A method for molecular assisted breeding based on a kcnagene molecular marker of eriocheir sinensis

Abstract

The present application belongs to the technical field of gene exploration and molecular marker assisted breeding, and particularly relates to a method for molecular assisted breeding based on Kcna gene molecular marker of Eriocheir sinensis, which adopts a rapid genotyping method based on competitive allele specific PCR (KASP) of Kcna gene molecular marker site of Eriocheir sinensis to assist the molecular breeding of Eriocheir sinensis, helps to protect the germplasm resources of Eriocheir sinensis in the Yangtze River system, and prevents the mixing of germplasm in different water systems, so as to realize the purification and rejuvenation of the germplasm of authentic Eriocheir sinensis in the Yangtze River system.

Description

Technical Field

[0001] This invention belongs to the field of gene discovery and molecular marker-assisted breeding technology, specifically involving a molecular-assisted breeding method based on the Kcna gene molecular marker of Chinese mitten crab. The method uses a rapid genotyping method based on competitive allele-specific PCR (KASP) of molecular marker sites of the Kcna gene of Chinese mitten crab to assist in the molecular breeding of Chinese mitten crab. Background Technology

[0002] The Chinese mitten crab (Eriocheir sinensis), commonly known as the river crab, is an extremely important aquatic economic animal in my country. In 2021, the national output of adult crabs reached 808,000 tons, with an annual aquaculture output value exceeding 70 billion yuan, making it a truly distinctive aquatic industry. However, along with the rapid development of my country's river crab industry, the improvement of aquaculture output and quality, and the recognition by the consumer market, the germplasm resources of Chinese river crabs are also experiencing a sharp decline and hybridization, with the problem of germplasm resource destruction being prominent. The Chinese mitten crab is distributed in major river systems from north to south in my country, such as the Liaohe River system, the Yellow River system, and the Yangtze River system. Chinese mitten crabs distributed in different river systems have their own distinct germplasm characteristics, such as temperature, stress resistance, and growth and development characteristics. Among them, the Yangtze River system mitten crab is widely recognized by the aquaculture and consumer markets due to its outstanding aquaculture performance, excellent quality, and distinctive external morphological features (such as long walking legs and pointed frontal teeth). However, driven by the profit-making of the consumer market, farmers have blindly introduced Chinese mitten crabs from the Yangtze and Liao River basins, which has exacerbated the rate and extent of genetic mixing. The genetic mixing of Chinese mitten crabs in the Yangtze River system is quite serious, affecting the superior genetic performance of Chinese mitten crabs in the Yangtze River system. Therefore, it is necessary to develop molecular markers for identifying Chinese mitten crabs in the Yangtze and Liao River systems, and to carry out molecular-assisted breeding of Chinese mitten crabs in the Yangtze River system based on these molecular markers in order to improve the genetic mixing situation. Summary of the Invention

[0003] To overcome the shortcomings of existing technologies, this invention provides a molecular-assisted breeding method based on the Kcna gene molecular marker of Chinese mitten crab. The method uses a rapid genotyping method based on competitive allele-specific PCR (KASP) of the Kcna gene molecular marker site of Chinese mitten crab to assist in molecular marker breeding of Chinese mitten crab, so as to solve the current situation of mixed germplasm of Chinese mitten crab.

[0004] To achieve the above objectives, the solution adopted by the present invention is as follows:

[0005] This invention provides a molecular-assisted breeding method based on the Kcna gene molecular marker of the Chinese mitten crab, comprising the following steps:

[0006] Hemolymph was collected from each individual in the candidate breeding population of Chinese mitten crab, and genomic DNA was extracted.

[0007] Genotyping was performed on the genomic DNA extracted from the individuals to be tested using the competitive allele-specific PCR (KASP) method based on the molecular marker site of the Kcna gene of the Chinese mitten crab.

[0008] Individuals with the genotype AA were selected as candidate parents for breeding in one type of aquatic mitten crab, or individuals with the genotype GG were selected as candidate parents for breeding in another type of aquatic mitten crab.

[0009] Preferably, the molecular marker of the Chinese mitten crab Kcna gene is a single nucleotide polymorphism (SNP) mutation site on the CDS (SEQ ID NO:1) coding sequence of the Chinese mitten crab Kcna gene, located at 1461 bp, which is an A and G SNP mutation site (named c.1461 A>G).

