SNP molecular marker related to plum-blossom single-petal single pistil or double-petal multiple pistil trait and application

Abstract

The present application relates to the technical field of plant molecular biology, and particularly relates to a SNP molecular marker related to plum flower single petal single pistil or multi-petal multi-pistil traits and application. The SNP molecular marker is simultaneously closely linked to plum petal quantity and pistil quantity traits, early identification of plum flower single petal single pistil and multi-petal multi-pistil traits can be realized by using the SNP molecular marker, and single petal single pistil and multi-petal multi-pistil plum varieties can be quickly, accurately and efficiently identified in the plum seedling stage. When used for assisted breeding, the screening period of high-quality plum can be shortened, the breeding workload can be reduced, and the present application has a broad application prospect.

Description

Technical Field

[0001] This invention relates to the field of plant molecular biology, and in particular to SNP molecular markers and their applications related to the single-petaled single-pistil or double-petaled multi-pistil trait of plum blossoms. Background Technology

[0002] plum bossom( Prunus mume It belongs to the genus *Prunus* in the family Rosaceae. Among the many ornamental traits of plum blossoms, flower shape variation is one of the most crucial and desirable traits, with the combination of double petals and multiple pistils being particularly prominent. Therefore, breeding new double-petaled plum varieties with multiple pistils that possess both excellent ornamental traits and high economic value is an important breeding objective.

[0003] The origin of double-petaled, multi-spiky plum blossoms is usually related to natural variation and artificial selection. Natural variation may lead to an increase in the number of petals and pistils. However, traditional hybridization breeding methods are time-consuming, costly, and slow to yield results, resulting in low breeding efficiency. Furthermore, the varieties bred cannot meet the market's demand for plum blossom variety diversity. The emergence of molecular markers has provided a new breeding approach for plum blossoms. Developing molecular markers that are closely linked to and stable with target traits can greatly shorten the breeding cycle and significantly improve breeding efficiency.

[0004] In their paper "A Gene Controlling Single and Double Petal Traits in Plum Blossoms and Its Molecular Marker and Application," Zheng Tangchun et al. discovered a gene that regulates single and double petal traits in plum blossoms. PmAP2-like The genes were identified and related InDel molecular markers were applied in 20 plum blossom varieties. In their paper "InDel molecular markers, primers and their applications for the identification of single and double petal traits in plum blossoms", Zhang Jie et al. identified two InDel molecular markers on chromosome 1 of plum blossoms and applied them in 69 plum blossom varieties.

[0005] These studies on plum blossom flower types have only focused on the single-petal and double-petal characteristics of plum blossoms, and there are still no reports on molecular markers related to the number of petals and the number of pistils. Therefore, developing molecular markers linked to the number of plum blossom petals and the number of pistils has become a pressing technical challenge in this field. Summary of the Invention

[0006] To address the aforementioned technical challenges, this invention provides an SNP molecular marker associated with the single-petaled, single-pistil or double-petaled, multi-pistil phenotype of plum blossoms. This marker is characterized by a C or G polymorphism at position 255 of the nucleotide sequence shown in SEQ ID NO.1. When the genotype of the SNP site is CC, the phenotype is single-petaled, single-pistil; when the genotype of the SNP site is CG or GG, the phenotype is double-petaled, multi-pistil.

[0007] SEQ ID NO.1:

[0008] CTGTGGCTTCTTCAATTTATTTGGAGCTTTGGCATGCTTGTGCTGGTCCACTCATCTCACTGCCCAAGAAAGGGAATGTGATTGTCTACTTCCCACAAGGTCACTTGGAACAAGTTGCCTCATCCTCTCCTTTCTCTTCCATGGAGATGCCCACC TTTGATCCCAGCCACAGATCTTCTGCAAGGTTGTGAATGTCCAGCTACTTGCTAACAAGGAAAATGACGAGGTCTATACGCATGTCACTTTGCTTCCT[C / G]AGCCAGAGCCTGAGTTGGTAGGAACAAATTCAGACGGCAAAGAGCTTGAAG

[0009] Furthermore, the present invention provides primers for amplifying the SNP molecular marker.

[0010] Preferably, the primers are those shown in SEQ ID NO.2 and SEQ ID NO.3.

