A recombinant plasmid for genetic marker of cordyceps sinensis and a genetic marker method
By introducing the EF1α promoter and green fluorescent protein marker into Cordyceps sinensis and utilizing the Agrobacterium-mediated transformation system, the problem of morphological detection of Cordyceps sinensis was solved, realizing a stable and simple genetic marker method, which promotes research and application.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INST OF ZOOLOGY CHINESE ACAD OF SCI
- Filing Date
- 2022-03-24
- Publication Date
- 2026-06-02
AI Technical Summary
Existing technologies struggle to specifically detect different morphologies of Cordyceps sinensis in complex environments, and traditional labeling methods are cumbersome, limiting basic research and applications.
A recombinant plasmid containing the EF1α promoter sequence and the green fluorescent protein coding sequence of Cordyceps sinensis was used to constitutively express the green fluorescent protein label in Cordyceps sinensis through an Agrobacterium-mediated transformation system, and the co-culture and screening conditions were optimized.
This study has enabled the discovery of stable and visible genetic markers for Cordyceps sinensis, simplifying the detection process, shortening the screening time, and providing broader research and application prospects.
Smart Images

Figure CN116837018B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a recombinant plasmid for genetic markers of Cordyceps sinensis, an Agrobacterium strain, and a method for genetic markers of Cordyceps sinensis. Background Technology
[0002] Cordyceps sinensis is a typical fungal-insect complex, formed when the fungus *Ophiocordyceps sinensis* (Berk.) of the Clavicipitaceae family specifically infects the larvae of Hepialidae moths, multiplies within the host, and ultimately kills the host. Cordyceps sinensis possesses immunomodulatory, antioxidant, lipid and blood sugar regulating, anti-tumor, and anti-aging effects. Its high medicinal value is a major reason for the increasing market demand for Cordyceps sinensis. However, the slow growth of both *Ophiocordyceps sinensis* and the Hepialidae moth, along with their specific living environments and narrow ranges, leads to a scarcity of Cordyceps sinensis resources and limits its basic research and application. Many scientific questions regarding the formation process of Cordyceps sinensis remain unanswered, such as the process of *Ophiocordyceps sinensis* infecting Hepialidae moth larvae under natural conditions, the immune interaction between *Ophiocordyceps sinensis* and the host Hepialidae moth larvae, and the developmental process of *Ophiocordyceps sinensis* within the Hepialidae moth. If there are specifically labeled Cordyceps sinensis fungi, the aforementioned scientific research will break through limitations and enter a new stage of rapid development.
[0003] Chinese patent CN107557305A discloses a fermentation synthesis method. 13 A method for labeling Cordyceps sinensis mycelium with C. This labeling method is cumbersome, requiring repeated preparations... 13 C-labeled Cordyceps sinensis mycelium requires 13 C-labeled glucose. Furthermore... 13 C-labeled Cordyceps sinensis lacks visual characteristics, requiring large-scale instruments for detection. This method is only suitable for metabolic-related studies, limiting basic research and applications of Cordyceps sinensis. Therefore, fluorescent labeling of Cordyceps sinensis at the genetic level is an urgent problem to be solved. Summary of the Invention
[0004] Therefore, the purpose of this invention is to provide a method for detecting genetic markers of different morphologies of Cordyceps sinensis that is visually appealing, easy to operate, and can specifically detect them in complex environments.
[0005] The objective of this invention is achieved through the following technical solution:
[0006] On one hand, the present invention provides a recombinant plasmid for genetic markers of Cordyceps sinensis, which contains a constitutively expressed green fluorescent protein (GFP) promoter sequence operably linked to a green fluorescent protein coding sequence.
[0007] According to an embodiment of the present invention, the Cordyceps sinensis promoter sequence is the Cordyceps sinensis EF1α promoter sequence. Specifically, the Cordyceps sinensis EF1α promoter sequence is shown in the following sequence: (SEQ ID No. 1).
[0008] According to a preferred embodiment of the present invention, the recombinant plasmid further comprises an antibiotic resistance selection gene sequence. Specifically, the antibiotic resistance selection gene may be selected from a hygromycin resistance gene or a benomyl resistance gene. Preferably, the antibiotic resistance selection gene is a hygromycin resistance gene.
[0009] On the other hand, the present invention also provides an Agrobacterium strain for genetic markers of Cordyceps sinensis, which contains the recombinant plasmid described above according to the present invention.
[0010] According to an embodiment of the present invention, the recombinant plasmid is transformed into the Agrobacterium strain using a freeze-thaw method.
[0011] Furthermore, this invention provides a genetic marker method for Cordyceps sinensis, which includes the following steps:
[0012] The Agrobacterium strain according to the present invention was co-cultured with Cordyceps sinensis, and positive transformants were screened.
[0013] According to an embodiment of the present invention, the genetic marker method includes co-culturing Agrobacterium strain and Cordyceps sinensis at 16-22°C on a solid culture medium for co-culturing, preferably at 20°C in the dark for 48-96 hours, then screening the co-culture with Cordyceps sinensis solid culture medium containing antibiotics, and obtaining resistant colonies by culturing at 16-22°C for 25-35 days. Preferably, the solid culture medium for co-culture comprises 5-15 mM potassium dihydrogen phosphate, 7-17 mM dipotassium hydrogen phosphate, 2-2.5 mM magnesium sulfate, 2-6 mM sodium chloride, 0.1-0.5 mM calcium chloride, 0.5-10 μM ferrous sulfate, 3-5 mM ammonium sulfate, 3-7 mM glucose, 0.3-0.7% glycerol, 1.5-2.0% agar, 30-50 mM morpholine ethanesulfonic acid, and 200-300 μM acetylsyl syringone; and / or each liter of the Cordyceps sinensis solid culture medium comprises 100-200 g potato, 10-20 g glucose, 5-10 g peptone, 1-5 g sodium chloride, 0-100 mg vitamin B2, 10-100 mL fetal bovine serum, and 15 g agar. The co-culture is conducted at a temperature of 16-22℃ in the dark, which ensures both the infectivity of Agrobacterium and the normal growth of Cordyceps sinensis. The 72-hour co-culture period ensures that Agrobacterium does not overgrow while allowing Cordyceps sinensis to integrate the target fragment into its genome. Using the Cordyceps sinensis solid culture medium described in this invention can significantly shorten the time for screening positive transformants to approximately 30 days.
[0014] According to a preferred embodiment of the present invention, the genetic marker method further includes propagating the obtained resistant colonies in a Cordyceps sinensis culture medium. Preferably, each liter of the Cordyceps sinensis culture medium contains 100-200g of potato, 10-20g of glucose, 5-10g of peptone, 1-5g of sodium chloride, 0-100mg of vitamin B2, and 10-100mL of fetal bovine serum. According to a preferred embodiment of the present invention, the genetic marker method further includes detecting the green fluorescence signal of the positive transformants obtained by propagation using a fluorescence microscope.
[0015] According to an embodiment of the present invention, prior to the co-culture, the Agrobacterium is induced with acetylsyleugenone for 5-7 hours to OD. 660 It is 0.3-0.5.
[0016] According to an embodiment of the present invention, the Cordyceps sinensis fungus is a Cordyceps sinensis spore. Preferably, the concentration of the Cordyceps sinensis spore is 1.0 × 10⁻⁶. 7 Count / mL. Cordyceps sinensis spores are easy to culture and collect.
[0017] The inventors unexpectedly discovered that using the constitutively expressed Cordyceps sinensis EF1α promoter ensured constitutively high expression of GFP protein in the recipient Cordyceps sinensis, enabling all morphologies of Cordyceps sinensis to emit green fluorescence. Furthermore, the inventors had experimented with various commonly used constitutively expressed promoters in fungi; however, only recombinant plasmids containing the EF1α promoter yielded positive transformants, while other constitutively expressed promoters, such as β-Tubulin and TrpC promoters, failed to produce positive transformants with fluorescent signals.
[0018] Furthermore, it was surprisingly discovered that the Cordyceps sinensis solid culture medium and culture solution of the present invention contain an appropriate amount of fetal bovine serum, which can stimulate and accelerate the growth of Cordyceps sinensis, greatly shortening the propagation time of positive transformants, which can be completed in 7-10 days.
[0019] Given that Agrobacterium-mediated transformation systems can achieve genetic transformation without using protoplasts as transformation recipients, using conidia, hyphae, or even fungal tissues as recipients, especially for slow-growing Cordyceps sinensis, omitting the protoplast preparation and revival steps means saving a significant amount of time, this invention employs an Agrobacterium-mediated transformation system. Furthermore, compared to traditional fungal transgenic technology, Agrobacterium-mediated transformation offers advantages such as high transformation efficiency, ease of operation, and single-copy insertion.
[0020] This invention optimizes the co-culture and screening conditions of Agrobacterium and Cordyceps sinensis, enabling screening to be completed in 30 days. Using the Cordyceps sinensis culture medium of this invention, the propagation speed of positive transformants is accelerated, completing propagation in 7-10 days.
[0021] This invention employs an Agrobacterium-mediated fungal transformation system, using green fluorescent protein to label Cordyceps sinensis, wherein the promoter is a constitutively expressed promoter of Cordyceps sinensis. The co-culture conditions and screening conditions of Agrobacterium and Cordyceps sinensis are optimized, and positive transformants are rapidly propagated using the Cordyceps sinensis culture medium of this invention, ultimately obtaining GFP-labeled Cordyceps sinensis strains.