[0010] Preferably, the genotyping method for the competitive allele-specific PCR (KASP) of the Kcna gene molecular marker site of the Chinese mitten crab includes the following steps:

[0011] Step (1): Design specific primers based on the upstream and downstream sequences of the SNP site in the coding region of the Kcna gene of the Chinese mitten crab (SEQ ID NO:1), wherein the sequence of the forward primer F1 is 5'- GAAGGTGACCAAGTTCATGCT AGGACTCGTTATCCGAGTCA-3', the sequence of the forward primer F2 is 5'- GAAGGTCGGAGTCAACGGATT AGGACTCGTTATCCGAGTCG-3', the reverse primer R sequence is 5'-TCAGCCTCCCCAATGTCTGA-3', the underlined part is the fluorescent group sequence tag;

[0012] Step (2): Extract hemolymph from the walking legs of the Chinese mitten crab to be tested and extract genomic DNA;

[0013] Step (3), PCR amplification: Fluorescent PCR amplification of the genomic DNA of the Chinese mitten crab obtained in step (2) was performed using the specific primers designed in step (1);

[0014] Step (4): Read the fluorescence signal value of the PCR amplification reaction and draw a scatter plot. Determine the genotype of the Kcna molecular marker of the Chinese mitten crab to be tested based on the distribution of the fluorescence signal value.

[0015] Preferably, in step (4), after PCR amplification, the fluorescence signal is read, and a scatter plot is drawn with FAM value on the X-axis and HEX value on the Y-axis. The genotype is determined according to the distribution of the samples on the scatter plot: the samples concentrated on the HEX axis (Y-axis) are AA type, the samples concentrated on the FAM axis (X-axis) are GG type, and the samples concentrated in between are AG type.

[0016] Preferably, the molecular-assisted breeding method based on the Kcna gene molecular marker of Chinese mitten crab helps to trace the germplasm of Chinese mitten crab in different water systems and prevents germplasm mixing.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0018] (1) This invention provides a molecular-assisted breeding method based on the Kcna gene molecular marker of Chinese mitten crab. The rapid genotyping method of competitive allele-specific PCR (KASP) based on the Kcna gene molecular marker site of Chinese mitten crab is used to assist the molecular marker breeding of Chinese mitten crab. This helps to protect the germplasm resources of Chinese mitten crab in the Yangtze River system and prevent the mixing of germplasm from different water systems, thereby achieving the purification and rejuvenation of the authentic Yangtze River mitten crab germplasm.

[0019] (2) The rapid genotyping method based on competitive allele-specific PCR (KASP) of the Kcna gene molecular marker site of Chinese mitten crab used in this invention greatly saves genotyping time. Compared with traditional genotyping methods, this invention saves the time of sequencing PCR products and can complete genotyping after PCR amplification. In addition, it can also save the cost of genotyping. This invention can complete genotyping only through PCR amplification, saving the cost of sequencing.

[0020] (3) The present invention extracts DNA from the hemolymph of the Chinese mitten crab without damaging the parent Chinese mitten crab, thus achieving non-destructive typing. Attached Figure Description

[0021] Figure 1 This is an illustration of the genotyping verification of the Kcna gene molecular marker site in the Chinese mitten crab according to an embodiment of the present invention; in the figure, a is the KASP genotyping result of the Kcna molecular marker, and b is the sequencing genotyping result of the Kcna molecular marker.

[0022] Figure 2 This is a diagram showing the genotyping results of the Kcna gene of the candidate breeding parent of the Chinese mitten crab in this embodiment of the invention. Detailed Implementation

[0023] Based on the published reference genome of the Chinese mitten crab (https: / / www.ncbi.nlm.nih.gov / genome / ?term=chinese+mitten+crab), this invention performed whole-genome resequencing and data analysis on 60 wild samples from the Yangtze, Liaohe, and Yellow River systems. The study revealed significant genetic differentiation of the Kcna gene in the Yangtze and Liaohe River systems. A single nucleotide mutation (named c.1461 A>G) was found at 1461 bp in the Kcna gene coding region (with A as the first base in the start codon ATG, marked as +1). The A allele was enriched in the Chinese mitten crab population of the Yangtze River system, while the G allele was enriched in the Chinese mitten crab population of the Liaohe River system. Further genotyping of wild samples of *Eriocheir sinensis* from the Yangtze and Liaohe River systems in 2014 and 2017 using the Kcna gene molecular marker revealed that the proportion of the AA type of the Kcna gene molecular marker (c.1461 A>G) was significantly higher in the Yangtze River system than in the GG type (as shown in Table 1). In contrast, the proportion of the GG type in the Liaohe River system reached as high as 98% in 2017, and the AA type was absent. Therefore, this Kcna molecular marker (c.1461 A>G) can serve as a specific molecular marker for distinguishing between Yangtze and Liaohe River populations of *Eriocheir sinensis*. This would facilitate the tracing of germplasm across different river systems, prevent germplasm mixing, and also be applicable to molecular-assisted breeding of *Eriocheir sinensis* from the Yangtze and Liaohe River systems.