[0011] SEQ ID NO.2 (upstream primer F, 5' to 3' orientation):

[0012] CTGTGGCTTCTTCAATTTATTTGGAGC;

[0013] SEQ ID NO.3 (downstream primer R, 5' to 3' orientation):

[0014] CTTCAAGCTCTTTGCCGTCTGAATTTGTTCCTACCAACTCAGGCTCTGACT.

[0015] Furthermore, the present invention provides a kit containing the primers.

[0016] Preferably, the kit is a PCR kit.

[0017] Preferably, the PCR kit contains the primers shown in SEQ ID NO.2 and SEQ ID NO.3, DNA polymerase (e.g., Taq polymerase), dNTPs, and Mg. 2+ and buffering substances.

[0018] Preferably, the kit also includes Hinf I enzyme.

[0019] Furthermore, the present invention provides the application of the SNP molecular marker, the primer, or the kit in at least one of the following aspects:

[0020] (1) Identify the characteristics of plum blossoms: single-petaled with a single pistil or double-petaled with multiple pistils;

[0021] (2) Marker-assisted breeding of plum blossoms with single petals and single pistil or double petals and multiple pistils;

[0022] (3) Develop dCAPS molecular markers to identify the traits of single-petaled single-pistil or double-petaled multi-pistiled plum blossoms.

[0023] Furthermore, the present invention provides a method for identifying single-petaled single-pistil or double-petaled multi-pistiled plum blossoms, comprising: detecting the genotype of the SNP molecular marker; when the genotype of the SNP locus is CC, the phenotype is single-petaled single-pistil; when the genotype of the SNP locus is CG or GG, the phenotype is double-petaled multi-pistiled.

[0024] Preferably, the cDNA obtained by reverse transcription of total RNA from the plum blossom to be tested is used as a template, and PCR amplification is performed using the primers shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain the PCR amplification product.

[0025] Preferably, the size of the PCR amplification product is 306 bp.

[0026] Preferably, the PCR amplification product is digested with Hinf I enzyme, and the digested product is subjected to agarose gel electrophoresis. The electrophoresis results are used to determine whether the plum blossom to be tested is single-petaled with a single pistil or double-petaled with multiple pistils. The determination method is as follows:

[0027] If the enzyme digestion product contains only a 306bp main band, the plum blossom to be tested is a single-petaled, single-pistil variety; if the enzyme digestion product contains only a 255bp main band, the plum blossom to be tested is a homozygous double-petaled, multi-pistil variety; if the enzyme digestion product contains both 306bp and 255bp main bands, the plum blossom to be tested is a heterozygous double-petaled, multi-pistil variety.

[0028] Preferably, the PCR amplification reaction program includes: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 15 s, 30 cycles; 72℃ final extension for 5 min.

[0029] Preferably, the PCR amplification reaction system comprises: 4 μL of DNA template solution, 25 μL of Taq Mix, 2 μL each of forward and reverse primers, with a concentration of 10 μM / L, and the total volume is brought up to 50 μL with 17 μL of ddH2O.

[0030] Preferably, the agarose gel electrophoresis uses a 3% agarose gel.

[0031] Preferably, the enzyme digestion reaction system comprises: 1 μL Hinf I enzyme, 2 μL 10× FastDigest Green Buffer, ≤1 μg PCR amplification product, and ddH2O to bring the total volume to 30 μL.

[0032] Preferably, the enzyme digestion reaction conditions include: enzyme digestion at 37°C for 1 hour.

[0033] The above detection methods can be performed using conventional PCR and agarose gel electrophoresis, and have the advantages of being simple, fast, and low-cost.

[0034] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0035] This invention provides a SNP molecular marker associated with the single-petaled, single-pistil or double-petaled, multi-pistil trait in plum blossoms. This molecular marker is closely linked to both the number of petals and the number of pistils in plum blossoms. Using this molecular marker, the single-petaled, single-pistil and double-petaled, multi-pistil traits in plum blossoms can be identified at an early stage. It allows for rapid, accurate, and efficient identification of single-petaled, single-pistil and double-petaled, multi-pistil varieties of plum blossoms during the seedling stage. When used in breeding assistance, it can shorten the screening cycle for high-quality plum blossoms and reduce the workload of breeding, showing broad application prospects. Attached Figure Description

[0036] Figure 1 Genetic mapping of the SNP locus (Chr1:6199559_C / G).

