Application of CD244 in gene editing target for anti-african swine fever

Abstract

The application discloses application of CD244 in a gene editing target point against African swine fever. The application provides application of a substance capable of inhibiting CD244 expression in preparation of a product for treating and / or preventing African swine fever virus infection. Inhibition of expression of the CD244 gene in porcine primary alveolar macrophage (PAM) can significantly interfere with ASFV replication, and overexpression of CD244 can significantly promote ASFV replication in an iPAM cell line. The application provides new materials for research and development of anti-ASFV infection drugs and pig disease-resistant breeding.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to application of CD244 in gene editing target point against African swine fever. BACKGROUND

[0002] Disease resistance breeding has always been the focus and hotspot in the field of animal genetics and breeding, and its ultimate goal is to produce new disease-resistant lines or varieties for effective disease prevention and control. African swine fever virus (ASFV) is a highly infectious virus that poses a serious threat to the global pig industry. So far, there is no effective vaccine and treatment method, and disease resistance breeding is one of the feasible ways to control the spread of the virus. At present, strengthening the research on the molecular mechanism of viral infection and identifying candidate host resistance functional sites based on multi-omics data can provide targets for disease resistance breeding, which is the key to breaking the bottleneck of African swine fever resistance breeding. Although scientists around the world have made significant breakthroughs in African swine fever vaccine research, we still do not have a reliable vaccine that can be industrialized. This has forced researchers to think in another direction, how to resist the invasion of African swine fever virus. In 1998, a serological survey of rural pigs in the Angonia district of Tete Province, Mozambique, near the Malawi border, found that nearly 40% of the 54 healthy pigs sampled had ASFV antibodies. Subsequent challenge experiments also confirmed the existence of naturally resistant pig breeds, but unfortunately researchers did not find that this resistance is heritable, which indicates that African swine fever virus has a complex pathogenesis. Myoma virus resistance (Mx) gene is an interferon-regulated gene that can inhibit the replication of multiple viruses. Studies have shown that MxA can also inhibit ASFV replication in host cells, and this inhibitory effect is related to the recruitment of MxA protein to the virus assembly point around the nucleus. Further studies have found that ASFV entry into cells seems to directly stimulate the absorption of host glucan, the polarization of actin, and the activation of EGFR, PI3K-Akt, Pak1, and Rac1, and inhibiting these key regulatory genes or treating with drug EIPA (a TRPP3 channel inhibitor) can significantly reduce ASFV invasion and viral replication. Researchers have also found that the host metabolic pathway of ARG1-polyamine is important for viral replication, suggesting that ASFV may promote its own replication by regulating small molecule levels in host cells. Although researchers have identified some key genes involved in the ASFV infection process, they have not yet identified the key resistance genes and receptor genes. African swine fever has spread widely in China, and although effective prevention and control policies have been implemented in various regions, the ASF virus already exists in the natural environment of China, and there is currently no effective vaccine for prevention and control. In light of the current situation of China's animal husbandry, disease purification is the most fundamental strategy for disease prevention and control, and disease resistance breeding as one of the most effective means of disease purification will become an important strategy for the prevention and control of African swine fever in the future. Conducting research on African swine fever virus resistance genes will lay an important foundation for the breeding of African swine fever-resistant pigs and provide a new approach to the prevention and control of African swine fever. SUMMARY

[0003] The purpose of the present application is to provide the application of CD244 as a gene editing target for anti-African swine fever.

[0004] In a first aspect, the present application claims the use of a substance capable of inhibiting CD244 expression in any one of:

[0005] (A1) preparing a product for treating and / or preventing African swine fever virus (ASFV) infection;

[0006] (A2) treating and / or preventing African swine fever virus (ASFV) infection.