[0022] The labeling method of this invention is stable, non-toxic, safe, and easy to operate, providing convenient conditions for the application of this strain. This invention utilizes the constitutively expressed promoter of *Cordyceps sinensis* and the exogenous GFP gene to achieve in vivo genetic labeling of *Cordyceps sinensis*. Large quantities of *Cordyceps sinensis* with green fluorescence can be propagated as needed, and different morphologies of *Cordyceps sinensis* with green fluorescence can also be obtained, thus enabling specific detection of *Cordyceps sinensis* in complex environments, providing visual visibility and a broader prospect for the research and application of *Cordyceps sinensis*. This invention can be used for transcriptional level detection of specific genes in *Cordyceps sinensis*, subcellular localization of specific proteins, and functional studies of specific proteins. Alternatively, referring to the method of this invention and combining it with homologous recombination theory, a specific gene in *Cordyceps sinensis* can be knocked out for functional studies of that specific gene. Attached Figure Description
[0023] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings, wherein:
[0024] Figure 1 This is a simplified diagram of the plasmid pBHt2-OsPEF1α-GFP constructed in this invention.
[0025] Figure 2 It consists of GFP-labeled Cordyceps sinensis spores and hyphae cultured in vitro.
[0026] Figure 3 It is a GFP-labeled Cordyceps sinensis fungus found inside the body of the worm. Detailed Implementation
[0027] The present invention will be further described below with reference to specific embodiments. These embodiments are only for explaining the present invention and do not imply any limitation on the content of the present invention in any way.
[0028] Example 1
[0029] This embodiment describes an Agrobacterium-mediated method for labeling Cordyceps sinensis with GFP, comprising the following steps:
[0030] Step 1) Predict the EF1α, β-Tubulin, and TrpC promoter sequences of Cordyceps sinensis:
[0031] Analyzing the genomic data of Cordyceps sinensis, the sequences of the EF1α, β-Tubulin, and TrpC coding regions and their preceding 1000-2000 bp were derived (the underlined portions are the gene coding regions):
[0032] The coding region of the EF1α gene and its anterior sequence
[0033] ATGGGGTATGTCGCCTCGCCCTCTCCAGCGGCATCGCGGCAGCCTCGCCATACCATCGCCA TAACATATTGACTGACGCTATCGTGTAGTAAGGACGACAAGACTCACATCAATGTGGTCGTTATCGTACGTGCTCC CCTTCCTGCTTCAGCCCGCTTTCTTGTCTCGGCACGCCTTACTGACTTCTCTCTTCTAGGGGTACGTCGAATCACT CGATTCCTGCCGCCAACTGTTTCCGTTGTGCTAACACTCGGGTCAGCCACGTCGACTCCGGCAAGTCGACCACTGT GAGTCTTTCCCCGTCGGCCGCGACTTGAACATCCGGCTCGTCCTCGTCCTGCCCCCGCCTGCCTCATCGTCAGTGC GGGGTATTCAGATGAACATTTCTGACATGCAATTCAGACCGGCCACTTGATCTACAAGTGCGGTGGTATCGACAAG CGAACCATCGAGAAGTTCGAGAAGGTAAATATCTAGTCATTTCGTCTCTTCCGCTCTTCCGTACCCATTTTCCCGC TCCCCAAGTGCCAGGGCACCGGCGGGCATCTATTCCCCCTCACGCGCAATCAAAAATTTCTCACGGCGTGCCTTGA CCTCGGGCTGGTGGGGCTCTACCCCGCTACTCTCGCCCTGCTGCCAATGGCACCCAGCAGTGACCCTCCTCCAGCC CCGCAAAAGAAAACAGAATCCGCGCTCATGTGACATCGCTAACCCGACTCGAATTACAGGAAGCCGCCGAACTTGG CAAGGGCTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATT GCCCTGTGGAAGTTTGAGACTCCCAGGTACTATGTCACCGTCATTGGTAACTCAATCCTGTTGCTGCTCCTGTCCG AATGGCTCCCACTGACCATGGCCTCGCAGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGATCACCGGTACC TCCCAGGCCGATTGCGCTGTCCTTATCATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCC AGACTCGTGAGCACGCCCTGCTTGCCTACACCCTCGGTGTGAAGCAGCTCATCGTTGCTATCAACAAGATGGACAC CACCAAGTGGTCCGAGGCTCGCTTCCAGGAAATCATCAAGGAGACGTCCAACTTCATCAAGAAGGTCGGCTACAAC CCCAAGACCGTCGCCTTTGTCCCCATCTCTGGCTTCAACGGCGACAACATGATTGATTCCTCCCCCAACTGCCCCT GGTACAAGGGCTGGGAGAAGGAGATCAAGTCTGGCAAGGTCACTGGCAAGACCCTGCTCGAGGCCATCGACTCCAT CGAGCCTCCCAAGCGTCCCTCCGACAAGCCCCTGCGTCTGCCCCTCCAGGATGTGTACAAGATTGGCGGTATCGGA ACAGTTCCCGTCGGTCGTGTCGAGACTGGTGTCATCAAGCCCGGCATGGTCGTAACCTTTGCTCCGGCCAACGTCA CTACCGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACCGAGGGTCTTCCTGGCGACAACGTCGGCTTCAA CGTGAAGAACGTCTCCGTCAAGGAGATTCGCCGTGGCAACGTCGCTGGTGACTCCAAGAACGACCCCCCTCTGGGC GCCGCATCCTTCAACGCTCAGGTCATCGTCCTCAACCACCCCGGCCAGGTCGGTGCTGGTTACGCCCCCGTTCTTG ACTGCCACACCGCCCACATTGCCTGCAAGTTCTCCGAGCTCCTGGAGAAGATCGACCGCCGTACCGGCAAGGCTGT CGAGACTTCCCCCAAGTTCATCAAGTCTGGTGATGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTT GAGGCTTTCACCGACTACCCTCCTCTGGGCCGCTTCGCCGTCCGCGACATGCGCCAGACCGTCGCCGTTGGTGTCA TCAAGTCTGTCGAGAAGGCTGCTGCCAGCTCTGGCAAGGTCACCAAGTCCGCCGCCAAGGCTGTCAAGAAATAA (SEQ ID No.2).
[0034] The coding region of the β-Tubulin gene and its anterior sequence
[0035] ATGGCCACACGTGTTTCCCGGAGGCTCAACAGTCGTCTGCAGGG CAACCAAATCGGTGCTGCGTTCTGGCAGACCATCTCTGGCGAGCATGGCCTCGACAGCAATGGTGTCTACAACGGC ACTTCGGAGCTTCAGCTCGAGCGCATGAGCGTATACTTCAATGAGGTTCGTCTCGCCATGTGTGCCCTGCTTGGGA AACCCATCCGCCAAAGCCCAACTAACCGTATTGGCTGGTGAATAGGCCTCAGGAAACAAATATGTCCCCCGCGCTG TCCTTGTCGATCTCGAGCCCGGCACCATGGACGCCGTTCGTGCCGGTCCCTTTGGTCAGCTGTTCCGCCCGGATAA CTTCGTTTTCGGCCAGTCCGGTGCTGGCAACAACTGGGCCAAGGGCCACTACACTGAGGGTGCCGAGCTGGTCGAC CAGGTCCTCGACGTCGTTCGTCGCGAGGCTGAGGGCTGCGACTGCCTGCAGGGCTTCCAGATCACCCACTCCCTGG GTGGCGGCACTGGTGCTGGTATGGGTACCTTGCTCATTTCCAAGATCCGCGAGGAGTTCCCCGACCGCATGATGGC CACCTTTTCTGTCGTGCCCTCCCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACAACGCCACCCTCTCCGTCCAC CAGCTTGTGGAGAACTCGGACGAGACGTTCTGCATCGACAACGAGGCCCTCTATGATATCTGCATGCGTACCCTGA AGCTGTCCAGCCCCTCGTACGGTGACCTAAACCACCTCGTCTCGGCTGTTATGTCGGGCGTCACGACCTGCCTGCG ATTCCCGGGTCAGCTCAACTCGGATCTCCGCAAGCTCGCCGTCAACATGGTTCCCTTCCCTCGTCTTCATTTCTTC ATGGTCGGCTTCGCGCCCCTGACCAGCCGTGGCGCCCACTCTTTCCGCGCCGTCAGCGTGCCCGAGTTGACGCAGC AAATGTTCGACCCCAAGAACATGATGGCTGCCTCCGATTTCCGGAACGGCCGCTACCTGACTTGCTCTGCCATTTT GTATGTGTTCCTGACTATGCTGTCGGCCTTGAGACTTGGACTAACATGCATTGCAGCCGTGGCAAGGTCGCCATGA AGGAGGTCGAGGACCAGATGCGCAACGTGCAGAACAAAAATGCAACGTACTTTGTTGAATGGATTCCCAATAATAT CCAGACAGCCCTTTGCGCTATCCCTCCCCGTGGCCTCAAGATGTCGTCCACCTTTATCGGCAACTCGACCTCTATC CAGGAGCTCTTTAAGCGTGTTGGTGAGCAGTTCACTGCCATGTTCCGTCGCAAGGCTTTCTTGCATTGGTACACGG GCGAGGGCATGGATGAGATGGAGTTCACCGAGGCCGAGTCTAACATGAACGACTTGGTCTCCGAGTACCAGCAGTA CCAGGATGCTGGTATCGACGATGAGCCGGAGGAGTACGACGAGGAGCAGGCTCCCGAGGCCGAGGAATAG (SEQ ID No. 3).
