOD1, UGCG, and P62 were tandemly embedded into the gene loop using the miR-155 backbone as a stem-loop structure. Tg(SOD1 G93AMice were randomly divided into five groups, and each group was injected intravenously with a dose of 10 mg / kg via the tail vein. The following gene loops were used: the RVG-CMV-siRSOD1 loop expressing nonsense siRNA; the CMV-RVG-siRSOD1 loop expressing a single effective SOD1 siRNA sequence with a targeting peptide; the CMV-RVG-siRP62 loop expressing a single effective P62 siRNA sequence with a targeting peptide; the CMV-RVG-siRU loop expressing a single effective UGCG siRNA sequence with a targeting peptide; and the CMV-RVG-siRmix loop containing the central nervous system targeting peptides RVG, SOD1, UGCG, and P62. All indicators were measured as described above. Various physiological and biochemical detection techniques were used to quantify the disease progression in mice, thereby evaluating the efficacy of multi-target combined therapy.

[0156] The feasibility and knockdown efficiency of co-expressing multiple siRNAs in the gene loop were further investigated. The two siRNA sequences (siRNA-1 and siRNA-2) with the best knockdown effect on the SOD1 gene were screened and tandemly inserted into the gene loop. After transfecting this gene loop into HEK293T cells, the expression levels of siRNA-1 and siRNA-2 were detected by qRT-PCR and compared with the expression level of single siRNA. It can be seen that there is no difference in the efficiency of co-expressing elements to produce multiple siRNAs.

[0157] Example 8

[0158] Safety assessment and spinal cord-specific toxicology assessment based on in vivo self-assembled exosome siRNA delivery system:

[0159] Wild-type C57BL / 6J mice were randomly divided into four groups and injected via tail vein with PBS, the following gene loops: CMV-siRscrR gene loop expressing nonsense siRNA, CMV-siRSOD1 gene loop expressing effective SOD1 siRNA sequence but without target peptide, and CMV-RVG-siRSOD1 gene loop containing the central nervous system target peptide RVG and effective SOD1 siRNA sequence. After completing a full treatment cycle according to the above-designed treatment regimen (twice a week for a total of ten weeks), the toxicity and immunogenicity of the small nucleic acid drug were tested. Mice in each group were anesthetized by intraperitoneal injection of 1.5% afodin and whole blood was collected using anticoagulant tubes for routine blood analysis. The following indicators were statistically analyzed: white blood cell count, lymphocyte count, monocyte count, lymphocyte percentage, monocyte percentage, neutrophil percentage, red blood cell count, hemoglobin, hematocrit, mean corpuscular volume, mean corpuscular hemoglobin content, mean corpuscular hemoglobin concentration, coefficient of variation of red blood cell distribution width, platelet count, mean platelet volume, platelet distribution width, and plateletcrit.

[0160] Paraffin sections and H&E staining were performed on major organs of mice, including liver, spleen, and kidneys, to observe for pathological structural lesions in the tissues and cells. The treatment group was compared with the control group of normal mice to evaluate whether the SOD1 siRNA gene loop caused organ damage and systemic immune response.

[0161] Mice treated with each gene circuit were graded according to the ASIA (Spinal Cord Injury Assessment System) for spinal cord injury: Grade A-E (Spinal Cord Injury Rating Standard) to determine whether the gene circuits had toxic side effects on the mouse spinal cord. The animals' general condition, toxic symptoms, and time to death were closely observed and recorded before and after administration. Specific observation indicators are as follows:

[0162] 1. General indicators: These include the animal's weight, food intake, and water intake. Weight changes were recorded before drug administration, during the observation period, and at the end of the experiment. The animal's appearance, behavior, responses to stimuli, secretions, and excretions were also observed.

[0163] 2. Toxicity indicators: After administration, observe the time of onset and recovery of toxic reactions in animals, their severity, and the time of death (e.g., when an animal dies).

[0164] 3. Pathological examination: All laboratory animals should undergo gross dissection to observe for changes in the volume, color, and texture of tissues and organs. Pathological examination should be performed on any questionable tissues or organs or those showing confirmed pathological changes, and relevant experimental records should be kept.

[0165] To verify the safety of gene loops (exosomal siRNA delivery systems) designed based on synthetic biology elements, B6 wild-type mice were randomly divided into four groups and injected via tail vein with PBS, gene loops CMV-siRscrR, CMV-siRSOD1, and CMV-RVG-siRSOD1, respectively, at a dose of 10 mg / kg. The injections were administered twice weekly for 10-20 weeks. After all injections were completed, whole blood samples were collected for complete blood count analysis. Results showed that mice injected with the gene loops had lower platelet counts (PLTs). Figure 17 A) Red blood cell count (RBC) Figure 17 B) and white blood cell count (WBC) Figure 17 C) There were no significant differences in the indicators compared to the control group mice. Hematologic and epithelial studies (H&E) of liver, spleen, kidney, and other tissue sections from each group of mice showed that this treatment method did not cause pathological structural changes in the major organs. Figure 17 D). Experiments show that this treatment method is expected to be relatively safe.

[0166] Example 9

[0167] AAV was used as a vector to further verify the stability and reliability of the gene loop:

[0168] SOD1 mutant mice were randomly divided into three groups. At 4-5 weeks of age, mice were injected with AAV. Group 1 received a single tail vein injection of PBS. Group 2 received an intrathecal injection of adeno-associated virus (AAV9) containing a CMV promoter and miR-155 as a backbone for siRSOD1 expression. Group 3 received a 100 μl tail vein injection of adeno-associated virus (AAV8) containing a CMV promoter, RVG targeting peptide, and miR-155 as a backbone for siRSOD1 expression. AAV, as a vector, can stably and long-term express the mutant gene in model animals. By utilizing AAV to encapsulate the gene loop, long-term and efficient expression of the mutant gene siRNA can be achieved with a single injection.