[0007] In a second aspect, the present application claims the use of a substance capable of inhibiting CD244 expression in any one of:

[0008] (B1) preparing a product for inhibiting African swine fever virus (ASFV) replication in a host cell;

[0009] (B2) inhibiting African swine fever virus (ASFV) replication in a host cell;

[0010] (B3) preparing a cell model or an animal model with enhanced resistance to African swine fever virus (ASFV).

[0011] In the first aspect and the second aspect, the product can be an anti-ASFV drug or vaccine.

[0012] In the first aspect and the second aspect, the substance capable of inhibiting CD244 expression can be a CD244 expression knockout substance or a CD244 expression knockdown substance or a CD244 inhibitor directly targeting CD244.

[0013] Further, the substance capable of inhibiting CD244 expression can be a CD244 siRNA.

[0014] In the specific embodiments of the present application, the nucleotide sequence of the CD244 siRNA is shown in SEQ ID No. 1.

[0015] In a third aspect, the present application claims the use of a substance capable of promoting CD244 expression in any one of:

[0016] (C1) preparing a product for increasing the susceptibility of a host cell to African swine fever virus (ASFV);

[0017] (C2) increasing the susceptibility of a host cell to African swine fever virus (ASFV);

[0018] (C3) preparing a cell model or an animal model susceptible to African swine fever virus (ASFV);

[0019] (C4) preparing a product for promoting African swine fever virus (ASFV) replication in a host cell;

[0020] (C5) promoting replication of African swine fever virus (ASFV) in the host cell;

[0021] (C6) preparing a cell model or animal model with reduced resistance to African swine fever virus (ASFV).

[0022] The substance capable of promoting expression of CD244 can be a nucleic acid molecule capable of encoding CD244, or an expression cassette or a recombinant vector containing the nucleic acid molecule, or a CD244 promoter.

[0023] In the detailed description of the present application, the substance capable of promoting expression of CD244 is a recombinant lentivirus capable of expressing CD244.

[0024] In the fourth aspect, the present application claims any of the following methods:

[0025] Method I: a method for preparing a cell model or animal model with increased resistance to African swine fever virus (ASFV), comprising the following steps: reducing expression of CD244 in a host cell or animal to obtain a recombinant cell or animal; the recombinant cell or animal has increased resistance to African swine fever virus (ASFV) compared with the host cell or animal.

[0026] Method II: a method for preparing a cell model or animal model with reduced resistance to African swine fever virus (ASFV), comprising the following steps: increasing expression of CD244 in a host cell or animal to obtain a recombinant cell or animal; the recombinant cell or animal has reduced resistance to African swine fever virus (ASFV) compared with the host cell or animal.

[0027] Method III: a method for preparing a cell model or animal model susceptible to African swine fever virus (ASFV), comprising the following steps: increasing expression of CD244 in a host cell or animal to obtain a recombinant cell or animal; the recombinant cell or animal is more susceptible to African swine fever virus (ASFV) compared with the host cell or animal.

[0028] In the method I, the reduction of expression of CD244 in the host cell or animal can be achieved by any technical means, such as by introducing CD244 siRNA into the host cell or animal. In the detailed description of the present application, the nucleotide sequence of the CD244 siRNA is shown in SEQ ID No. 1.

[0029] In the method II and the method III, the expression of CD244 in the host cell or animal can be achieved by any technical means. In the specific embodiments of the present application, it is achieved by infecting the host cell or animal with a recombinant lentivirus capable of expressing CD244. Further, the three-plasmid system used for packaging the recombinant lentivirus includes the pLVX-2A-mCHerry-puro recombinant vector carrying the CD244-encoding gene, PMD2.G and PSPAX, and the packaging cell is 293T cell.

[0030] In the fifth aspect, the present application claims any of the following applications:

[0031] (D1) Application of CD244 as a target in regulating the susceptibility of a host cell or animal to African swine fever virus (ASFV);

[0032] (D2) Application of CD244 as a target in regulating the replication ability of African swine fever virus (ASFV) in a host cell or animal;

[0033] (D3) Application of CD244 as a target in preparing a product for regulating the susceptibility of a host cell or animal to African swine fever virus (ASFV);

[0034] (D4) Application of CD244 as a target in preparing a product for regulating the replication ability of African swine fever virus (ASFV) in a host cell or animal.