[0036] The coding region of the TrpC gene and its anterior sequence
[0037] CGGCAATCTCGTCCGAGTCGAGGGCCGACGATGCGCCCAGGTCCGATAGGAAAGATGCGCCTTGACCATTTTGAAGGCCGGCGGCTTCTTGTAGATTTGCGGCGTCCTGAGAGGAGAGCGGGCCCATAAGATGCCTGAAAGGGCGCGACTGGGCCTCGACAATGACGACCCGCAGCGCAGCGACGGGGTTAATCTTTGCGTTTTGACTGAGCCATTCCGCATCTGCCTTGAAGGTCTTGACATCGTGGTCCGAGGCCGAGGTCACGTTGACGGGAGCCGTCTTGGTCTCAAAGTCCTTTTGGAAGGCGTCGTTGGGCGGCGCAAACACGGCCGAAGGGTCTCTGAGCAAAGAATGAACGTGTTCATCTGCGAGGAAACCGACCACAGCTGGGCACGTCTGTCGTTGGCCGGATTGGTCCGAAAGCGCGGTCGCGATGTGAGTCCAGGAGCTAAAGGGAAGTCAGTCGCAAGCATCTCAATGGAGGGGAGAAGGCTCACAGAAGCACGCGCTCCCCGGACAAGCACCCCTCCAGCGGGGGGAAATAAGTGCTATCCGACACCGGCGCCATGGCCGCGAGCGTCAGTCAAGGGGTGACGGCAGGCGCATCCCTTGGCGGGGGGGTTGGCGCAGGTGAGGATGAGGATGTTGGTGTTGACGCGCTTGAGCAGCAGCATTTGTCCGTCGAGCTACGAATACACTCCTCACTGTCTGGGACTTTTTCCTTAGGCCCGAGCTTCGTTGGACCGATGTTTAGCCAGCTAAGCCGTTCCCCGGCAGTTGATGGAAGCGCTGCACTGTGCATACGCACGGTACATGACGCCCTGTTCATCGTGCGACGACACAGTACGCCGGGTTATCTATCGGTGCCCGCAGATTCTCAATGGCCTCGAGTCAGTCACGTCTGGCGAAGCGAGCGTTTCCCTTGCATTCTATCTCGGCGGCGCCGTGTTCCTGTATCAGTGCACACATCAATCAAGACATTGTCGGAAGTCTTTGAAA。 ATGCCGTCGGCTCTCGGAATCATCGATCACTCTCCCCATCAGCCCGAACCCTCCCC CCCCATTCCAACAGCCTCCAACCTCGTTCTCATCGACAACTACGACTCCTTTACCTGGAACATCTACCAGTATCTC GTTCTCGAGGGAGCCACCGTCCATGTATTCCGCAACGACCAGATCAGCCTCGAGGAGCTCATCCAGAAGAACCCTA CCCAGCTCATCATCAGCCCAGGCCCGGGGCACCCCGCAACCGACTCGGGCATCAGTCGAGATGCCATTCGTCATTT TGCCGGCAAGGTCCCCATCTTTGGTGTTTGCATGGGCCTGTGAGTCTCTATAGAGGTGGTGTCCCTCCCTGTACTG GTCTGTCTGGCTCACGCTTGCCAGACAATGCATGTTTGATGTCTATGGCGGAGATGTCAACTCGGCTGGCGAGTGG CTTCACGGCAAGACGTCCCCTTTGGTACATGACTCCAAGGGCGTCTTTGCCGACCTCGAGCAGAATCTCCCAGTGA CGAGGTATCATTCCCTGGCGGGAACCCACGTCACCCTGCCCGAGTGCCTTGAAATCACCTCGTGGGTGGCCAACGC GGACGGCTCGCCCGGCATCATCCAAGGCATTCGTCACAAGACGTTTGCCATGGAGGGAGTGCAGTTTCACCCTGAG AGCATACTGACAGCCCACGGCCGCAAGATGATTAAAAATTTCCTGCTTATGCAGGGTGGCACCTGGGAGGAAAACT CTCAGCTGCAGAGGGCGGCGTCGGCCAAGGACGCTGCCGCTGCGCCGGCGAAGCCCAAGGGCAACAACATCCTTGA GCGAATCTATGCTAGCCGAAGGGCTGCTGTTGCGATTCAGAAAGAGATCCCTTCCCAGAGAATGGCCGACCTGCAG GCTGCCTACGATCTTAACGCCGCCCCTCCTCTGGTCCCGCTCGTCAGTCGCCTGCGCCAAACACCATTCGACGTGG CTCTCATGGCCGAGATCAAGCGTGCCTCTCCTTCCAAAGGCGTCTTTGCTCTCGACATCAATGCGCCCACTCAAGC ACGCACGTATGCACTGGCGGGCGCCAGCGTCATCTCGGTTCTCACGGAGCCAGAGTGGTTCAAGGGAAGTCTCGAC GACTTGCGAGCCGTGCGGCAGGTCCTGGACGGAATGCCAAACAGGCCCGTCGTTTTGCGCAAGGACTTCATCTTTG ACGAGTACCAGATCCTCGAGGCGAGACTAGCGGGCGCCGACACGATTCTGCTGATTGTCAAGATGCTGCATCTCGA GCTGCTCGAACGGCTGTACAAGTACTCGCTCTCGCTGGGCATGGAGCCACTGGTGGAGGTTCAAAACGCCGAGGAG ATGACGACGGCCGTGAAGCTGGGCGCCAGGGTTATCGGGGTGAACAACCGGAACCTGGAAAATTTCGAGGTAGACC TGGACACGACGGGCCGGCTGAGGCGCATGGTGCCCGAAAACACGCTCATCTGCGCTCTCAGCGGCATCAACACCCA CGACGACGTGCTGATGAACAAAAATGACGGGGTCAACGCCGTGCTCGTGGGAGAGGCAATTATGCGCGCGCCAAAC GCGGGCGTCTTCATCAGCGAGCTCTGCGCGGGCTCGAAGCCGGTGGCCGACAAGCCGCCGCCGCGACGGCTCTACG TCAAGATTTGCGGGACTCGGTCGGTCGAAGCCGCCCAAGAAGCCGTCAAGTCAAAGGCCGACTTTGTGGGCATTTG CCTGGTGCGTGGCGCCAAGCGCTGCGTCACTCACGAGACGGCGCTGGCAATATCCAACGCGTTGCATTCGCAACCT GGACGTCTCGAGGCCAGAGCTGAGTGCCAATTGTCCAGCAGCTGCGCCACGGACTACTTTACAGCCGCCGCTTCAC GGCTTCTGAGCTCACGGACCCGCCTGGTGGGCATCTTCCAGAACCAGCCCCTGGCAGACGTGTTGGAAATGCAGAG GCTCTACGACCTAGATCTCGTCCAGCTGCACGGTGACGAGCCGGTTGAGTGGGCCAGGGTCATCCCGGTGCCCGTC ATCCGGTGCTTCAAACCCGGCCAGGTCGGGCTCGGGCTGCGCGGTTACCACACGATACCGCTGCTCGACTCGGGGT CCGGCTCGGGCAAACTGCTCGACGTGTCGAGCGTCAAGGCTGCGCTGGAGAAGGATGCCCACCTCCGAGTCTTCTT CGCCGGCGGCCTGAGCCCGGACAACGTGGCCGAGGCGGTCGATGCCCTAGGCGGGCTGAGCGCTCGGGTCCTCGGG GTCGACGTGAGCAGCGGTGTCGAGGAGGACGGGGAGCAGAGTCTGAGCAAGATTGCTGCTTTTGTCGAGGCTGCGA AGAGCATCAGATAG (SEQ ID No.4).
[0038] Upload the three sequences above to the website http: / / www.softberry.com / berry.phtml?topic=tssp&group=programs&subgroup=promoter. The predicted promoter sequences are as follows:
[0039] The promoter sequence of Cordyceps sinensis EF1α is 800 bp long and is as follows:
[0040] GCTCAAGTTGGGCATGACGGGACCCTCGCTTTTCCACCCGAAACTCGAGACGCACCGATTTTTTTTTGGCTCCATCGTGGATGCGGCTTCGACCCCACTTCGTAGGTATCTGCTAACAGATGACGTGTACGAAGTATACACTGCCGTTAGGAAGAGCGGCTTCGGCGCACCGTCGAGTCATCCGGGCAGGATGAGTACTTTCGCCGTAGAAAAAAACCTTCCGCTGCTGGCTGCGGCCTCGGCGCCCCGGGACGAGGGCAGGGTCATTGAAAATAGGATGAGTCGTGTCTGTCTCTCGTGCGCCTGCGTTTGGGCATTGCACCAGTGACTCTCACGACAACAACACAACCGGCCCGAAATGCGTCAATCTCATTGGCCCGCGTAGCCCTGGTCCACCCACAGACAGAGGGGGGGCGGGGTAAATTCACTGCGAGGCAGGGAAAAATAGCGACCGACCAGGTACCTCGGGCGTGTTAGGGCTTGCCTGCACAAACTGCACAAACTGCTCCCACCCTCCTCTAGTTGCCCCGCGCGAGTGCGGCAGCAGCATGAGCCACTCTCGCCCCACCCTACCCACCCTTTAAATCCCTTCCTCCCACCACAGCGTTTGCGAATTTTTCTCTTTCTGCTCTTCGTCTCGCATACCCGGTTCAAGCATCCGACCTGCGATTTTGTCAGTTGCTCGCCTTCCGCCATCGCCATCCACAGCGAGAGCATCGTCTAACGCGCGTCTTCGCTCTGCAGTTCGATTTCAGTCAAGCAATCCACACGAACACTTCACCTCCACAAACCTCGCCAAG(SEQ ID No.1).