[0024] Table 1. Distribution ratio of Kcna gene molecular markers in the Yangtze and Liaohe River populations of Chinese mitten crab.

[0025]

[0026] Based on obtaining specific Kcna molecular markers for the Chinese mitten crab (Eriocheir sinensis), rapid genotyping of a large number of individual Chinese mitten crabs using Kcna gene molecular markers is crucial for marker-assisted breeding of this species. Traditional genotyping often involves DNA extraction, PCR amplification, and sequencing, but this method is time-consuming and limits its practical breeding applications. Kompetitive Allele-Specific PCR (KASP) is a fluorescent marker-based genotyping technique. Its core involves designing two specific forward primers and one universal reverse primer at the molecular marker site. Different fluorescent probes are added to the two forward primers. During amplification, the fluorescent probes bind to the ends of the amplification products, resulting in different fluorescent signals for different genotypes. Therefore, rapid genotyping can be achieved solely through the detection and analysis of fluorescent signals, eliminating the need for sequencing. Genotyping results are obtained upon completion of PCR amplification, saving both experimental time and sequencing costs. Therefore, this patent utilizes the identified Kcna molecular marker, designs specific fluorescent marker primers, and employs the KASP genotyping kit to accurately, conveniently, and rapidly detect the genotype of Kcna molecular markers in a large number of Chinese mitten crab individuals, thereby assisting in the molecular breeding of Chinese mitten crabs and further promoting the genetic improvement and industrial development of Chinese mitten crabs.

[0027] Therefore, the present invention also provides a genotyping method based on competitive allele-specific PCR (KASP) of the Kcna gene molecular marker site of the Chinese mitten crab, comprising the following steps:

[0028] Step (1): Design specific primers based on the upstream and downstream sequences of the SNP site in the coding region of the Kcna gene of the Chinese mitten crab (SEQ ID NO:1), wherein the sequence of the forward primer F1 is 5'- GAAGGTGACCAAGTTCATGCT AGGACTCGTTATCCGAGTCA-3', the sequence of the forward primer F2 is 5'- GAAGGTCGGAGTCAACGGATT AGGACTCGTTATCCGAGTCG-3', the reverse primer R sequence is 5'-TCAGCCTCCCCAATGTCTGA-3', the underlined part is the fluorescent group sequence tag;

[0029] Step (2): Extract hemolymph from the walking legs of the Chinese mitten crab to be tested and extract genomic DNA;

[0030] Step (3), PCR amplification: Fluorescent PCR amplification of the genomic DNA of the Chinese mitten crab obtained in step (2) was performed using the specific primers designed in step (1);

[0031] Step (4): Read the fluorescence signal value of the PCR amplification reaction and draw a scatter plot. Determine the genotype of the Kcna molecular marker of the Chinese mitten crab to be tested based on the distribution of the fluorescence signal value.

[0032] In step (4), after PCR amplification, the fluorescence signal is read and a scatter plot is drawn with FAM value on the X-axis and HEX value on the Y-axis. The genotype is determined according to the distribution of the samples on the scatter plot: the samples concentrated on the HEX axis (Y-axis) are AA type, the samples concentrated on the FAM axis (X-axis) are GG type, and the samples concentrated in between are AG type.

[0033] Based on the genotyping method using competitive allele-specific PCR (KASP) of the Kcna gene molecular marker locus in *Eriocheir sinensis*, this invention further provides a molecular-assisted breeding method based on the Kcna gene molecular marker in *Eriocheir sinensis*, comprising the following steps:

[0034] Hemolymph was collected from each individual in the candidate breeding population of Chinese mitten crab, and genomic DNA was extracted.

[0035] Genotyping was performed on the genomic DNA extracted from the individuals to be tested using the competitive allele-specific PCR (KASP) method based on the molecular marker site of the Kcna gene of the Chinese mitten crab.

[0036] Individuals with the genotype AA were selected as candidate parents for breeding in one type of aquatic mitten crab, or individuals with the genotype GG were selected as candidate parents for breeding in another type of aquatic mitten crab.

[0037] The molecular-assisted breeding method based on the Kcna gene molecular marker of Chinese mitten crab, as described above, uses a rapid genotyping method based on competitive allele-specific PCR (KASP) of the Kcna gene molecular marker site to assist in the molecular marker breeding of Chinese mitten crab. This helps to protect the germplasm resources of Chinese mitten crab in the Yangtze River system and prevent the mixing of germplasm from different river systems, thereby achieving the purification and rejuvenation of the authentic Yangtze River mitten crab germplasm.