[0035] In the sixth aspect, the present application claims a cell model prepared by the method described in the fifth aspect.

[0036] In the seventh aspect, the present application claims the application of a cell model prepared by the method II or the method III described in the fifth aspect in screening anti-African swine fever virus drugs.

[0037] In the above aspects, the host cell can be any cell that can be infected by African swine fever virus (ASFV). In the specific embodiments of the present application, the host cell is specifically porcine primary alveolar macrophage.

[0038] In the above aspects, the animal can be any animal that can be infected by African swine fever virus (ASFV), such as a pig.

[0039] In the above aspects, the CD244 is the protein shown in SEQ ID No. 2.

[0040] Compared with the prior art, the present application has the following advantages:

[0041] (1) The present application comprehensively uses multiple methods to evaluate the influence of targeted control of CD244 gene on the replication of ASFV in host cells, and the main technical means used are: using relative quantification and absolute quantification to detect the copy number of P72 gene and the expression of P30 core gene of ASFV after inhibition of CD244 gene; using immunofluorescence technology to detect the influence of overexpression of CD244 gene on the expression of P30 gene of ASFV. The influence of CD244 gene on the replication of ASFV in primary alveolar macrophages and iPAM cell lines is verified from multiple aspects by using multiple different experimental techniques, which improves the accuracy of the results.

[0042] (2) African swine fever is a severe infectious disease caused by ASFV. ASFV infection usually causes acute hemorrhagic disease, and the mortality rate of infected domestic pigs is close to 100%, which has caused great losses to China's pig industry. At present, although the African swine fever epidemic in China has been controlled, the ASFV has widely existed in the natural environment and will continue to threaten China's pig breeding industry. However, due to the unclear ASFV infection mechanism, there is currently no effective treatment drug, mainly due to the lack of effective molecular targets. The present application finds that by using RNA interference technology to inhibit the expression of CD244 gene, the replication of ASFV can be significantly inhibited, and by using lentiviral transduction technology to construct CD244 overexpression cell lines, the infection ability of ASFV is significantly improved, which provides high-quality research materials for subsequent research of ASFV. The present application provides a new target for anti-ASFV drug development, gene editing cell and animal model preparation.

[0043] (3) The present application also provides a method for efficiently constructing CD244 gene overexpression cell model, preferably lentiviral transduction technology, which can be used for efficient preparation of CD244 gene overexpression cell lines. The method of the present application also provides technical reference and vector material for constructing CD244 gene editing animal model.

[0044] The present application inhibits the expression of CD244 gene in porcine primary alveolar macrophages by RNA interference technology, constructs CD244 gene overexpression cell lines in iPAM cell lines by gene editing technology, and combines a series of molecular and virology experiments to prove that inhibition of CD244 gene expression in porcine primary alveolar macrophages (PAM) can significantly interfere with the replication of ASFV, and overexpression of CD244 can significantly promote the replication of ASFV in iPAM cell lines. Through literature research, it is found that there is currently no research report on CD244 participating in mediating the replication of ASFV. Therefore, the present application provides new materials for anti-ASFV infection drug research and development and pig breeding research. BRIEF DESCRIPTION OF DRAWINGS

[0045] Figure 1To inhibit the expression of CD244 gene in primary alveolar macrophages by using small RNA interference technology. The ordinate is the relative expression of the target gene in the random interference group and the target interference group. "**" indicates significant difference (P <0.01).

[0046] Figure 2 To detect the relative expression of viral gene P30 in CD244 gene expression inhibition group (si-CD244) and control group (si-NC) by using fluorescence quantitative PCR technology. The virus infection multiplicity is 1, and the infection time is 24 hours. "**" indicates significant difference (P <0.01).