[0041] The promoter sequence of β-Tubulin of Cordyceps sinensis is 868 bp long and is as follows:
[0042] CAGCCCGGAGACAAGGGATCCGGGGAGACATATCCATCCATTGTGTAGCGAATGGAAATGGCGTGTCCTCAGCCGCCGTGGTGGTGAGTGCTGAGATGCCCGTCGAGGTGATCCCGCGCGGACTCTCCTATCTGTTTCCTTCTCTTTTCAAAGCTTCATGCGCCGAAGATATCTCGCGCTTCTGCCCCTTGTTGGGCGGTAACGCGCCGGAAACACCGCGACGTCCCGGCCAAAACACCTTCTCCTCGCGTCAAGAGGGAAATACTTATTTCGATAGCATGAGGATCGGGCCCGTAACACTTGTACTCGGATCTTCACACCGGGTCGAGGTTGATGGAAGCAACCGCTCACCCAACTGGCTTACGTAATTCCCAGCCTGGCAAATGAATTGCAATGCAGGCGAGAGGAGTTGTCTCTTGCCGCCCCGGCGGTGAAGAGGTATGTATGTACCTGATCTCCTGCAGGAGTGTCCAACAAAAATCCACCTCTCACTTCTCTCACCACAACACACACTATCACCACCCTCGCATCGCGAAGCTCCCCTTGGCCCTCGCGATCTCGCCCGATTCCCTCTTCCGCTCAGTACGCCTCTTCGACGATAGCCTTCATCCGTCAACATGCGCGAAATTGTGAGTCTCCCTCTTTCTCCCCGGCAAGCTCAATTCGCGCGACGCGTCTCGACCACCCAAGATGCCCCTGATGATGTGTGCCCCACCAAAAACATTGCACTCCCATTTCGGCCCAACTTGAGGAGCACGCAGATACAAGCGACCTGCTGTCGACGACCAGCCTGCTGACCGAGACTCTTTGAACGACTATAGGTTCATCTTCAGACCGGCCAGTGCGTAAGTAACTGCCCTCCACCGCG(SEQ ID No.5).
[0043] The promoter sequence of Cordyceps sinensis TrpC is 431 bp in length and is as follows:
[0044] GGCCGCGAGCGTCAGTCAAGGGGTGACGGCAGGCGCATCCCTTGGCGGGGGGGTTGGCGCAGGTGAGGATGAGGATGTTGGTGTTGACGCGCTTGAGCAGCAGCATTTGTCCGTCGAGCTACGAATACACTCCTCACTGTCTGGGACTTTTTCCTTAGGCCCGAGCTTCGTTGGACCGATGTTTAGCCAGCTAAGCCGTTCCCCGCCAGTTGATGGA AGCGCTGCACTGTGCATACGCACGGTACATGACGCCCTGTTCATCGTGCGACGACACAGTACGCCGGGTTATCTATCGGTGCCCGCAGATTCTCAATGGCCTCGAGTCAGTCACGTCTGGCGAAGCGAGCGTTTCCCTTGCATTCTATCTCGGCGGCGCCGTGTTCCTGTATCAGTGCACACATCAATCAAGACATTGTCGGAAGTCTTTGAAA(SEQ ID No. 6).
[0045] Step 2) Amplify the EF1α, β-Tubulin, and TrpC promoter sequences of Cordyceps sinensis:
[0046] The primer sequences designed to amplify the above three promoters are shown below:
[0047] POsEF1α-F:accatgattacgaattcGCTCAAGTTGGGCATGACGGGACCC (SEQ ID No. 7).
[0048] POsEF1α-R:tcgcccttgctcaccatCTTGGCGAGGTTTGTGGAGGTGAAG (SEQ ID No. 8).
[0049] POsTub-F:accatgattacgaattcCAGCCCGGAGACAAGGGATCCGGGG (SEQ ID No. 9).
[0050] POsTub-R: gcccttgctcaccatCGCGGTGGAGGGCAGTTACTTACGC (SEQ ID No. 10).
[0051] POsTrpC-F: catgattacgaattcGGCCGCGAGCGTCAGTCAAGGGGTG (SEQ ID No. 11).
[0052] POsTrpC-R:tcgcccttgctcaccatTTTCAAAGACTTCCGACAATGTC (SEQ ID No. 12).
[0053] Using the CTAB-extracted Cordyceps sinensis genome as a template, the EF1α promoter (OsPEF1α), β-Tubulin promoter (OsPTub), and TrpC promoter (OsPTrpC) of Cordyceps sinensis were amplified. PCR reaction system: 6 μL buffer, 2.4 μL 2.5 mM dNTPs, 0.6 μL each of 10 μM primers, and 0.6 μL Cordyceps sinensis genomic DNA. 0.6 μL of DNA polymerase was added, followed by ddH2O to a final volume of 30 μL.
[0054] The PCR amplification program was as follows: 95℃ pre-denaturation for 2 min, 95℃ denaturation for 20 s, 55℃ annealing for 20 s, 72℃ extension for 20 s, 35 cycles, and a final extension at 72℃ for 5 min. Agarose gel electrophoresis confirmed that the PCR product was a single band, and the band size was as expected, indicating the availability of the EF1α promoter (OsPEF1α), β-Tubulin promoter (OsPTub), and TrpC promoter (OsPTrpC) of *Cordyceps sinensis*. The PCR products were temporarily stored at 4℃ for subsequent plasmid ligation.
[0055] Step 3) Construct recombinant plasmids pBHt2-OsPEF1α-GFP, pBHt2-OsPTub-GFP, and pBHt2-OsPTrpC-GFP:
[0056] Because the original plasmid pBHt2-GFP (purchased from Purui Biotechnology Co., Ltd.) lacks suitable restriction enzyme sites at both ends of the PtrpC promoter, plasmid reconstruction cannot be directly performed via double enzyme digestion. In this embodiment, the intermediate cloning vector pEASY-Blunt (purchased from Beijing TransGen Biotech Co., Ltd.) was used to construct plasmids pBHt2-OsPEF1α-GFP, pBHt2-OsPTub-GFP, and pBHt2-OsPTrpC-GFP using a combination of rapid cloning and double enzyme digestion (see flowchart). Figure 1 The specific steps are as follows:
[0057] Using pBHt2-GFP as a template, PtrpC-Hyg-CaMV and EGFP-NOS fragments were amplified by PCR and ligated into the pEASY-Blunt vector (ligation method follows the pEASY-Blunt cloning kit instructions). 2 μL of the ligation product was transformed into *E. coli* DH5α strain using the standard heat shock method. Colony PCR and sequencing were performed the following day to confirm successful construction of plasmids Blunt-PHygT and Blunt-GFPT. The PCR reaction system and PCR amplification procedure are as described in step 2. Primers are as follows:
[0058] PtrpCHygCAMV-F: GAATTCGTAATCATGGTCATAGCTG (SEQ ID No. 13).
[0059] PtrpCHygCAMV-R: GACAACTTAATAACACATTGCGGAC (SEQ ID No. 14).
[0060] EGFPNOS-F: ATGGTGAGCAAGGGCGAGG (SEQ ID No. 15).
[0061] EGFPNOS-R: GATCTAGTAACATAGATGACACCGC (SEQ ID No. 16).
[0062] The three promoter sequences amplified in step 2) were ligated into the Blunt-GFPT vector using a rapid cloning method to construct three plasmids containing EGFP expression cassettes: Blunt-OsPEF1GFPT, Blunt-OsPTubGFPT, and Blunt-OsPtrpCGFPT. The rapid cloning method requires linearization of the Blunt-GFPT vector, which is achieved through conventional PCR. Reaction system: 6 μL buffer, 2.4 μL 2.5 mM dNTPs, 0.6 μL each of 10 μM primers, 20 ng plasmid Blunt-GFPT. 0.6 μL of DNA polymerase was added, followed by ddH2O to a final volume of 30 μL for amplification. The primer sequences are shown below:
[0063] line-Blunt-EGFPNOS-F: ATGGTGAGCAAGGGCGAGGAG (SEQ ID No. 17).
[0064] line-Blunt-EGFPNOS-R:GAATTCGTAATCATGGTCATAGCTG (SEQ ID No. 18).
[0065] The reaction procedure was as follows: 95℃ pre-denaturation for 2 min, 95℃ denaturation for 20 s, 55℃ annealing for 20 s, 72℃ extension for 2 min, 18 cycles, and a final extension at 72℃ for 5 min. Agarose gel electrophoresis confirmed that the PCR product was a single band, approximately 5000 bp in size, indicating that the linearized plasmid Linear-Blunt-GFPT had been obtained.
[0066] DpnI enzyme was used to ligate the linearized plasmid Linear-Blunt-GFPT to the three Cordyceps sinensis promoters (OsPEF1α, OsPTub, and OsPTrpC) obtained in step 2). The ligation system was: 6 μL Linear-Blunt-GFPT, 3 μL OsPEF1α, OsPTub, or OsPTrpC, and 1 μL DpnI (NEB#R0176). The mixture was incubated at 37°C for 1 hour. 2 μL of the ligation product was then transformed into Escherichia coli DH5α strain using the conventional heat shock method. Colony PCR and sequencing were performed the following day to confirm the successful construction of the recombinant plasmids Blunt-OsPEF1GFPT, Blunt-OsPTubGFPT, and Blunt-OsPTrpCGFPT.
[0067] The three EGFP expression cassettes from plasmids Blunt-OsPEF1GFPT, Blunt-OsPTubGFPT, and Blunt-OsPTrpCGFPT were then integrated into plasmid Blunt-PHygT using a double enzyme digestion method. The double digestion reaction mixture consisted of: EcoRI 2.5 μL, EcoRV 2.5 μL, 10×H buffer 5 μL, plasmid 10 μL, and ddH2O 30 μL. After incubation at 37°C for 2 hours, agarose gel electrophoresis was performed, and the digested products were recovered by gel excision. For T4 ligation, the reaction mixture consisted of: 10× ligation buffer 2 μL, T4 ligase 1 μL, double-digested vector fragment 50 ng, double-digested target fragment 100 ng, and ddH2O added to a final volume of 20 μL. After ligation overnight at 16°C, 2 μL of the ligation product was transformed into *E. coli* DH5α strain using the conventional heat shock method. The following day, colony PCR detection and sequencing confirmed the successful construction of recombinant plasmids Blunt-HygOsPEF1GFPT, Blunt-HygOsPTubGFPT, and Blunt-HygOsPTrpCGFPT.
