Recombinant escherichia coli for efficiently producing tetrahydropyrimidine and construction method thereof

Abstract

The application discloses a kind of recombinant escherichia coli for efficiently producing tetrahydropyrimidine and a construction method thereof, and belongs to the field of bioengineering.The application uses escherichia coli BL21 as host, pET and other series of plasmids as carrier, and expresses L-diaminobutyric acid transaminase (EctB T15S / T49A / Y293M ), L-diaminobutyric acid acetyltransferase (EctA) and tetrahydropyrimidine synthetase (EctC) in intracellular heterologous expression, obtains optimal expression vector and gene combination mode by plasmid copy number optimization, and further optimizes enzyme activity ratio of three enzymes in vivo by regulating three enzyme expression levels by different levels of RBS.Using optimal recombinant strain as biological catalyst for whole-cell transformation, the highest yield of tetrahydropyrimidine reaches 87.36g / L.The production process is simple, raw materials are easy to obtain, and impurities are less, so it has good industrial application prospect.

Description

Technical Field

[0001] This invention relates to a recombinant Escherichia coli for efficient production of tetrahydropyrimidine and its construction method, belonging to the field of bioengineering technology. Background Technology

[0002] Tetrahydropyrimidine, also known as ectoine or tetrahydromethylpyrimidine carboxylic acid, has the English name Ectoine, 1,4,5,6-tetrahydro-2-methyl-4-pyrimidinecarboxylic acid, and the molecular formula C6H. 10 N₂O₂, with a molecular weight of 142.16, is a hydrophilic small organic molecule and a common osmolar regulator in halophilic or halophilic microorganisms. Studies have shown that tetrahydropyrimidine has a protective effect on the structure and function of intracellular biomolecules such as proteins and nucleic acids in extreme environments, and therefore has broad application prospects in the pharmaceutical, biopharmaceutical, and cosmetic industries.

[0003] Currently, the main methods for synthesizing tetrahydropyrimidine are chemical and biological methods. Chemical methods are more difficult due to the presence of chiral carbon atoms in the chemical structure of tetrahydropyrimidine, resulting in numerous byproducts, low yields, and limited large-scale production. Biological methods, mainly including fermentation and enzymatic conversion, are the primary research directions for tetrahydropyrimidine synthesis. The main synthetic pathway of tetrahydropyrimidine in halophilic bacteria is: oxaloacetic acid → aspartic acid → aspartic acid-β-hemiacetal → aldehyde amino acid → oxaloacetyl-2-aminobutyric acid → N-γ-acetyl-2-aminobutyric acid → tetrahydropyrimidine. Based on this metabolic pathway, heterologous expression engineered strains can be constructed to achieve heterologous expression of tetrahydropyrimidine. Kang Zhen et al. (CN 113186143 A) reported the construction of a recombinant *Escherichia coli* ECT-LA that produces tetrahydropyrimidine under low-salt conditions using synthetic biology and genetic engineering techniques. This recombinant gene cluster ectABC, controlled by the T7 promoter, and the exogenous gene lysC are included. C932TUsing glucose as a substrate, after 56 hours of fed-batch fermentation, the tetrahydropyrimidine yield reached 60 g / L. Lin Ling et al. (CN 112961875 A) reported a recombinant Escherichia coli engineered strain that tandemly expressed GABA acetyltransferase, diaminobutyrate aminotransferase, and tetrahydropyrimidine synthase from *Salinicola salaria*. Using sodium aspartate and glucose as substrates, the enzymatic reaction catalyzed the production of tetrahydropyrimidine, achieving a maximum yield of 24.8 g / L. The tetrahydropyrimidine yields of the above two recombinant *E. coli* strains are relatively high in existing literature, but there is still room for further improvement. Hillier et al. found that EctB is the rate-limiting enzyme in the tetrahydropyrimidine synthesis pathway; Chen et al. improved the tetrahydropyrimidine yield by increasing the exobase production and specific activity of the EctB mutant. Therefore, by improving the catalytic efficiency of key enzymes in the tetrahydropyrimidine synthesis pathway, it is expected to develop high-yield tetrahydropyrimidine-producing strains, which is of great significance for promoting the industrial production and application of tetrahydropyrimidine. Summary of the Invention