[0037] Figure 2 This includes single-petaled, single-pistil plum blossom varieties, double-petaled, multi-pistil plum blossom varieties, hybrid offspring of single-petaled, single-pistil, and hybrid offspring of double-petaled, multi-pistil varieties. PmARF1 The sequence alignment results of the SNP site (Chr1:6199559_C / G) on the gene.

[0038] Figure 3 Electrophoresis images of 24 plum blossom resources amplification.

[0039] Figure 4 Electrophoresis images of 22 F1 generation single-petaled single-pistil individuals.

[0040] Figure 5 Electrophoresis images of 22 F1 generation double-petaled multi-pistil individuals.

[0041] Figure 6 Electrophoresis images of enzyme fragments obtained from 24 plum blossom resources after detection by dCAPS molecular markers.

[0042] Figure 7 Electrophoresis image of enzyme fragments obtained from F1 generation individuals by dCAPS molecular marker detection. Detailed Implementation

[0043] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0044] The plant materials used in the embodiments of this specification may be provided to the public by the applicant, but are only for verifying the present invention and may not be used for other purposes. Those skilled in the art may also use other materials to conduct verification experiments; the following embodiments are merely examples.

[0045] In the embodiments provided in this specification, unless specific techniques or conditions are specified, the techniques or conditions described in the literature in this field, or the product instructions, shall be followed. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased from legitimate channels.

[0046] This invention relates to molecular biology experiments. Unless otherwise specified, reference can be made to the book *Molecular Cloning* (J. Sambrook, E.F. Fritsch, and T. Maniatis, Science Press, 1994). This book and its subsequent editions are the most commonly used and guiding reference books for those skilled in the art when performing experiments related to molecular biology. In addition, depending on the experimental purpose, those skilled in the art may conduct the corresponding experiments under the guidance of the operating manuals accompanying various commercially available kits or entrust them to specialized companies.

[0047] Example 1: Screening and identification of SNP molecular markers related to the traits of single-petaled single-pistil or double-petaled multi-pistiled plum blossoms

[0048] Using the F1 population constructed from a cross between 'six-petal' plum and 'yellow-green calyx' plum as experimental material, QTL mapping data related to plum flower morphology were analyzed. A GWAS analysis was performed in conjunction with resequencing data from 348 plum varieties. The results showed... PmARF1 Genes are strongly associated with the formation of single-petaled single-pistil / double-petaled multi-pistil phenotypes in plum blossoms, therefore... PmARF1 It was identified as a candidate gene associated with the single-petaled, single-pistil / double-petaled, multi-pistil trait of plum blossoms. PmARF1 One SNP locus (Chr1:6199559_C / G) significantly associated with the single-petaled, single-pistil or double-petaled, multi-pistiled trait of plum blossoms was identified in the coding region of the gene. Figure 1The nucleotide sequences of single-petaled, single-pistil plum blossom varieties and double-petaled, multi-pistil plum blossom varieties were compared using DNAMAN software to verify the SNP sites. It was found that when the non-synonymous SNP site was a C base, the amplified fragment could not be digested by Hinf I enzyme, while when the SNP site was mutated to a G base, the amplified fragment could be digested by Hinf I enzyme.

[0049] Example 2: Verification of SNP molecular marker polymorphism and its association with single-petaled single-pistil or double-petaled multi-pistil traits

[0050] 1. Plum blossom materials used for testing

[0051] Leaves from 25 plum blossom varieties were collected from Beijing Forestry University, Beijing Jiufeng National Forest Park, and Yunnan Heilongtan Plum Garden, including 11 single-petaled varieties with single pistils and 14 double-petaled varieties with multiple pistils (Table 1). Leaves from 44 hybrid offspring were collected from the F1 population constructed by hybridizing 'Liuban Dan' plum and 'Sanlun Yudie' plum as parents, including 22 single-petaled varieties with single pistils and 22 double-petaled varieties with multiple pistils. After being fixed with liquid nitrogen, the samples were stored at -80℃.

[0052] Table 1 Information on 25 Plum Blossom Varieties

[0053]

[0054] 2. Verification of SNP molecular marker polymorphism and its association with single-petaled single-pistil or double-petaled multi-pistil traits.