[0068] Finally, a rapid cloning method was used to replace the Hyg and GFP expression elements in the original pBHt2-GFP with the Hyg and EGFP expression cassettes from the Blunt vector, thus successfully constructing the recombinant plasmids pBHt2-OsPEF1α-GFP, pBHt2-OsPTub-GFP, and pBHt2-OsPTrpC-GFP for Agrobacterium transformation. The primers for linearizing pBHt2-GFP are:
[0069] LinepBHt-F: AAGCTTGGCACTGGCCGTCGTTTTACAAC (SEQ ID No. 19).
[0070] LinepBHt-R:TAAGCGTCAATTTGTTTACACCACAATATATCCTGCC (SEQ ID No. 20).
[0071] The primers for amplifying the Hyg and EGFP expression cassettes in the Blunt vector are:
[0072] HygEGFPBOX-F: AAACAAATTGACGCTTAGACAACTTAATAACACATTGCGGACG (SEQ ID No. 21).
[0073] HygEGFPBOX-R: GCCAGTGCCAAGCTTCCTCTAGATGCATGCTCGAGC (SEQ ID No. 22).
[0074] The PCR reaction and the DpnI enzyme ligation reaction are performed according to the rapid cloning method described above.
[0075] Positive DH5α strains containing recombinant plasmids pBHt2-OsPEF1α-GFP, pBHt2-OsPTub-GFP, and pBHt2-OsPTrpC-GFP were inoculated into 5 mL of LB medium (containing 50 μg / mL kanamycin) and cultured overnight at 37°C and 200 rpm. The three recombinant plasmids pBHt2-OsPEF1α-GFP, pBHt2-OsPTub-GFP, and pBHt2-OsPTrpC-GFP were extracted from 3 mL of the overnight culture using the Kangwei Century Plasmid Extraction Kit (CW0500M) according to its instructions. The remaining bacterial culture was stored at -80°C in 20% glycerol. The three recombinant plasmids constructed contain both the hygromycin resistance gene Hyg, which is suitable for screening positive transformants of Cordyceps sinensis, and the promoter sequences OsPEF1α, OsPTub, or OsPTrpC that constitutively express GFP.
[0076] Step 4) The recombinant plasmids pBHt2-OsPEF1α-GFP, pBHt2-OsPTub-GFP, and pBHt2-OsPTrpC-GFP were transformed into Agrobacterium AGL-1 (purchased from Beijing Bomaide Gene Technology Co., Ltd.):
[0077] The three recombinant plasmids were transformed into Agrobacterium using the conventional freeze-thaw method. For details, please refer to the instruction manual for AGL-1 Agrobacterium competent cells (BC302) from Biomed Biotechnology Co., Ltd.
[0078] Step 5) Agrobacterium-mediated transformation of Cordyceps sinensis:
[0079] Single colonies of AGL-1 containing pBHt2-OsPEF1α-GFP, pBHt2-OsPTub-GFP, or pBHt2-OsPTrpC-GFP plasmids were inoculated into 5 mL of YEB medium (containing 50 μg / mL carbenicillin and 50 μg / mL kanamycin) and cultured overnight at 220 rpm at 28°C. The cells were collected by centrifugation at 5000g for 5 minutes, the supernatant was removed, and the cells were resuspended in an appropriate amount of induction medium (containing 200 μM acetylsyleugenol). The bacterial concentration was adjusted to OD0.05. 660 The concentration was 0.15. The culture was placed at 28°C and incubated on a shaker at 220 rpm for 6 hours until the bacterial concentration reached OD500. 660 Approximately 0.5. During this culture period, a suspension of Cordyceps sinensis spores was prepared.
[0080] Take 20 mL of liquid and culture Cordyceps sinensis for 10 days. Filter the solution using a Miracle Membrane filter (purchased from Merck Millipore) to remove mycelia. Centrifuge the filtrate at 5000g for 5 minutes, remove the supernatant, resuspend the spore precipitate in 1 mL of sterile water, and wash three times. Finally, resuspend the Cordyceps sinensis spores in sterile water and adjust the concentration to 1.0 × 10⁻⁶. 7 per mL.
[0081] Take 100 μL of each of the three induced Agrobacterium cultures and transfer them to three sterile centrifuge tubes. Add 100 μL of the prepared spore suspension to each tube, mix thoroughly, and then spread them onto three co-culture solid media. Co-culture at 20°C in the dark for 72 hours. Add 3 mL of sterile water to each co-culture solid media, wash away excess co-culture material with a spreader, and observe under a microscope for any remaining co-culture material, which will be used for subsequent screening of positive transformants. Then pour the Cordyceps sinensis solid media containing antibiotics (300 μg / mL hygromycin and 300 μg / mL thiazomycin) onto the washed co-culture solid media and incubate at 18°C for 30 days until resistant colonies appear. Transfer the resistant colonies to Cordyceps sinensis culture medium (300 μg / mL hygromycin and 300 μg / mL thiazomycin) with a toothpick and propagate by shaking at 100 rpm at 18°C for 7 days. Fluorescence microscopy revealed that *Cordyceps sinensis* strains transformed with *Agrobacterium* containing the plasmid pBHt2-OsPEF1α-GFP exhibited a distinct green fluorescence signal, while *Cordyceps sinensis* strains transformed with *Agrobacterium* containing either the plasmids pBHt2-OsPTub-GFP or pBHt2-OsPTrpC-GFP showed no green fluorescence signal. Selecting strains of *Cordyceps sinensis* transformed with *Agrobacterium* containing pBHt2-OsPEF1α-GFP that exhibited the strongest green fluorescence signal yielded GFP-labeled *Cordyceps sinensis* strains (such as...). Figure 2 ).
[0082] In this embodiment, the solid culture medium used for co-culture comprises: 10.66 mM potassium dihydrogen phosphate, 11.77 mM dipotassium hydrogen phosphate, 2.03 mM magnesium sulfate, 2.57 mM sodium chloride, 0.45 mM calcium chloride, 9 μM ferrous sulfate, 3.78 mM ammonium sulfate, 5 mM glucose, 0.50% glycerol, 1.50% agar, 40 mM morpholine ethanesulfonic acid, and 200 μM acetylsuccine; each liter of the Cordyceps sinensis solid culture medium contains 200 g potato, 15 g glucose, 10 g peptone, 5 g sodium chloride, 0 mg vitamin B2, 100 mL fetal bovine serum, and 15 g agar; each liter of the Cordyceps sinensis culture broth contains 200 g potato, 15 g glucose, 10 g peptone, 5 g sodium chloride, 0 mg vitamin B2, and 100 mL fetal bovine serum. In this embodiment, screening for positive transformants takes approximately 30 days, and propagation takes approximately 7 days.
[0083] Example 2
[0084] This embodiment screened and determined the culture medium formula for Cordyceps sinensis.
[0085] The slow growth of Cordyceps sinensis fungus has brought many inconveniences to its related scientific research. In order to improve the efficiency of genetic transformation, before carrying out Example 1, the inventors compared different culture media formulations and finally selected the most suitable culture media for the growth of Cordyceps sinensis fungus.
[0086] Take 2 μL of a concentration of 1.0 × 10⁻⁶. 7 A suspension of Cordyceps sinensis spores at a concentration of 1 spore / mL was added dropwise to the center of different solid culture media. After complete absorption of the liquid, the media were inverted and incubated at 18°C. Colony diameters were measured after 60 days. The formulations of the different culture media are shown in Table 1 below.
[0087] Table 1 Comparison of propagation effects of different culture medium formulations
[0088]
[0089] As can be seen from the experimental results in Table 1, after culturing Cordyceps sinensis spores in culture media numbered 3 to 7 for 60 days, the colony diameter obtained was significantly larger than that obtained in culture media numbered 1 and 2, as well as in the commonly used PPDA culture medium. This indicates that adding fetal bovine serum to the culture medium has an unexpected stimulating effect and accelerates the growth of Cordyceps sinensis.
[0090] Example 3
[0091] This example demonstrates the application of GFP-labeled Cordyceps sinensis strains.
[0092] Six hours after infecting small golden pheasant larvae with GFP-labeled Cordyceps sinensis, 5 μL of hemolymph was dropped onto a glass slide, covered with a coverslip, and observed under a fluorescence microscope. The immune attack of the pheasant hemolymph on Cordyceps sinensis, such as cysts and nodules, could be easily observed.