[0047] Figure 3 To detect the copy number of viral gene P72 in the culture supernatant of CD244 gene expression inhibition group (si-CD244) and control group (si-NC) by using absolute quantitative technology. The virus infection multiplicity is 1, and the infection time is 24 hours. "**" indicates significant difference (P <0.01).

[0048] Figure 4 To evaluate the relative expression of CD244 gene in CD244 overexpression monoclonal cell line (CD244-OE) and wild type iPAM cell (WT) by using fluorescence quantitative PCR experiment. "**" indicates significant difference (P <0.01).

[0049] Figure 5 To detect the expression of CD244 protein, β-tubulin microtubulin protein and viral P72 protein in CD244 overexpression cell line (CD244-OE) and wild type iPAM cell (WT) by using Western Blot technology. The virus infection multiplicity is 10, and the infection time is 24 hours.

[0050] Figure 6 To detect the expression of viral protein P30 in CD244 overexpression cell line (CD244-OE) and wild type iPAM cell (WT) by using immunofluorescence technology. The virus infection multiplicity is 10 and 50, and the infection time is 24 hours. DETAILED DESCRIPTION

[0051] The application will be further described in detail below in conjunction with the specific embodiments. The examples given are only to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the application.

[0052] The experimental methods in the following examples are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the field or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0053] The amino acid sequence of CD244 involved in the following examples is shown in SEQ ID No. 2, and the cDNA sequence thereof is shown in SEQ ID No. 3.

[0054] Example 1, Inhibition of CD244 gene expression in porcine primary alveolar macrophages using RNA interference technology

[0055] First, the exon sequence of porcine CD244 gene and the whole genome sequence of porcine (version number: Sus_scrofa.Sscrofa11.1) were downloaded from ensemble database (www.ensembl.org), respectively, and then small interfering RNA targeting porcine CD244 gene was designed (Table 1).

[0056] Table 1, Nucleotide sequence of small interfering RNA

[0057] Gene name Gene ID Small interfering RNA sequence (siRNA) CD244 ENSSSCG00000006374 5'-ACAGCCATTAGAAGAGCAA-3' (SEQ ID No. 1)

[0058] The day before, porcine primary alveolar macrophages (obtained by conventional method from the lung tissue of healthy pigs ex vivo) were inoculated into 12-well culture plates and cultured for 12-24 hours. Further, the synthesized siRNA dry powder was diluted to 20 μM with RNase-free water, 5 mol was added to 500 μl of 500 μl JetPrime Buffer (Jet-101000046) diluent and vortexed, then 40 μl JetPrime (Jet-101000046) was added, vortexed for 10 s, and then incubated at room temperature for 10 min. Wait for the JetPrime liposome to wrap the siRNA to form a liposome complex. The experiment also set up a control group of transfected random siRNA sequence (5'-TACGTTCAGCGACTGCATCG-3').

[0059] Further, the liposome complex was added to the cultured porcine primary alveolar macrophages and cultured for 24 hours, and then the cells were collected and the total RNA of the culture was extracted using Trizol (Invitrogen 15596026), and then the cDNA library was obtained by reverse transcription using the High-Capacity cDNA Reverse Transcription kit (Thermo Fisher 4374967).

[0060] The cDNA sequence of pig CD244 was downloaded from the ensemble database, and the PCR primers for detecting the cDNA sequence of CD244 gene were designed. The quantitative primers of CD244 are shown in Table 2.

[0061] Table 2, fluorescence quantitative PCR primers

[0062] Gene name Upstream primer (5'-3') Downstream primer (5'-3') CD244 TCCTGAAGAAGGGACCACCA ATGCTCTCTGTCCAACCTCTTG GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA

[0063] The expression of the target gene was detected by fluorescence quantitative PCR using the cDNA library as the template and GAPDH as the internal reference gene. The specific quantitative PCR reaction system and conditions are as follows:

[0064] PCR reaction system: THUNDERBIRD SYBR qPCR Mix (2x) 25.0 μl; upstream primer (10 μm) 1.0 μl; downstream primer (10 μm) 1.0 μl; template 200 ng; H2O supplemented to 50.0 μl.