[0038] The technical solution of the present invention will be further described below with reference to specific embodiments; however, the scope of protection of the present invention is not limited to these embodiments. All changes or equivalent substitutions that do not depart from the concept of the present invention are included within the scope of protection of the present invention.

[0039] Example 1: Genotyping verification of the Kcna gene molecular marker locus in the Chinese mitten crab

[0040] The steps are as follows:

[0041] 1. Primer design

[0042] Specific primers were designed based on the upstream and downstream sequences of the SNP site (c.1461 A>G) in the coding region of the Kcna gene (SEQ ID NO:1). The sequence of the forward primer F1 is as follows (the underlined part is the fluorescent gene sequence tag): 5'- GAAGGTG ACCAAGTTCATGCT The sequence of the forward primer F2 is AGGACTCGTTATCCGAGTCA-3' (underlined part is the fluorescent group sequence tag): 5'- GAAGGTCGGAGTCAACGGATT The sequence of the reverse primer R is: 5'-TCAGCCTCCCCAATGTCTGA-3'.

[0043] 2. Extraction of DNA from Samples

[0044] Hemolymph was extracted from the walking legs of the Chinese mitten crab, and DNA was extracted using the conventional phenol-chloroform extraction method.

[0045] 3. PCR amplification

[0046] The primers from step 1 above were used to amplify the DNA sample from the *Eriocheir sinensis* sample from step 2 above by PCR. The PCR amplification reaction system was as follows: 0.14 μL of primer-Mix premix (forward primers F1 and F2, and reverse primer R, mixed in a ratio of 12:12:30), 5 μL of 2×Master mix, and 5 μL of template DNA. The PCR reaction program was as follows: 94°C pre-denaturation for 15 min, 94°C denaturation for 20 s, annealing extension at 61-55°C (decreasing by 0.6°C per cycle) for 60 s, for 10 cycles; 94°C denaturation for 20 s, 55°C annealing extension for 60 s, for 26 cycles. The PCR reaction was performed on a real-time PCR instrument.

[0047] 4. Determination of Kcna genotype

[0048] After PCR amplification, the fluorescence signal of the amplified products is detected using a quantitative real-time PCR instrument. The quantitative real-time PCR reading program is: 35°C, 30s. A scatter plot is plotted based on the fluorescence signal values ​​to determine the genotype of the sample. The entire genotyping process takes approximately one day (e.g., ...). Figure 1 (As shown).

[0049] 5. Comparison of KASP genotyping and traditional sequencing genotyping results

[0050] The DNA extracted using the above steps was subjected to routine PCR and then sent to a biotechnology company for sequencing. Sequencing sequences were obtained for each sample, and the sequencing peaks were then analyzed one by one to determine the genotype of the Kcna gene at that molecular marker site. Genotyping was performed using sequencing methods, and the entire process took approximately 3 days.

[0051] Comparing the sequencing results with the KASP genotyping results revealed complete consistency in the genotyping results at this molecular marker site in the Kcna gene. This result validates the feasibility of the KASP genotyping method and the designed primer pairs (e.g., Figure 1 (As shown). However, traditional sequencing methods for genotyping are time-consuming and expensive, while using KASP for genotyping can achieve low cost and high efficiency while ensuring the accuracy of genotyping results.

[0052] Example 2: Genotyping and Breeding Application of Kcna Gene in Candidate Chinese Eriocheir sinensis Breeding Population

[0053] Hemolymph was collected from each individual in the candidate breeding population of Chinese mitten crabs. After extracting genomic DNA, the individuals were genotyped using the rapid KASP genotyping method of Kcna as described in Example 1 (e.g., Figure 2 As shown in the figure, individuals with genotype AA were selected as candidate parents for breeding of Chinese mitten crabs in the Yangtze River system, or individuals with genotype GG were selected as candidate parents for breeding of Chinese mitten crabs in the Liaohe River system.

[0054] In this invention, the coding sequence (1584bp) of the Kcna gene is SEQ ID NO:1:

[0055]

[0056] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A molecular-assisted breeding method based on the Kcna gene molecular marker of the Chinese mitten crab, characterized in that, Includes the following steps: Hemolymph was collected from each individual in the candidate breeding population of Chinese mitten crab, and genomic DNA was extracted. Based on the competitive allele-specific PCR method, the genomic DNA extracted from the individuals to be tested was genotyped, wherein: the molecular marker of the Chinese mitten crab Kcna gene is shown as SEQ ID NO:1, and there is an A / G mutation at 1461bp; Individuals with the genotype AA were selected as candidate parents for breeding of Chinese mitten crabs in the Yangtze River system, or individuals with the genotype GG were selected as candidate parents for breeding of Chinese mitten crabs in the Liao River system.

Images