[0055] (1) Extracting DNA from plum blossom samples

[0056] RNA was extracted from 69 plum blossom leaves using the OmniPlant RNA Kit (DNase Ⅰ) (Jiangsu Kangwei Century Biotechnology Co., Ltd.), and the extracted RNA was reverse transcribed into cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Nanjing Novizan Biotechnology Co., Ltd.).

[0057] (2) Using the above cDNA as a template, PCR amplification was performed using the specific primer pairs shown in SEQ ID NO.4 and SEQ ID NO.5;

[0058] SEQ ID NO.4, F: 5'-CACCTTTGATCTCCAGCCACAG-3';

[0059] SEQ ID NO.5, R: 5'-ACCAACTCAGGCTCTGGCT-3';

[0060] The 50 μL PCR amplification reaction system includes: 4 μL cDNA template solution, 25 μL Taq Mix, 2 μL each of forward and reverse primers at a concentration of 10 μM / L, and 17 μL ddH2O.

[0061] PCR amplification reaction program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 15 s, 30 cycles; 72℃ final extension for 5 min.

[0062] (3) Sequencing experiments were performed on the above PCR products to obtain the target sequence, and DNAMAN software was used to analyze the sequence. PmARF1 Sequence alignment is performed at SNP molecular markers on the gene.

[0063] 3. Results Analysis

[0064] Figure 2 The images show single-petaled, single-pistil plum blossom varieties, double-petaled, multi-pistil plum blossom varieties, hybrid offspring of single-petaled, single-pistil, and hybrid offspring of double-petaled, multi-pistil. PmARF1 Sequence alignment of the SNP locus (Chr1:6199559_C / G) on the gene showed that the base at this SNP locus was C in single-petaled, single-pistil plum varieties and their hybrid offspring. In double-petaled, multi-pistil plum varieties, the base at this SNP locus showed both G+C and G combinations. In the hybrid offspring of double-petaled, multi-pistil plum varieties, the base at this SNP locus was G+C. Therefore, this SNP molecular marker can be used to further develop dCAPS molecular markers for use in assisted breeding of single-petaled, single-pistil or double-petaled, multi-pistil plum varieties.

[0065] Example 3: Transformation of gene SNP sites into dCAPS molecular markers and related primers

[0066] The restriction endonuclease Hinf I was selected for digestion. Mismatched bases were introduced by designing primers to construct the recognition site of the restriction endonuclease, with a sequence length of 306 bp. The nucleotide sequence of the dCAPS molecular marker located at the Hinf I digestion site is shown in SEQ ID NO.1. Primers for the dCAPS molecular marker were designed using SnapGene software. The markers and primer information used in the localization process are shown in Table 2.

[0067] Table 2. Information on dCAPS molecular markers and primer sequences related to site Chr1:6199559_C / G.

[0068]

[0069] In the dCAPS molecular marker sequence (SEQ ID NO.1), the underlined part is the Hinf I restriction site, N is the SNP site (Chr1:6199559_C / G), and the bolded base C will introduce the mismatched base T when designing primers.

[0070] Example 4: Verification of dCAPS molecular marker restriction enzyme digestion band polymorphism and its association with single-petaled single-pistil or double-petaled multi-pistil traits.

[0071] 1. Plum blossom materials used for testing

[0072] Consistent with the source of Example 2.

[0073] 2. Verification of dCAPS molecular marker restriction enzyme digestion band polymorphism and its association with single-petaled single-pistil or double-petaled multi-pistil traits.

[0074] (1) Extracting DNA from plum blossom samples

[0075] The method is consistent with that in Example 2 (1).

[0076] (2) Using the above cDNA as a template, specific PCR amplification was performed using the dCAPS molecular marker primer pair provided in Example 3 to obtain the amplification product;

[0077] The 50 μL PCR amplification reaction system includes: 4 μL cDNA template solution, 25 μL Taq Mix, 2 μL each of forward and reverse primers at a concentration of 10 μM / L, and 17 μL ddH2O.

[0078] PCR amplification reaction program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 15 s, 30 cycles; 72℃ final extension for 5 min.

[0079] (3) The PCR amplification products were analyzed by 3% agarose gel electrophoresis to detect the amplification results. Trelief @ The DNAGel Extraction Kit (safe & Convenient) (Beijing Qingke Biotechnology Co., Ltd.) is used for gel extraction and recovery to obtain the recovered product of the target band.