[0093] After GFP-labeled Cordyceps sinensis proliferates within the larvae of the small golden pit moth, it kills the Cordyceps sinensis fungus, forming a mummified worm, i.e., an insect-fungus complex. A suitable amount of mummified worm tissue is taken, placed on a glass slide, a drop of physiological saline is added, a coverslip is placed, and observation is performed under a fluorescence microscope. The Cordyceps sinensis fungus within the mummified worm tissue can be easily observed. Figure 3 . sequence list <110> Institute of Zoology, Chinese Academy of Sciences <120> A recombinant plasmid and genetic marker method for Cordyceps sinensis genetic markers <130> DIC21110095 <160> twenty two <170> SIPOSequenceListing 1.0 <210> 1 <211> 800 <212> DNA <213> Cordyceps sinensis <400> 1 gctcaagttg ggcatgacgg gaccctcgct tttccacccg aaactcgaga cgcaccgatt 60 tttttttggc tccatcgtgg atgcggcttc gaccccactt cgtaggtatc tgctaacaga 120 tgacgtgtac gaagtataca ctgccgttag gaagagcggc ttcggcgcac cgtcgagtca 180 tccgggcagg atgagtactt tcgccgtaga aaaaaacctt ccgctgctgg ctgcggcctc 240 ggcgccccgg gacgagggca gggtcattga aaataggatg agtcgtgtct gtctctcgtg 300 cgcctgcgtt tgggcattgc accagtgact ctcacgacaa caacacaacc ggcccgaaat 360 gcgtcaatct cattggcccg cgtagccctg gtccacccac agacagaggg ggggcggggt 420 aaattcactg cgaggcaggg aaaaatagcg accgaccagg tacctcgggc gtgttagggc 480 ttgcctgcac aaactgcaca aactgctccc accctcctct agttgccccg cgcgagtgcg 540 gcagcagcat gagccactct cgccccaccc tacccaccct ttaaatccct tcctcccacc 600 acagcgtttg cgaatttttc tctttctgct cttcgtctcg catacccggt tcaagcatcc 660 gacctgcgat tttgtcagtt gctcgccttc cgccatcgcc atccacagcg agagcatcgt 720 ctaacgcgcg tcttcgctct gcagttcgat ttcagtcaag caatccacac gaacacttca 780 cctccacaaa cctcgccaag 800 <210> 2 <211> 3638 <212> DNA <213> Ophiocordyceps sinensis <400> 2 ccgaggcgac gaggagtgta cgaattgact tgaagatttg tgaaagtgtc gccatgtgtt 60 atcgagctcc gatgcgggtg caacatctag ggcaacccga ggtcatcctc atcgcagcgc 120 gggcagttgg tgtcacagcc tggatgaaag aaccttttgt ggattcgacg gtgacggaat 180 agtgaattca aggtctgtcc ttacatcaag tatggggcac atttcgttgc cacagtggac agcttgaagg aaggtggaga aggcgccggt aaccacctcg tgggtcccga tgctgtcgca 300 360. tcaaaagcag cgggctgaat gaaacctcgc cgccacggtt ggtagtattg ctttattact cgctactcga tactactact tgattaggcg ccaacgcaca agcaaccccc atcgaggctt ggggtcgcct ccctgcgcac ctcggcgccg taggtttgc gcggccgcct tctttggtat 480 gaacatgctc gacgaggcaa tgtatgaaac ctccctgata tgtatgtaca tatgtacata catacaatcg cacgttcgcc aaggacaaca ggtggccaga cacagaagga gtggggtggg gaggggtgac tcaccaagcg ttttggtagc cagctacagc tccagctggt gcacgaagct gagcggggaga gcttcttctc cccggcccat gcgtaaatca atacaaaaa tacatttgca cgatagtaaa caaaaggcca agcttgcatc accaagcacc cgaatagctg gccactgcgg 840. caattccctc ccatgtcctt tgggctcaag ttggggcatga cgggaccctc gcttttccac ccgaaactcg agacgcaccg attttttttt ggctccatcg tggatgcggc ttcgacccca 900 cttcgtaggt atctgctaac agatgacgtg tacgaagtat acactgccgt taggaagagc 960 ggcttcggcg caccgtcgag tcatccgggc aggatgagta ctttcgccgt agaaaaaaac 1020 cttccgctgc tggctgcggc ctcggcgccc cgggacgagg gcagggtcat tgaaaatagg 1080 atgagtcgtg tctgtctctc gtgcgcctgc gtttgggcat tgcaccagtg actctcacga 1140 caacaacaca accggcccga aatgcgtcaa tctcattggc ccgcgtagcc ctggtccacc 1200 cacagacaga gggggggcgg ggtaaattca ctgcgaggca gggaaaaata gcgaccgacc 1260 aggtacctcg ggcgtgttag ggcttgcctg cacaaactgc acaaactgct cccaccctcc 1320 tctagttgcc ccgcgcgagt gcggcagcag catgagccac tctcgcccca ccctacccac 1380 cctttaaatc ccttcctccc accacagcgt ttgcgaattt ttctctttct gctcttcgtc 1440 tcgcataccc ggttcaagca tccgacctgc gattttgtca gttgctcgcc ttccgccatc 1500 gccatccaca gcgagagcat cgtctaacgc gcgtcttcgc tctgcagttc gatttcagtc 1560 aagcaatcca cacgaacact tcacctccac aaacctcgcc aagatggggt atgtcgcctc 1620 gccctctcca gcggcatcgc ggcagcctcg ccataccatc gccataacat attgactgac 1680 gctatcgtgt agtaaggacg acaagactca catcaatgtg gtcgttatcg tacgtgctcc 1740 ccttcctgct tcagcccgct ttcttgtctc ggcacgcctt actgacttct ctcttctagg 1800 ggtacgtcga atcactcgat tcctgccgcc aactgtttcc gttgtgctaa cactcgggtc 1860 agccacgtcg actccggcaa gtcgaccact gtgagtcttt ccccgtcggc cgcgacttga 1920 acatccggct cgtcctcgtc ctgcccccgc ctgcctcatc gtcagtgcgg ggtattcaga 1980 tgaacatttc tgacatgcaa ttcagaccgg ccacttgatc tacaagtgcg gtggtatcga 2040 caagcgaacc atcgagaagt tcgagaaggt aaatatctag tcatttcgtc tcttccgctc 2100 ttccgtaccc attttcccgc tccccaagtg ccagggcacc ggcgggcatc tattccccct 2160 cacgcgcaat caaaaatttc tcacggcgtg ccttgacctc gggctggtgg ggctctaccc 2220 cgctactctc gccctgctgc caatggcacc cagcagtgac cctcctccag ccccgcaaaa 2280 gaaaacagaa tccgcgctca tgtgacatcg ctaacccgac tcgaattaca ggaagccgcc 2340 gaacttggca agggctcttt caagtatgcg tgggttcttg acaagctcaa ggccgagcgt 2400 gagcgtggta tcaccatcga cattgccctg tggaagtttg agactcccag gtactatgtc 2460 accgtcattg gtaactcaat cctgttgctg ctcctgtccg aatggctccc actgaccatg 2520 gcctcgcaga cgctcccggt caccgtgatt tcatcaagaa catgatcacc ggtacctccc 2580 aggccgattg cgctgtcctt atcatcgctg ccggtactgg tgagttcgag gctggtatct 2640 ccaaggatgg ccagactcgt gagcacgccc tgcttgccta caccctcggt gtgaagcagc 2700 tcatcgttgc tatcaacaag atggacacca ccaagtggtc cgaggctcgc ttccaggaaa 2760 tcatcaagga gacgtccaac ttcatcaaga aggtcggcta caaccccaag accgtcgcct 2820 ttgtccccat ctctggcttc aacggcgaca acatgattga ttcctccccc aactgcccct 2880 ggtacaaggg ctgggagaag gagatcaagt ctggcaaggt cactggcaag accctgctcg 2940 aggccatcga ctccatcgag cctcccaagc gtccctccga caagcccctg cgtctgcccc 3000 tccaggatgt gtacaagatt ggcggtatcg gaacagttcc cgtcggtcgt gtcgagactg 3060 gtgtcatcaa gcccggcatg gtcgtaacct ttgctccggc caacgtcact accgaagtca 3120 agtccgtcga gatgcaccac gagcagctca ccgagggtct tcctggcgac aacgtcggct 3180 tcaacgtgaa gaacgtctcc gtcaaggaga ttcgccgtgg caacgtcgct ggtgactcca 3240 agaacgaccc ccctctgggc gccgcatcct tcaacgctca ggtcatcgtc ctcaaccacc 3300 ccggccaggt cggtgctggt tacgcccccg ttcttgactg ccacaccgcc cacattgcct 3360 gcaagttctc cgagctcctg gagaagatcg accgccgtac cggcaaggct gtcgagactt 3420 cccccaagtt catcaagtct ggtgatgccg ccatcgtcaa gatggttccc tccaagccca 3480 tgtgcgttga ggctttcacc gactaccctc ctctgggccg cttcgccgtc cgcgacatgc 3540 gccagaccgt cgccgttggt gtcatcaagt ctgtcgagaa ggctgctgcc agctctggca 3600 aggtcaccaa gtccgccgcc aaggctgtca agaaataa 3638 <210> 3 <211> 3482 <212> DNA <213> Ophiocordyceps sinensis <400> 3 tgcgcttgcg cgtgccctgt tctgcgagcc cgaccttttg ctactcgacg aaccgtccaa 60 catgttggac gttccttcaa tcacctttct ttccggatac ctgcaaagct accctagtac 120 tctcctcgtc gtctctcacg acagggcctt tctcaacgaa gtggctacag acattatcca 180 ccagcactcg gagcgcctcg actactaccg tggagccaac tttgactcct tctactccac 240 gcgcgaagag cgcaaaaagg ttgccaagag agagtacgag aaccagatgg cccagcgtgc 300 ccacctgcag gcctttatcg acaagtttcg ctacaacgcg gccaagtcct ccgaggccca 360 gtcgcgcatc aaaaagttgg agaaaatgcc ggtgctggac gcgccagagt cagagtacag 420 cgtcaagttt cggtttcccg aagtggagaa gctgtcccct cccatcattc aaatgtccga 480 ggtggatttt ggctactcca aggacaagcc gctgctaaga aacgtggact tggacgtcca 540 gttagactcc cgcatcggca tcgtcgggcc caacggtgcg ggtaagacga caattttgaa 600 gctccttact ggcaggctgg agccgttcaa aggaatcgtc acggcgaatg cccgactgcg 660 