[0169] Example 10

[0170] Further validation of the system's universality and optimization of treatment regimens were conducted using TDP43-mutant ALS mice:

[0171] (1) Similar to the SOD1 model described above, a cell model with abnormal accumulation of mutant TDP43 was constructed in vitro, and TDP43 fusion-expressed cells were used. A315THEK29T cell lines were infected with eGFP lentiviruses. Different siRNA sequences were designed targeting the mutation sites. Finally, the siRNA with the best knockdown effect was screened by western blot and qRT-PCR experiments.

[0172] (2) Design of gene loop: The most effective TDP43 siRNA sequence and RVG specific sequence were selected and tandemly inserted into the entire pcDNA6.2 backbone to construct a complex gene loop that can cross the blood-brain barrier, enter the central nervous system, and express siRNA to knock down TDP43.

[0173] (3) In vivo detection of gene loop on Tg(TDP43) A315T The therapeutic effect of 95Balo / J: First, according to the JAX official website, it has a therapeutic effect on Tg (TDP43). A315T )95Balo / J mice were bred: one Tg(TDP43) mouse was used for breeding. A315T 95Balo / J male mice were housed with two B6 wild-type female mice. At 3 weeks of age, the newborn mice were separated by sex, their toes were clipped, and they were numbered for tail identification. The primer sequences and procedures used for tail identification were obtained from the JAX website (strain number 010700).

[0174] Subsequently, the 4-week-old Tg(TDP43) that successfully expressed the rat tail identification was then used. A315T Mice were randomly divided into three groups and injected intravenously via the tail vein at a dose of 10 mg / kg into three gene loops: the CMV-siRscrR loop expressing nonsense siRNA, the CMV-siRTDP43 loop expressing the most effective siRNA sequence for TDP43 without a target peptide, and the CMV-RVG-siRTDP43 loop containing both RVG and the most effective siRNA sequence for TDP43. Injections were administered three times every two weeks for a total of seven weeks. During these seven weeks, grip strength, body weight, and rotarod fatigue tests were performed on the three groups of mice. The behavioral data and body weight recordings were used to visualize the disease progression in the mice.

[0175] In the later stages of disease progression, at approximately 15 weeks of age, mice from the three groups were euthanized by cervical dislocation. Brain, spinal cord, gastrocnemius muscle, and liver were harvested for immunofluorescence, immunohistochemistry, western blot, and qRT-PCR to detect the knockdown of TDP43 inclusion bodies in each tissue, particularly the content of TDP43 siRNA and changes in TDP43 gene expression in the Mop (primary motor region) and Mos (secondary motor region) of the central nervous system cortex and the spinal cord. Inflammation in the central nervous system and the number of motor neurons in the ventral horn of the lumbar spinal cord were also analyzed. Lamanin staining of the gastrocnemius muscle was used to determine the average area of ​​gastrocnemius muscle fibers in each group, assessing the degree of muscle atrophy. Unlike SOD1 mice, TDP43 mice have a median survival of about 15 weeks, which is shorter than that of SOD1 mice. Therefore, the TDP43 mouse model is an acute disease model, and symptoms such as paralysis, extensive skeletal muscle atrophy, and rapid weight loss will appear in a short period of time. Therefore, before the mice were anesthetized and sacrificed, their spontaneous activities were recorded by video. After sacrifice, the degree of hind limb muscle atrophy was assessed, and parallel experimental groups were set up to statistically analyze the survival curves.

[0176] (4) Further validation analysis of the TDP43 protein siRNA assembly system was performed using the AAV vector. As a vector, AAV can be stably and expressed for a long time in model animals.

[0177] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions or improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An RNA delivery system for treating amyotrophic lateral sclerosis (ALS), characterized in that, The system includes a delivery vector and an RNA fragment on the delivery vector that can treat amyotrophic lateral sclerosis (ALS). The delivery vector can accumulate in the host's organs and tissues and spontaneously form a complex structure containing the RNA fragment that can treat ALS in the host organs and tissues. The complex structure can deliver the RNA fragment into the target tissue to achieve the treatment of ALS. The RNA fragment sequence capable of treating amyotrophic lateral sclerosis is the siRNA of the SOD1 gene, and the siRNA is the sequence shown in SEQ ID No. 1; The delivery vector is a plasmid vector or a viral vector; The delivery vector includes the following circuitry: 5'-promoter-target tag-5' flanking sequence-RNA fragment-loop sequence-compensation sequence-3' flanking sequence; The promoter is a CMV promoter; The targeting tag is an RVG targeting peptide; The 5' flanking sequence is ggatcctggaggcttgctgaaggctgtatgctgaattc; The loop sequence is gttttggccactgactgac; The 3' flanking sequence is accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag. The compensation sequence is the reverse complementary sequence of the RNA fragment, with any 1-5 bases deleted.

2. The RNA delivery system for treating amyotrophic lateral sclerosis as described in claim 1, characterized in that, The organ tissue is the liver, and the composite structure is an exosome.

3. The use of the RNA delivery system for treating amyotrophic lateral sclerosis (ALS) as described in claim 1 or 2 in the preparation of a medicament for treating ALS, characterized in that, The drug can be administered orally, by inhalation, subcutaneously, intramuscularly, or intravenously.

Images