[0004] The purpose of this invention is to provide a high-yield tetrahydropyrimidine-producing *Escherichia coli* strain and a method for producing tetrahydropyrimidine using this strain. This invention involves overexpressing L-diaminobutyrate transaminase (EctB), a pathway enzyme involved in the synthesis of tetrahydropyrimidine, in *E. coli* cells. T15S / T49A / Y293M The study identified three enzymes: L-diaminobutyric acid acetyltransferase (EtcA) and tetrahydropyrimidine synthase (EtcC). Subsequently, the optimal expression vector and gene combination were obtained through plasmid copy number optimization. The expression levels of the three enzymes were further optimized by regulating the expression levels of the three enzymes at different levels of RBS, thereby achieving efficient production of tetrahydropyrimidine and laying the foundation for the industrial production of tetrahydropyrimidine.

[0005] This invention provides a mutant of L-diaminobutyric acid transaminase, wherein the mutant is characterized by mutating threonine at position 15 to serine, threonine at position 49 to alanine, and tyrosine at position 293 to methionine; named EctB. T15S / T49A / Y293M .

[0006] In one embodiment of the present invention, the nucleotide sequence encoding the parent enzyme of the L-diaminobutyric acid transaminase is shown in SEQ ID NO.2.

[0007] The present invention also provides a gene encoding the mutant.

[0008] The present invention also provides a recombinant vector carrying the above-mentioned genes.

[0009] In one embodiment of the present invention, the recombinant vector is pET-28a, pRSF-Duet-1, or pCDF-Duet-1 as the expression vector.

[0010] The present invention also provides recombinant cells expressing the above-mentioned mutants, or containing the above-mentioned genes, or containing the above-mentioned recombinant vectors.

[0011] In one embodiment of the present invention, the recombinant cells use prokaryotic cells or eukaryotic cells as expression hosts.

[0012] The present invention also provides a recombinant Escherichia coli, wherein the recombinant Escherichia coli is an overexpression of the above-mentioned L-diaminobutyric acid transaminase mutant EctB. T15S / T49A / Y293M L-diaminobutyric acid acetyltransferase with an amino acid sequence as shown in SEQ ID NO.3 and tetrahydropyrimidine synthase with an amino acid sequence as shown in SEQ ID NO.4.

[0013] In one embodiment of the present invention, the L-diaminobutyric acid transaminase mutant EctB is encoded. T15S / T49A / Y293M The nucleotide sequence is shown in SEQ ID NO.5, the nucleotide sequence encoding the L-diaminobutyric acid acetyltransferase is shown in SEQ ID NO.6, and the nucleotide sequence encoding the tetrahydropyrimidine synthase is shown in SEQ ID NO.7.

[0014] In one embodiment of the present invention, the recombinant Escherichia coli uses E. coli BL21(DE3) as the expression host.

[0015] In one embodiment of the present invention, tetrahydropyrimidine synthase was overexpressed using the pCDF-Duet-1 vector, and L-diaminobutyric acid transaminase mutant and L-diaminobutyric acid acetyltransferase were overexpressed using the pRSF-Duet-1 vector.

[0016] In one embodiment of the present invention, the RBS sequence CCGTGATTGACGCCGACAAACTGGATGACG is used to replace the AAGGAG of the vector preceding the L-diaminobutyric acid acetyltransferase gene.

[0017] The present invention also provides a method for constructing the recombinant Escherichia coli, wherein the steps of the construction method are as follows:

[0018] (1) Obtain single-gene expression vectors for L-diaminobutyric acid transaminase mutant, L-diaminobutyric acid acetyltransferase and tetrahydropyrimidine synthase.

[0019] (2) The genes encoding the three enzymes were amplified and ligated into the expression vectors pACYC-Duet-1, pCDF-Duet-1, pET-Duet-1 and pRSF-Duet-1 respectively in independent reading frame order. The ligation types and orders of the three genes in each vector were different.