gattggcttc tttgcgcagc accacgtcga cgcgctcgat ctgacaatga gttcagtgag 720 tttcatggcc aaaatgtatc ctggccgcac cgacgaggaa taccgacggc agctcggcgc 780 ctttggcatc acgggcacca cgggcctgca gaagatgggt cagctctcgg gtggtcagaa 840 gtcaagggtc gcgtttgctt gcctggccct cacgaacccg cacattttgg tgctcgacga 900 gccttcgaat catctcgaca ttgaggccat ggacgccctg gcggaggcgc tcaccgagtt 960 ccagggcggt gtgctcatgg tgtcccacga cgtcaccatg ctgcagatgg tgtgcacatc 1020 gctgtgggta tgcgacggcg gaatagttga gaagtttccg ggcgatgtgc agcagtacaa 1080 gaagaggatc gcggcgcagg cagacgcggc tggtgtagtc aaagctcatt agcagcccgg 1140 agacaaggga tccggggaga catatccatc cattgtgtag cgaatggaaa tggcgtgtcc 1200 tcagccgccg tggtggtgag tgctgagatg cccgtcgagg tgatcccgcg cggactctcc 1260 tatctgtttc cttctctttt caaagcttca tgcgccgaag atatctcgcg cttctgcccc 1320 ttgttgggcg gtaacgcgcc ggaaacaccg cgacgtcccg gccaaaacac cttctcctcg 1380 cgtcaagagg gaaatactta tttcgatagc atgaggatcg ggcccgtaac acttgtactc 1440 ggatcttcac accgggtcga ggttgatgga agcaaccgct cacccaactg gcttacgtaa 1500 ttcccagcct ggcaaatgaa ttgcaatgca ggcgagagga gttgtctctt gccgccccgg 1560 cggtgaagag gtatgtatgt acctgatctc ctgcaggagt gtccaacaaa aatccacctc 1620 tcacttctct caccacaaca cacactatca ccaccctcgc atcgcgaagc tccccttggc 1680 cctcgcgatc tcgcccgatt ccctcttccg ctcagtacgc ctcttcgacg atagccttca 1740 tccgtcaaca tgcgcgaaat tgtgagtctc cctctttctc cccggcaagc tcaattcgcg 1800 cgacgcgtct cgaccaccca agatgcccct gatgatgtgt gccccaccaa aaacattgca 1860 ctcccatttc ggcccaactt gaggagcacg cagatacaag cgacctgctg tcgacgacca 1920 gcctgctgac cgagactctt tgaacgacta taggttcatc ttcagaccgg ccagtgcgta 1980 agtaactgcc ctccaccgcg atggccacac gtgtttcccg gaggctcaac agtcgtctgc 2040 agggcaacca aatcggtgct gcgttctggc agaccatctc tggcgagcat ggcctcgaca 2100 gcaatggtgt ctacaacggc acttcggagc ttcagctcga gcgcatgagc gtatacttca 2160 atgaggttcg tctcgccatg tgtgccctgc ttgggaaacc catccgccaa agcccaacta 2220 accgtattgg ctggtgaata ggcctcagga aacaaatatg tcccccgcgc tgtccttgtc 2280 gatctcgagc ccggcaccat ggacgccgtt cgtgccggtc cctttggtca gctgttccgc 2340 ccggataact tcgttttcgg ccagtccggt gctggcaaca actgggccaa gggccactac 2400 actgagggtg ccgagctggt cgaccaggtc ctcgacgtcg ttcgtcgcga ggctgagggc 2460 tgcgactgcc tgcagggctt ccagatcacc cactccctgg gtggcggcac tggtgctggt 2520 atgggtacct tgctcatttc caagatccgc gaggagttcc ccgaccgcat gatggccacc 2580 ttttctgtcg tgccctcccc caaggtctcc gacaccgtcg tcgagcccta caacgccacc 2640 ctctccgtcc accagcttgt ggagaactcg gacgagacgt tctgcatcga caacgaggcc 2700 ctctatgata tctgcatgcg taccctgaag ctgtccagcc cctcgtacgg tgacctaaac 2760 cacctcgtct cggctgttat gtcgggcgtc acgacctgcc tgcgattccc gggtcagctc 2820 aactcggatc tccgcaagct cgccgtcaac atggttccct tccctcgtct tcatttcttc 2880 atggtcggct tcgcgcccct gaccagccgt ggcgcccact ctttccgcgc cgtcagcgtg 2940 cccgagttga cgcagcaaat gttcgacccc aagaacatga tggctgcctc cgatttccgg 3000 aacggccgct acctgacttg ctctgccatt ttgtatgtgt tcctgactat gctgtcggcc 3060 ttgagacttg gactaacatg cattgcagcc gtggcaaggt cgccatgaag gaggtcgagg 3120 accagatgcg caacgtgcag aacaaaaatg caacgtactt tgttgaatgg attcccaata 3180 atatccagac agccctttgc gctatccctc cccgtggcct caagatgtcg tccaccttta 3240 tcggcaactc gacctctatc caggagctct ttaagcgtgt tggtgagcag ttcactgcca 3300 tgttccgtcg caaggctttc ttgcattggt acacgggcga gggcatggat gagatggagt 3360 tcaccgaggc cgagtctaac atgaacgact tggtctccga gtaccagcag taccaggatg 3420 ctggtatcga cgatgagccg gaggagtacg acgaggagca ggctcccgag gccgaggaat 3480 ag 3482 <210> 4 <211> 3350 <212> DNA <213> Ophiocordyceps sinensis <400> 4 cggcaatctc gtccgagtcg agggccgacg atgcgcccag gtccgatagg aaagatgcgc 60 cttgaccatt ttgaaggccg gcggcttctt gtagatttgc ggcgtcctga gaggagagcg 120 ggcccataag atgcctgaaa gggcgcgact gggcctcgac aatgacgacc cgcagcgcag 180 cgacggggtt aatctttgcg ttttgactga gccattccgc atctgccttg aaggtcttga 240 catcgtggtc cgaggccgag gtcacgttga cgggagccgt cttggtctca aagtcctttt 300 ggaaggcgtc gttgggcggc gcaaacacgg ccgaagggtc tctgagcaaa gaatgaacgt 360 gttcatctgc gaggaaaccg accacagctg ggcacgtctg tcgttggccg gattggtccg 420 aaagcgcggt cgcgatgtga gtccaggagc taaagggaag tcagtcgcaa gcatctcaat 480 ggaggggaga aggctcacag aagcacgcgc tccccggaca agcacccctc cagcgggggg 540 aaataagtgc tatccgacac cggcgccatg gccgcgagcg tcagtcaagg ggtgacggca 600 ggcgcatccc ttggcggggg ggttggcgca ggtgaggatg aggatgttgg tgttgacgcg 660 cttgagcagc agcatttgtc cgtcgagcta cgaatacact cctcactgtc tgggactttt 720 tccttaggcc cgagcttcgt tggaccgatg tttagccagc taagccgttc cccggcagtt 780 gatggaagcg ctgcactgtg catacgcacg gtacatgacg ccctgttcat cgtgcgacga 840 cacagtacgc cgggttatct atcggtgccc gcagattctc aatggcctcg agtcagtcac 900 gtctggcgaa gcgagcgttt cccttgcatt ctatctcggc ggcgccgtgt tcctgtatca 960 gtgcacacat caatcaagac attgtcggaa gtctttgaaa atgccgtcgg ctctcggaat 1020 catcgatcac tctccccatc agcccgaacc ctcccccccc attccaacag cctccaacct 1080 cgttctcatc gacaactacg actcctttac ctggaacatc taccagtatc tcgttctcga 1140 gggagccacc gtccatgtat tccgcaacga ccagatcagc ctcgaggagc tcatccagaa 1200 gaaccctacc cagctcatca tcagcccagg cccggggcac cccgcaaccg actcgggcat 1260 cagtcgagat gccattcgtc attttgccgg caaggtcccc atctttggtg tttgcatggg 1320 cctgtgagtc tctatagagg tggtgtccct ccctgtactg gtctgtctgg ctcacgcttg 1380 ccagacaatg catgtttgat gtctatggcg gagatgtcaa ctcggctggc gagtggcttc 1440 acggcaagac gtcccctttg gtacatgact ccaagggcgt ctttgccgac ctcgagcaga 1500 atctcccagt gacgaggtat cattccctgg cgggaaccca cgtcaccctg cccgagtgcc 1560 ttgaaatcac ctcgtgggtg gccaacgcgg acggctcgcc cggcatcatc caaggcattc 1620 gtcacaagac gtttgccatg gagggagtgc agtttcaccc tgagagcata ctgacagccc 1680 acggccgcaa gatgattaaa aatttcctgc ttatgcaggg tggcacctgg gaggaaaact 1740 ctcagctgca gagggcggcg tcggccaagg acgctgccgc tgcgccggcg aagcccaagg 1800 gcaacaacat ccttgagcga atctatgcta gccgaagggc tgctgttgcg attcagaaag 1860 agatcccttc ccagagaatg gccgacctgc aggctgccta cgatcttaac gccgcccctc 1920 ctctggtccc gctcgtcagt cgcctgcgcc aaacaccatt cgacgtggct ctcatggccg 1980 agatcaagcg tgcctctcct tccaaaggcg tctttgctct cgacatcaat gcgcccactc 2040 aagcacgcac gtatgcactg gcgggcgcca gcgtcatctc ggttctcacg gagccagagt 2100 ggttcaaggg aagtctcgac gacttgcgag ccgtgcggca ggtcctggac ggaatgccaa 2160 acaggcccgt cgttttgcgc aaggacttca tctttgacga gtaccagatc ctcgaggcga 2220 gactagcggg cgccgacacg attctgctga ttgtcaagat gctgcatctc gagctgctcg 2280 aacggctgta caagtactcg ctctcgctgg gcatggagcc actggtggag gttcaaaacg 2340 ccgaggagat gacgacggcc gtgaagctgg gcgccagggt tatcggggtg aacaaccgga 2400 acctggaaaa tttcgaggta gacctggaca cgacgggccg gctgaggcgc atggtgcccg 2460 aaaacacgct catctgcgct ctcagcggca tcaacaccca cgacgacgtg ctgatgaaca 2520 aaaatgacgg ggtcaacgcc gtgctcgtgg gagaggcaat tatgcgcgcg ccaaacgcgg 2580 gcgtcttcat cagcgagctc tgcgcgggct cgaagccggt ggccgacaag ccgccgccgc 2640 gacggctcta cgtcaagatt tgcgggactc ggtcggtcga agccgcccaa gaagccgtca 2700 agtcaaaggc cgactttgtg ggcatttgcc tggtgcgtgg cgccaagcgc tgcgtcactc 2760 acgagacggc gctggcaata tccaacgcgt tgcattcgca acctggacgt ctcgaggcca 2820 gagctgagtg ccaattgtcc agcagctgcg ccacggacta ctttacagcc gccgcttcac 2880 ggcttctgag ctcacggacc cgcctggtgg gcatcttcca gaaccagccc ctggcagacg 2940 tgttggaaat gcagaggctc