[0080] (4) The above-recovered products were digested with the restriction endonuclease Hinf I. The resulting digested products were electrophoresed on 3% agarose gels and the electrophoretic bands were observed on a gel imaging system. The experimental results were analyzed.

[0081] The 30 μL enzyme digestion reaction system includes: 10 μL of the recovered product described in step (3), 1 μL of Hinf I enzyme, 2 μL of 10×FastDigest Green Buffer, and 17 μL of ddH2O; the enzyme digestion reaction conditions are incubation at 37℃ for 1 h.

[0082] 3. Results Analysis

[0083] Figure 3 These are electrophoresis images of 24 plum blossom resource amplification samples in this embodiment. Figure 4 These are amplification electrophoresis images of 22 F1 generation single-petaled, single-pistil individuals in this embodiment. Figure 5 These are amplification electrophoresis images of 22 F1 generation double-petaled multi-pistil individuals in this embodiment. Figure 6 This is an electrophoresis image of the enzyme fragments obtained from plum blossom resources in this embodiment using dCAPS molecular marker detection. Figure 7 The image shows an electrophoresis diagram of the enzyme digestion fragments obtained by dCAPS molecular marker detection from F1 generation individuals in this embodiment. The enzyme digestion product consists of a single main band at the top with a length of 306 bp, which is consistent with the length of the band before digestion. This corresponds to a single-petaled, single-pistil plum blossom variety. The enzyme digestion product also includes two main bands with lengths of 306 bp and 255 bp, respectively, and a single main band at the bottom with a length of 255 bp. This corresponds to a double-petaled, multi-pistil plum blossom variety.

[0084] This demonstrates that the dCAPS molecular marker exhibits good enzyme digestion polymorphism, and the enzyme digestion band pattern corresponds very well with the single-petaled single-pistil or double-petaled multi-pistil trait of plum blossoms, with an identification accuracy of 100%. This indicates that the dCAPS molecular marker developed using the above-mentioned SNP molecular marker can effectively identify plum blossom varieties with single petals and single pistil or double petals and multi-pistil, with high accuracy, enabling early and rapid identification of plum blossom flower types.

[0085] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The application of SNP molecular markers related to the trait of single-petaled single-pistil or double-petaled multi-pistiled plum blossoms, characterized in that, The SNP molecular marker is a C or G polymorphism at position 255 of the nucleotide sequence shown in SEQ ID NO.1; when the genotype of the SNP site is CC, the phenotype is single-petaled single pistil; when the genotype of the SNP site is CG or GG, the phenotype is double-petaled multiple pistils; the application includes at least one of the following aspects; (1) Identify the characteristics of plum blossoms: single-petaled with a single pistil or double-petaled with multiple pistils; (2) Marker-assisted breeding of plum blossoms with single petals and single pistil or double petals and multiple pistils; (3) Develop dCAPS molecular markers to identify the traits of single-petaled single-pistil or double-petaled multi-pistiled plum blossoms.

2. A method for identifying whether a plum blossom has a single petal and a single pistil or a double petal and multiple pistils, characterized in that, include: The genotype of the SNP molecular marker described in claim 1 is detected. When the genotype of the SNP site is CC, the phenotype is single petal and single pistil. When the genotype of the SNP locus is CG or GG, the phenotype is double-petaled with multiple pistils.

3. The method according to claim 2, characterized in that, Using the cDNA obtained by reverse transcription of total RNA from the plum blossom to be tested as a template, PCR amplification was performed using the primers shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain the PCR amplification product.

4. The method according to claim 3, characterized in that, The PCR amplification products were digested with Hinf I enzyme, and the digested products were subjected to agarose gel electrophoresis. Based on the electrophoresis results, it was determined whether the plum blossom to be tested was single-petaled with a single pistil or double-petaled with multiple pistils. The determination method is as follows: If the enzyme digestion product contains only a 306bp main band, the plum blossom to be tested is a single-petaled, single-pistil variety; if the enzyme digestion product contains only a 255bp main band, the plum blossom to be tested is a homozygous double-petaled, multi-pistil variety; if the enzyme digestion product contains both 306bp and 255bp main bands, the plum blossom to be tested is a heterozygous double-petaled, multi-pistil variety.

5. The method according to claim 3 or 4, characterized in that, The PCR amplification reaction program includes: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 15 s, 30 cycles; 72℃ final extension for 5 min.

Images