[0020] (3) The expression vectors obtained in steps (1) and (2) are assembled with the pathway enzyme to obtain a variety of combinations.

[0021] (4) Transform the recombinant plasmid obtained in step (3) into Escherichia coli BL21 to obtain recombinant Escherichia coli.

[0022] In one embodiment of the present invention, the recombinant expression vector is in which all pathway enzyme genes are sequentially linked to the expression vector in the order of independent open reading frames, and the order of the open reading frames is: promoter, ribosome binding site (RBS), pathway enzyme encoding gene, and terminator.

[0023] In one embodiment of the present invention, the host of the recombinant Escherichia coli is Escherichia coli BL21.

[0024] The present invention also provides a method for preparing tetrahydropyrimidine, wherein the method comprises using the above-mentioned recombinant cells or the above-mentioned recombinant Escherichia coli as whole-cell catalysts, and using sodium aspartate and glucose as substrates to convert and prepare tetrahydropyrimidine; the recombinant cells also express L-diaminobutyric acid acetyltransferase with the amino acid sequence shown in SEQ ID NO.3 and tetrahydropyrimidine synthase with the amino acid sequence shown in SEQ ID NO.4.

[0025] In one embodiment of the present invention, the amount of sodium aspartate added is 100-200 mM, and the amount of glucose added is 50-100 mM.

[0026] In one embodiment of the present invention, the whole-cell catalyst is prepared by:

[0027] Inoculate the fermenter with 2-10% of the inoculum and culture for 4-5 hours. Add IPTG at a final concentration of 0.5-0.8 mmol / L for induction at 37℃ for 18 hours. After fermentation, collect the cells by centrifugation at 8000 rpm, wash the cells with 0.8% NaCl solution, and store the cells at -20℃ for later use.

[0028] In one embodiment of the present invention, the fermentation medium in the fermenter is: glucose 25g / L, yeast powder 10g / L, peptone 15g / L, disodium hydrogen phosphate 5g / L, potassium dihydrogen phosphate 3g / L, magnesium sulfate 3g / L, and ferrous sulfate 1g / L. The pH is adjusted to 7.0-7.5 by adding ammonia. The feed solution consists of glucose mother liquor 800g / L. Glucose mother liquor is fed throughout the fermentation process.

[0029] In one embodiment of the present invention, in the whole-cell transformation production system, the above-mentioned recombinant bacteria are used as cell catalysts, 100-200mM sodium aspartate and 50-100mM glucose are used as substrates, and 50mM, pH 7.0 PBS buffer is used as solvent for the transformation reaction.

[0030] In one embodiment of the present invention, in the whole-cell conversion production system, after the reaction for 2-4 hours, 2M L-aspartate sodium and 1M glucose are added to the conversion system to maintain the pH of the conversion reaction system at 7.0.

[0031] The present invention also provides the use of the above-mentioned L-diaminobutyric acid transaminase mutant, or the above-mentioned gene, or the above-mentioned recombinant vector, or the above-mentioned recombinant cell, or the above-mentioned recombinant Escherichia coli in the preparation of tetrahydropyrimidine or products containing tetrahydropyrimidine.

[0032] Beneficial effects

[0033] This invention finely regulates the pathway enzyme L-diaminobutyrate transaminase EctB in tetrahydropyrimidine synthesis by altering plasmid copy number and RBS strength. T15S / T49A / Y293M The expression levels of L-diaminobutyric acid acetyltransferase EctA and tetrahydropyrimidine synthase EctC were used to achieve reaction equilibrium in this cascade pathway; the optimal recombinant strain E. coli9 (containing plasmid pRSF-EctB) T15S / T49A / Y293M Using a fed-batch strategy (co-feeding 155.08 g / L L-aspartate sodium) in a 5L fermenter (EctA, pCDF-EctC), the tetrahydropyrimidine yield reached 87.36 g / L after 20 hours of conversion. This method has great potential and broad value for industrial applications in increasing tetrahydropyrimidine yield. Attached Figure Description

[0034] Figure 1 This is a schematic diagram of the biosynthetic pathway of tetrahydropyrimidine.