tacgacctag atctcgtcca gctgcacggt gacgagccgg 3000 ttgagtgggc cagggtcatc ccggtgcccg tcatccggtg cttcaaaccc ggccaggtcg 3060 ggctcgggct gcgcggttac cacacgatac cgctgctcga ctcggggtcc ggctcgggca 3120 aactgctcga cgtgtcgagc gtcaaggctg cgctggagaa ggatgcccac ctccgagtct 3180 tcttcgccgg cggcctgagc ccggacaacg tggccgaggc ggtcgatgcc ctaggcgggc 3240 tgagcgctcg ggtcctcggg gtcgacgtga gcagcggtgt cgaggaggac ggggagcaga 3300 gtctgagcaa gattgctgct tttgtcgagg ctgcgaagag catcagatag 3350 <210> 5 <211> 868 <212> DNA <213> Ophiocordyceps sinensis <400> 5 cagcccggag acaagggatc cggggagaca tatccatcca ttgtgtagcg aatggaaatg 60 gcgtgtcctc agccgccgtg gtggtgagtg ctgagatgcc cgtcgaggtg atcccgcgcg 120 gactctccta tctgtttcct tctcttttca aagcttcatg cgccgaagat atctcgcgct 180 tctgcccctt gttgggcggt aacgcgccgg aaacaccgcg acgtcccggc caaaacacct 240 tctcctcgcg tcaagaggga aatacttatt tcgatagcat gaggatcggg cccgtaacac 300 ttgtactcgg atcttcacac cgggtcgagg ttgatggaag caaccgctca cccaactggc 360 ttacgtaatt cccagcctgg caaatgaatt gcaatgcagg cgagaggagt tgtctcttgc 420 cgccccggcg gtgaagaggt atgtatgtac ctgatctcct gcaggagtgt ccaacaaaaa 480 tccacctctc acttctctca ccacaacaca cactatcacc accctcgcat cgcgaagctc 540 cccttggccc tcgcgatctc gcccgattcc ctcttccgct cagtacgcct cttcgacgat 600 agccttcatc cgtcaacatg cgcgaaattg tgagtctccc tctttctccc cggcaagctc 660 aattcgcgcg acgcgtctcg accacccaag atgcccctga tgatgtgtgc cccaccaaaa 720 acattgcact cccatttcgg cccaacttga ggagcacgca gatacaagcg acctgctgtc 780 gacgaccagc ctgctgaccg agactctttg aacgactata ggttcatctt cagaccggcc 840 agtgcgtaag taactgccct ccaccgcg 868 <210> 6 <211> 431 <212> DNA <213> Ophiocordyceps sinensis <400> 6 ggccgcgagc gtcagtcaag gggtgacggc aggcgcatcc cttggcgggg gggttggcgc 60 aggtgaggat gaggatgttg gtgttgacgc gcttgagcag cagcatttgt ccgtcgagct 120 acgaatacac tcctcactgt ctgggacttt ttccttaggc ccgagcttcg ttggaccgat 180 gtttagccag ctaagccgtt ccccggcagt tgatggaagc gctgcactgt gcatacgcac 240 ggtacatgac gccctgttca tcgtgcgacg acacagtacg ccgggttatc tatcggtgcc 300 cgcagattct caatggcctc gagtcagtca cgtctggcga agcgagcgtt tcccttgcat 360 tctatctcgg cggcgccgtg ttcctgtatc agtgcacaca tcaatcaaga cattgtcgga 420 agtctttgaa a 431 <210> 7 <211> 42 <212> DNA <213> Artificial Sequence <400> 7 accatgatta cgaattcgct caagttgggc atgacgggac cc 42 <210> 8 <211> 42 <212> DNA <213> Artificial Sequence <400> 8 tcgcccttgc tcaccatctt ggcgaggttt gtggaggtga ag 42 <210> 9 <211> 42 <212> DNA <213> Artificial Sequence <400> 9 accatgatta cgaattccag cccggagaca agggatccgg gg 42 <210> 10 <211> 40 <212> DNA <213> Artificial Sequence <400> 10 gcccttgctc accatcgcgg tggagggcag ttacttacgc 40 <210> 11 <211> 40 <212> DNA <213> Artificial Sequence <400> 11 catgattacg aattcggccg cgagcgtcag tcaaggggtg 40 <210> 12 <211> 40 <212> DNA <213> Artificial Sequence <400> 12 tcgcccttgc tcaccatttt caaagacttc cgacaatgtc 40 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <400> 13 gaattcgtaa tcatggtcat agctg 25 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <400> 14 gacaacttaa taacacattg cggac 25 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <400> 15 atggtgagca agggcgagg 19 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <400> 16 gatctagtaa catagatgac accgc 25 <210> 17 <211> twenty one <212> DNA <213> Artificial Sequence <400> 17 atggtgagca agggcgagga g 21 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <400> 18 gaattcgtaa tcatggtcat agctg 25 <210> 19 <211> 29 <212> DNA <213> Artificial Sequence <400> 19 aagcttggca ctggccgtcg ttttacaac 29 <210> 20 <211> 37 <212> DNA <213> Artificial Sequence <400> 20 taagcgtcaa tttgtttaca ccacaatata tcctgcc 37 <210> twenty one <211> 43 <212> DNA <213> Artificial Sequence <400> twenty one aaacaaattg acgcttagac aacttaataa cacattgcgg acg 43 <210> twenty two <211> 36 <212> DNA <213> Artificial Sequence <400> twenty two gccagtgcca agcttcctct agatgcatgc tcgagc 36
Claims
1. A method for use with Cordyceps sinensis (Cordyceps sinensis) Ophiocordyceps sinensis A recombinant plasmid containing a genetic marker comprising a constitutive green fluorescent protein (GFP) promoter sequence operatively linked to a green fluorescent protein coding sequence, wherein the Cordyceps sinensis promoter sequence is the Cordyceps sinensis EF1α promoter sequence, as shown in SEQ ID No.
1.
2. The recombinant plasmid according to claim 1, wherein the recombinant plasmid further comprises an antibiotic resistance selection gene sequence.
3. The recombinant plasmid according to claim 2, wherein the antibiotic resistance selection gene is a hygromycin resistance gene or a benomyl resistance gene.
4. An Agrobacterium for genetic markers in Cordyceps sinensis ( Agrobacterium ( ) strain, which contains the recombinant plasmid according to any one of claims 1 to 3.
5. The Agrobacterium strain according to claim 4, wherein the recombinant plasmid is transformed into the Agrobacterium strain using a freeze-thaw method.
6. A genetic marker method for Cordyceps sinensis, comprising the following steps: The Agrobacterium strain described in claim 4 or 5 is co-cultured with Cordyceps sinensis to screen for positive transformants.
7. The genetic marker method according to claim 6, comprising co-culturing Agrobacterium strain and Cordyceps sinensis at 16-22°C on a solid culture medium for co-culture for 48-96 hours, screening the co-culture with Cordyceps sinensis solid culture medium containing antibiotics, and obtaining resistant colonies by culturing at 16-22°C for 25-35 days.
8. The genetic marker method according to claim 7, wherein the Agrobacterium strain and Cordyceps sinensis are co-cultured at 20°C in the dark for 48-96 hours.
9. The genetic marker method according to claim 7, wherein each liter of the Cordyceps sinensis solid culture medium contains 100-200 g of potato, 10-20 g of glucose, 5-10 g of peptone, 1-5 g of sodium chloride, 20-100 mg of vitamin B2, 10-100 mL of fetal bovine serum and 15 g of agar.
10. The genetic marker method according to claim 6, wherein, The genetic marker method also includes propagating the obtained resistant colonies in Cordyceps sinensis culture medium.
11. The genetic marker method according to claim 10, wherein each liter of the Cordyceps sinensis culture medium contains 100-200 g of potato, 10-20 g of glucose, 5-10 g of peptone, 1-5 g of sodium chloride, 0-100 mg of vitamin B2 and 10-100 mL of fetal bovine serum.
12. The genetic marker method according to claim 10, further comprising detecting the green fluorescence signal of the positive transformants obtained by propagation using a fluorescence microscope.
13. The genetic marker method according to claim 6, wherein, Prior to the co-culture, the Agrobacterium was induced with acetylsyleugenone for 5-7 hours to OD. 660 The concentration is 0.3-0.5; and / or the Cordyceps sinensis fungus is a Cordyceps sinensis spore.
14. The genetic marker method according to claim 13, wherein the concentration of Cordyceps sinensis spores is 1.0 × 10⁻⁶. 7 per mL.