[0065] PCR reaction conditions: 98℃ for 30 sec; 98℃ for 10 sec, 56℃ for 5 sec, 72℃ for 10 sec, 40 cycles; 72℃ for 2 min; 15℃ for 2 min.

[0066] Finally, the data was collected and the gene expression inhibition effect was evaluated. The quantitative detection results showed that after small RNA interference, the expression of target gene CD244 was extremely significantly reduced ( Figure 1 ).

[0067] Example 2, relative quantitative and absolute quantitative experiments found that inhibition of CD244 gene can significantly inhibit the replication ability of ASFV in host cells

[0068] In order to detect whether the inhibition of CD244 gene can inhibit the replication of ASFV in pig primary alveolar macrophages, the expression of ASFV core gene P30 in cells was detected by relative quantitative detection, and the replication of ASFV was detected by absolute quantitative detection. The specific experimental process is as follows:

[0069] First, inoculate the cells transfected with CD244 siRNA (see Example 1), and set up pig primary alveolar macrophages transfected with random siRNA sequence (5'-TACGTTCAGCGACTGCATCG-3') as control group (si-NC group) in the biosafety level three laboratory. Add the corresponding volume of ASFV strain Pig / HLJ / 2018 (GenBank: MK333180.1) (hereinafter also referred to as ASFV wild type virus) with MOI = 1, shake well and put back into the cell culture box. Two hours later, replace the fresh culture medium and continue to culture for 24 hours, then collect the total RNA sample and supernatant sample of the culture.

[0070] Total RNA samples were used to reverse transcription to obtain cDNA library samples of the culture, and the specific method of reverse transcription was as follows:

[0071] 1. Genomic DNA removal reaction

[0072] Reaction system: 5×gDNA Eraser Buffer (Novoprotein E047-01B) 2.0 μl; gDNA Eraser 1.0 μl; total RNA 2.0 μl; RNase-free water 5.0 μl.

[0073] The reaction conditions were: 42℃, 2min; 4℃, 2min.

[0074] 2. Reverse transcription reaction (SYBR Green qPCR method)

[0075] Reaction system: 10.0 μl of reaction solution in step 1; PrimeScript RT Enzyme Mix I (Novoprotein E047-01B) 1.0 μl; RT Primer Mix (Novoprotein E047-01B) 1.0 μl; 5×PrimeScript Buffer 2 (Novoprotein E047-01B) 4.0 μl; RNase-free water 4.0 μl.

[0076] The reaction conditions were: 37℃, 15min; 85℃, 5s; 4℃, 2min.

[0077] The above cDNA was used as a template, and SYRB Green qPCR method was used for fluorescence quantitative PCR amplification.

[0078] Specific quantitative PCR primers were designed and synthesized according to the cDNA sequence of the P30 gene encoded by ASFV, as follows:

[0079] ASFV-P30-F: 5'-TGTTTCATGCGGGTAGCCTG-3';

[0080] ASFV-P30-R: 5'-GGGCTCTTGCTCAAACAACG-3'.

[0081] GAPDH was used as an internal reference gene, and the primer sequence was as follows:

[0082] GAPDH-F: 5'-AGGTCGGTGTGAACGGATTTG-3';

[0083] GAPDH-R: 5'-TGTAGACCATGTAGTTGAGGTCA-3'.

[0084] 200 μl of culture supernatant was collected and viral DNA was extracted using the TaKaRa MiniBEST Viral RNA / DNA Extraction Kit Ver. 5.0 (Cat#9766, Takara). Specific quantitative PCR primers targeting the ASFV-encoding P72 gene DNA sequence were designed and synthesized as follows:

[0085] ASFV-P72-F: 5′-CTGCTCATGGTATCAATCTTATCGA-3′;

[0086] ASFV-P72-R: 5′-GATACCACAAGATCAGCCGTA-3′.