[0035] Figure 2 A schematic diagram illustrating the construction of gene expression vectors with different copy numbers.

[0036] Figure 3 Comparison of tetrahydropyrimidine production in shake-flask transformation of six recombinant strains with different copy numbers.

[0037] Figure 4 A schematic diagram illustrating the construction of gene expression vectors with different RBS levels.

[0038] Figure 5 Comparison of tetrahydropyrimidine production in shake-flask transformation of 10 recombinant strains with different RBS levels.

[0039] Figure 6 The yield of tetrahydropyrimidine was determined by fed-batch conversion of the optimal recombinant strain E. coli9 in a 5L fermenter. Detailed Implementation

[0040] The culture media involved in the following examples are as follows:

[0041] Seed culture medium for *Haloxylon elongate* DSM 2581: NaCl 80 g / L, casein amino acids 7.5 g / L, peptone 5 g / L, yeast extract 1 g / L, MgSO4·7H2O 20 g / L, K2HPO4 0.5 g / L, FeSO4·7H2O 1 g / L, pH 7.0;

[0042] LB medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L;

[0043] Fermentation medium: glucose 25g / L, yeast extract 10g / L, peptone 13g / L, disodium hydrogen phosphate 5g / L, potassium dihydrogen phosphate 3g / L, magnesium sulfate 3g / L, ferrous sulfate 1g / L, pH adjusted to 7.0-7.5 with ammonia.

[0044] The detection methods involved in the following embodiments are as follows:

[0045] Methods for detecting L-diaminobutyric acid transaminase activity:

[0046] The activity of L-diaminobutyrate transaminase (L-diaminobutyrate transaminase) was calculated by measuring the yield of L-2,4-diaminobutyric acid (L-2,4-diaminobutyric acid) produced by L-diaminobutyrate transaminase over 30 minutes. 1 mL of the reaction system contained 100 mM substrate, excess glutamate, and an appropriate amount of L-diaminobutyrate transaminase enzyme solution. The reaction time was 30 min–1 h. The amount of L-2,4-diaminobutyric acid produced was determined by HPLC after the reaction. The enzyme activity of L-diaminobutyrate transaminase was defined as the amount of enzyme required to produce 1 μmol of L-2,4-diaminobutyric acid within 1 minute.

[0047] HPLC detection of L-2,4-diaminobutyric acid:

[0048] The chromatographic column was an Agilent amino acid column; the mobile phase composition was as follows: Phase A used 10 mM KH2PO4, with the pH adjusted to approximately 5.30 using KOH solution; Phase B used a mixture of pure acetonitrile, pure methanol, and the Phase A solution in a 5:3:1 volume ratio, with the pH adjusted to approximately 5.30 using glacial acetic acid solution; the determination was performed using the o-phthalaldehyde derivatization method, i.e., 8 μL of sample was mixed with 4 μL of OPA for online derivatization; in addition, the elution method was gradient elution; the detector was a fluorescence detector, with an excitation wavelength of 330 nm and an emission wavelength of 465 nm.

[0049] Example 1: Construction of mutants

[0050] (1) Construction of single mutants:

[0051] Primers for the EctB mutation site were designed as shown in Table 1. The mutant was constructed by full plasmid PCR (the full plasmid used here is the pET-28a plasmid containing the wild-type L-diaminobutyric acid transaminase EctB gene).

[0052] Table 1: Primer sequences for single mutant mutations

[0053]

[0054] (2) Construction of a reaction PCR amplification system: Prim STAR 0.5 μL of enzyme, 5× Prime STAR Buffer 10 μL, dNTP 4 μL, two primers for each mutation site 1 μL each, template (EctB) WT 4 μL of DpnI and 32.5 μL of water were added. The reaction conditions were: ① 94℃ for 3 min; ② 98℃ for 10 s; ③ 55℃ for 30 s; ④ 72℃ for 3 min; ⑤ Repeat steps ② to ④ 29 times; ⑥ 72℃ for 5 min; ⑦ Incubate at 12℃. The above reaction system was incubated at 37℃ for 3 h to digest the plasmid template (digestion system: DpnI 0.5 μL, the above reaction PCR product 45 μL, 10×T Buffer 5 μL). After digestion, the digested product was introduced into E. coli BL21 competent cells by chemical transformation, plated on kanamycin-resistant plates, and incubated at 37℃ for about 12 h. Single colonies were picked and incubated in LB broth containing 0.05 mg / mL kanamycin-resistant plasmid, incubated at 37℃ for 12 h at 200 rpm, and then sent to the company for sequencing. Those with correct sequencing were positive transformants.

[0055] (3) Construction of multiple mutants: The construction method is the same as that for single mutants. Using the single mutant obtained in the first round as a template, combined mutations are performed to obtain the mutant EctB. T15S / T49A / Y293M .

[0056] Prepared separately to obtain EctBT49A EctB T15S EctB Y293M EctB T15S / T49A / Y293M The mutant recombinant E. coli (E coli BL21 / pET-28a-EctB) T49A E coli BL21 / pET-28a-EctB T15S E coli BL21 / pET-28a-EctB Y293M E coli BL21 / pET-28a-EctB T15S / T49A / Y293M Meanwhile, recombinant Escherichia coli containing wild-type EctB (E coli BL21 / pET-28a-EctB, prepared by the same method as above) was used as a control strain.

[0057] Example 2: Enzyme purification and determination of enzymatic properties

[0058] (1) Enzyme production by shake-flask fermentation:

[0059] The positive transformants of the recombinant strain containing the mutant prepared in Example 1 were inoculated into LB medium and cultured at 37°C until the OD600 reached 0.6–1.0. Then, 0.1 mM IPTG was added to induce enzyme expression at a final concentration of 25°C for 18 hours to obtain the fermentation broth. The fermentation broth was centrifuged at 4°C and 6000 rpm for 10 minutes, and the bacterial cells were collected.

[0060] (2) Enzyme purification and determination of enzymatic properties:

[0061] The collected bacterial cells were resuspended in 10 mL of binding solution A (20 mM Tris-HCl, 0.5 mM NaCl, 20 mM imidazole, pH adjusted to around 7.0 with HCl) and then the centrifuge tubes were placed in an ice bath and then placed in an ultrasonic cell disruptor. The ultrasonic disruption conditions were: working time 4 s, interval time 4 s, for a total of 10 min.

[0062] The obtained lysate was subjected to low-temperature high-speed centrifugation at 4°C and 8000 rpm for 30 min to obtain crude enzyme solution.

[0063] Filter using a 0.22 μm microporous membrane and set aside. Prepare a nickel ion affinity chromatography column. First, rinse the column with approximately 6–12 column volumes of ultrapure water at 4°C, then equilibrate the column with 10 mL of binding buffer A. When the pH of the effluent from the bottom of the column matches that of the low-salt buffer pumped into the column (approximately 5 column volumes of buffer are required), add the obtained crude enzyme solution to the column. First, wash away any contaminating proteins with binding buffer A, then elute with elution buffer B (20 mM Tris-HCl, 0.5 mM NaCl, 500 mM imidazole). Collect the eluent with the absorption peak, measure the enzyme activity, and obtain the target protein that has reached electrophoretic purity.

[0064] (3) Enzymatic property determination: In order to evaluate the mutant, the present invention determined the mutant parent EctB and the mutant EctB. T15S EctB T49A EctB Y293M and EctB T15S / T49A / Y293M Enzyme activity at 20°C (Table 2).