[0087] Then, on the one hand, the P72 gene sequence (see NCBI Reference Sequence: NC_001659.2) was cloned into pMD19T (TaKaRa, D102A) to obtain a plasmid with a known copy number (the resulting recombinant plasmid was named ASFV-P72-pMD19T). Using serially diluted ASFV-P72-pMD19T plasmid as a template, quantitative real-time PCR amplification was performed to obtain the relationship between Ct value and copy number, and a standard curve was plotted. On the other hand, using the above viral DNA as a template, quantitative real-time PCR amplification was performed according to the SYRB GreenqPCR method. The culture supernatant DNA from the infected group and the control group was then amplified, with three replicates for each group. The specific reaction system and conditions for quantitative real-time PCR are as follows:

[0088] Reaction system: SYBR Green Realtime PCR Master Mix 10.0 μl; primer ASFV-P72-F (10 μm) 0.6 μl; primer ASFV-P72-R (10 μm) 0.6 μl; viral DNA 1.0 μl; ddH2O 7.8 μl.

[0089] The reaction conditions were: 95℃ for 10 min; 95℃ for 10 sec, 60℃ for 10 sec, 72℃ for 10 sec, for 45 cycles.

[0090] For the Ct value obtained from real-time PCR, the corresponding viral copy number is calculated based on the standard curve.

[0091] like Figure 2 As shown, compared with the si-NC group, the transcriptional level of the ASFV core gene P30 was significantly reduced in the CD244 expression suppression group; Figure 3 As shown, the number of viral P72 gene copies in the culture supernatant was also significantly reduced.

[0092] Example 3, Construction of CD244 overexpression cell line by lentivirus transduction technology

[0093] First, the pig CD244 gene cDNA sequence (accession number: ENSSSCG00000006374, as shown in SEQ ID No. 3) was downloaded from the ensemble database (www.ensembl.org), then the sequence was synthesized in vitro, and the XhoI / BamHI two enzyme cutting sites were cloned into the pLVX-T2A-mCHerry-puro vector (recorded in the article "Limeng Sun, et al. Genome-scale CRISPR screen identifies TMEM41B as a multi-function host factor required for coronavirus replication. PLOS Pathogens | https: / / doi.org / 10.1371 / journal.ppat.1010113 December 6, 2021") skeleton to obtain the target plasmid.

[0094] The target plasmid was transformed into competent E. coli DH5a by heat shock method, then coated in AMP + resistant LB solid culture dish, placed in a 37°C incubator for overnight culture, single colony colonies were selected for expansion culture, and then sent to the company for sequencing. The bacterial liquid identified by sequencing was expanded and cultured, the plasmid was extracted by OMEGA endotoxin removal plasmid extraction kit, and named pLVX-2A-CD244-mCHerry-puro.

[0095] Then, the pLVX-2A-CD244-mCHerry-puro lentivirus was packaged, and iPAM cells (the "IPAM-WT" cells recorded in "Elena G. Sanchez, et al. Phenotyping and susceptibility of established porcine cell lines to African Swine Fever Virus infection and viral production. SCIENTIFIC REPORTS | 7: 10369 | DOI: 10.1038 / s41598-017-09948-x" are publicly available from the applicant and can only be used for repeating the experiments of the present application and cannot be used for other purposes) were infected to construct a CD244 gene overexpression cell strain, and the specific experimental process was as follows:

[0096] The day before, HEK 293T cells were inoculated in a 10 cm 2 When the confluence was 70%-90%, the lentivirus was packaged. First, 24 μg of total plasmid [pMD2.G (addgene: #12259): psPAX2 (addgene: #12260): pLVX-2A-CD244-mCHerry-puro = 1:2:3, mass ratio] was taken into 500 μL of Jetprime Buffer, vortexed to mix, then 40 μL of Jetprime transfection reagent was added, and vortexed to mix, and then placed for 10 min. Then, the above solution was added to the 10 cm 2 The 10 cm dish was placed back in a 37°C 5% CO2 incubator for culture. At 6 h, 10 mL of 2% FBS culture medium was added, and at 24 h, 10 mL of the same culture medium was added, and the culture was continued until 60 h, the supernatant was collected, centrifuged at 4°C 30000 rpm / min for 3 h, the supernatant was poured out, 200 μL of pre-cooled PBS was used to resuspend the lentivirus precipitate, and after dispersion at 4°C overnight, it was stored at -80°C to obtain the pLVX-2A-CD244-mCHerry-puro lentivirus.

[0097] The iPAM cell strain was infected with lentivirus containing the CD244 expression sequence (i.e. the pLVX-2A-CD244-mCHerry-puro lentivirus obtained in the previous step), and cultured for 48 h. The mCHerry-positive cells were sorted using a flow cytometer, and single cells were sorted into a 96-well culture plate to select a monoclonal cell strain. The pig CD244 gene cDNA sequence was downloaded from the ensemble database, and quantitative primers for detecting CD244 gene expression were designed (Table 2). Total RNA samples of the monoclonal cells were collected, reverse-transcribed into cDNA, and subjected to fluorescent quantitative PCR amplification using the cDNA as a template. For details, refer to the relevant steps in Example 1.

[0098] As shown in Figure 4 , the expression of the CD244 gene in the selected monoclonal cells was significantly increased.

[0099] Further, the expression of CD244 protein in the cell strain was detected by Western Blot technology, and the specific experimental procedure was as follows:

[0100] The monoclonal cells were inoculated in a six-well culture plate, and stable iPAM wild-type cells were set as a control group. When the confluence reached about 90%, 1 mM PMSF and 100 μl RIPA lysis buffer were added to each well, the cells were lysed in an ice bath for 30 min, centrifuged at 13000 rpm at 4°C for 20 min, and the supernatant was collected. The concentration was determined using a BCA protein quantification kit. 40 μg of denatured protein samples were subjected to polyacrylamide gel electrophoresis, and the target band was cut according to the size of the CD244 protein molecular weight. The β-tubulin protein electrophoresis band was also cut as a positive internal reference. The two groups of proteins were simultaneously transferred to PVDF membranes using wet transfer method. After blocking with skimmed milk powder, the primary antibody (CD244 1677-1-AP, β-tubulin ab231082) was incubated at 4°C overnight, and the secondary antibody (Thermo Fisher 61-6520) was developed after incubation. As shown in Figure 5 , the β-actin protein in the cell strain was well expressed, and the CD244 protein in the monoclonal cell strain was significantly increased. The results showed that the CD244 gene overexpression cell strain was successfully constructed, and the overexpression cell strain was named iPAM-CD244-OE.

[0101] Example 4, Western Blot and immunofluorescence experiments showed that overexpression of CD244 gene can significantly increase the expression of ASFV encoded proteins in host cells

[0102] Further, the expression of ASFV encoded gene P72 in the CD244 overexpression cell strain at 24 h after ASFV infection was detected by Western Blot experiment. The specific experimental procedure was as follows:

[0103] Inoculate the iPAM-CD244-OE cell strain (see Example 3), set the iPAM wild type cell as control, when the confluence reaches about 90%, add the corresponding volume of ASFV wild type virus according to MOI = 10 per well, shake well and put back into the cell culture box for culture, change to 2% FBS medium at 2h and continue to culture to 24h. Add 1mM PMSF and 100ul RIPA lysis buffer per well, lyse the cells in ice bath for 30min, centrifuge at 13000rpm for 20min at 4°C, collect the supernatant and determine the concentration with BCA protein quantification kit. Take 40ug denatured protein sample for polyacrylamide gel electrophoresis, cut the target band according to the molecular weight of P72 protein, and cut the beta-tubulin protein electrophoresis band as a positive internal reference, transfer the two groups of proteins to PVDF membrane at the same time using wet transfer membrane method, block with skimmed milk powder, incubate the primary antibody (P72 antibody, bs-41384R; beta-tubulin antibody, ab231082) at 4°C overnight, and develop after incubation with secondary antibody (Thermo Fisher 61-6520, Thermo Fisher 31460). As shown in the figure, the beta-actin protein of the strain is well expressed, and the P72 protein in the monoclonal cell strain is obviously improved. The results show that overexpression of CD244 gene significantly improves the expression of ASFV encoded gene P72 in iPAM cells. Figure 5

[0104] Further, the expression of ASFV encoded gene P30 in CD244 overexpressing cell strain infected with ASFV at 24h was detected by immunofluorescence experiment. The specific experimental process is as follows:

[0105] Inoculate the iPAM-CD244-OE cell strain (see Example 3), set the iPAM wild type cell as control, when the confluence reaches about 90%, add the corresponding volume of ASFV wild type virus according to MOI = 10 and 50 per well, shake well and put back into the cell culture box for culture, change to 2% FBS medium at 2h and continue to culture to 24h. Take the 24h cells and fix them with polyphosphoric acid PFA, treat with 0.3% Tritonx-100, add blocking solution and block at room temperature for 1h, incubate P30 (ASFV) primary antibody (P30 antibody, bs-41382R) at 4°C overnight, incubate secondary antibody (Thermo Fisher A32731) at room temperature for 2h, then DAPI staining and fluorescence imaging. The results are shown in the figure. Figure 6 As shown in the figure, compared with wild type iPAM cells, the expression of P30 protein in iPAM-CD244-OE cell strain inoculated with ASFV is obviously improved at MOI = 10, and the expression of P30 protein in iPAM-CD244-OE cell strain is more obviously improved at MOI = 50.​

[0106] In summary, Western Blot and immunofluorescence experiments demonstrated that overexpression of CD244 gene significantly increased the expression of ASFV encoded genes P72 and P30 in iPAM cells.

[0107] The above results show that inhibition of CD244 gene expression in porcine primary alveolar macrophage (PAM) cells can significantly interfere with ASFV replication, and overexpression of CD244 can significantly promote the replication of ASFV in iPAM cell lines.

[0108] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wide range of equivalent parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In summary, according to the principle of the present application, this application intends to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which deviates from the range disclosed in the present application.

Claims

1. The use of substances capable of inhibiting CD244 expression in the preparation of products for the treatment and / or prevention of African swine fever virus infection; The substance that can inhibit CD244 expression is CD244 siRNA; The nucleotide sequence of the CD244 siRNA is shown in SEQ ID No.

1.

2. Application of substances that can inhibit CD244 expression in the preparation of cell or animal models with enhanced resistance to African swine fever virus; The substance that can inhibit CD244 expression is CD244 siRNA; The nucleotide sequence of the CD244 siRNA is shown in SEQ ID No.

1.

3. The application according to claim 2, characterized in that: The cells are primary porcine alveolar macrophages; and / or The animal is a pig; and / or The CD244 is the protein shown in SEQ ID No.

2.

4. A method for preparing a cell model or animal model with enhanced resistance to African swine fever virus, comprising the following steps: reducing the expression of CD244 in host cells or animals to obtain recombinant cells or animals; the recombinant cells or animals exhibit enhanced resistance to African swine fever virus compared to the host cells or animals; The reduction of CD244 expression in the host cells or animals is achieved by introducing CD244 siRNA into the host cells or animals; The nucleotide sequence of the CD244 siRNA is shown in SEQ ID No.

1.

5. The method according to claim 4, characterized in that: The host cells are porcine primary alveolar macrophages; and / or The animal is a pig; and / or The CD244 is the protein shown in SEQ ID No. 2.

Images