[0065] Table 2: Enzyme activity of EctB parental enzyme and its mutants

[0066]

[0067] Example 3: Construction of single-gene expression vectors related to pathway enzymes

[0068] The L-diaminobutyric acid transaminase used in this invention is the mutant EctB obtained in Example 1. T15S / T49A / Y293M The parental enzyme, L-diaminobutyric acid acetyltransferase gene EctA, and tetrahydropyrimidine synthase gene EctC all originated from Halomonas elongate. The specific steps are as follows:

[0069] (1) *Haloxylon elongate* DSM 2581 was inoculated into seed culture medium with the following composition (g / L): NaCl 80 g, casein amino acids 7.5 g, peptone 5 g, yeast extract 1 g, MgSO4·7H2O 20 g, K2HPO4 0.5 g, FeSO4·7H2O 1 g, and deionized water to a final volume of 1 L, pH 7.0. The culture was carried out at 30℃ and 200 rpm for 10 h. The bacterial cells were collected, and genomic DNA was extracted from *H. elongate* DSM 2581 using a bacterial genomic DNA extraction kit.

[0070] Based on the published genomic information sequences, primers corresponding to the enzymes of each pathway were designed. Using the extracted genomic DNA and existing plasmids as templates, standard PCR amplification systems and procedures were used to amplify the corresponding EctA (SEQ ID NO. 6) and EctC gene (SEQ ID NO. 7) fragments. Simultaneously, following the method in Example 1, the encoding mutant EctB was obtained. T15S / T49A / Y293M The gene fragment (shown in SEQ ID NO.5) (related gene fragments can also be chemically synthesized based on the gene sequence).

[0071] (2) After double digestion of plasmid pET-28a with BamHI and XhoI, the plasmid pET-28a was recovered by agarose gel electrophoresis to obtain linearized plasmid pET-28a.

[0072] (3) The gene fragments obtained by PCR amplification were ligated to the double-digested plasmids using a one-step homologous recombinase. The ligation volume was 20 μL, and the incubation period was 37℃ for 30 min. The ligation products were transformed into JM109 competent cells, and single colonies were picked for PCR verification. Positive transformants were sequenced. If the sequencing results were consistent with the theoretical sequence, it proved that the single-gene expression vector was successfully constructed. Thus, three expression vectors were obtained, namely:

[0073] pET28a-EctB T15S / T49A / Y293M , pET28a-EctA, pET28a-EctC.

[0074] Example 4: Construction of vectors with different copy numbers of pathway enzyme genes

[0075] The specific steps are as follows:

[0076] 1. Preparation of single-copy recombinant vectors

[0077] (1) Obtain the corresponding EctB according to the method in Example 3. T15S / T49A / Y293M (Shown in SEQ ID NO.5), EctA (Shown in SEQ ID NO.6), and EctC gene fragments (Shown in SEQ ID NO.7);

[0078] (2) The plasmids pRSF-Duet-1, pCDF-Duet-1 and pET-Duet-1 were digested with BamHI and HindIII respectively, and then recovered by agarose gel electrophoresis to obtain linearized plasmids pRSF-Duet-1, pCDF-Duet-1 and pET-Duet-1.

[0079] (3) The gene fragments obtained by PCR amplification were ligated to the double-digested plasmids using a one-step homologous recombinase. The ligation volume was 20 μL, and the incubation period was 37℃ for 30 min. The ligation products were transformed into JM109 competent cells, and single colonies were picked for PCR verification. Positive transformants were sequenced. If the sequencing results were consistent with the theoretical sequence, it proved that the single-gene expression vector was successfully constructed. Seven expression vectors were thus obtained, namely:

[0080] pRSF-EctB T15S / T49A / Y293M pRSF-EctA, pET-EctB T15S / T49A / Y293M , pET-EctA, pET-EctC, pCDF-EctA, pCDF-EctC.

[0081] 2. Preparation of multi-copy recombinant vectors

[0082] The copy number of different carriers is shown in Table 3:

[0083] Table 3: Copy Number of Plasma Carriers

[0084]

[0085]

[0086] The specific steps are as follows:

[0087] (1) Obtain the corresponding EctA (SEQ ID NO. 6) and EctC (SEQ ID NO. 7) gene fragments according to the method in Example 3;

[0088] (2) Plasmids pCDF-EctA, pRSF-EctA, and pRSF-EctB were respectively added to the plasmids. T15S / T49A / Y293M After double digestion with KpnI and XhoI, pET-EctA was recovered by agarose gel electrophoresis to obtain linearized plasmids pCDF-EctA, pRSF-EctA, and pRSF-EctB. T15S / T49A / Y293M And pET-EctA.

[0089] (3) The gene fragments obtained by PCR amplification were ligated with the double-digested plasmids using a one-step homologous recombinase. The ligation volume was 20 μL, and the incubation period was 37℃ for 30 min. The ligation products were transformed into JM109 competent cells, and single colonies were picked for PCR verification. Positive transformants were sequenced. If the sequencing results were consistent with the theoretical sequence, it proved that the single gene expression vector was successfully constructed. Five expression vectors were thus obtained, namely:

[0090] pCDF-EctA-EctC, pET-EctA-EctC, pRSF-EctA-EctC, pRSF-EctB T15S / T49A / Y293M -EctC, pRSF-EctB T15S / T49A / Y293M -EctA.

[0091] The successfully constructed expression vectors were combined in pairs according to the enzyme expression requirements, and the two plasmids were simultaneously transformed into E. coli BL21(DE3) competent cells, thereby obtaining 6 recombinant bacteria. Figure 2 ), respectively:

[0092] E. coli BL21(DE3) / pRSF-EctB T15S / T49A / Y293M / pCDF-EctA-EctC, named E.coli 1;

[0093] E. coli BL21(DE3) / pRSF-EctB T15S / T49A / Y293M / pET-EctA-EctC, named E.coli 2;

[0094] E. coli BL21(DE3) / pET-EctB T15S / T49A / Y293M / pRSF-EctA-EctC, named E.coli 3;

[0095] E.coli BL21(DE3) / pET-EctA / pRSF-EctB T15S / T49A / Y293M -EctC, named E.coli 4;

[0096] E.coli BL21(DE3) / pET-EctC / pRSF-EctB T15S / T49A / Y293M -EctA, named E. coli 5;

[0097] E.coli BL21(DE3) / pCDF-EctC / pRSF-EctB T15S / T49A / Y293M -EctA, named E.coli 6.

[0098] Example 5: Shake-flask fermentation of recombinant E. coli 1-E. coli 6

[0099] The specific steps are as follows:

[0100] (1) Recombinant bacterial culture:

[0101] The single clones of E. coli 1-6 prepared in Example 4 were inoculated into 50 mL (250 mL shake flask) of LB medium and cultured at 37 °C and 200 rpm for 10 h to obtain the seed culture for shake flask fermentation.

[0102] The prepared seed culture was inoculated into 150 mL of fermentation medium at an inoculation rate of 2% (v / v) and cultured at 37°C until OD500. 600 The concentration was 0.8, and IPTG was added to make the final concentration 0.4 mM. The cells were induced at 25°C for 14 h. After the induction was completed, the cells were collected by centrifugation at 6000 rpm for 10 min and stored at -20°C as whole-cell catalysts for biotransformation.

[0103] Fermentation medium composition: glucose 25g / L, yeast extract 10g / L, peptone 13g / L, disodium hydrogen phosphate 5g / L, potassium dihydrogen phosphate 3g / L, magnesium sulfate 3g / L, ferrous sulfate 1g / L, pH adjusted to 7.0-7.5 by adding ammonia.

[0104] (2) Shake-flask conversion system:

[0105] The prepared whole-cell catalyst was suspended in 100 mM pH 7.0 PBS buffer to obtain wet cells;

[0106] 20 g / L wet cells were added to a reaction system containing 200 mM L-aspartate sodium and 100 mM glucose, and the transformation reaction was carried out at 30 °C for 24 h. The yield of tetrahydropyrimidine was measured, and the results are as follows: Figure 3 As shown.

[0107] The results showed that, 24 hours after transformation, the optimal recombinant strain was E. coli 6 (E. coli BL21(DE3) / pCDF-EctC / pRSF-EctB). T15S / T49A / Y293M -EctA) can produce 14.4 g / L tetrahydropyrimidine with a conversion rate of 46.5% (substrate feed: 31 g / L L-aspartate sodium, 18 g / L L-glucose).

[0108] Example 6: Construction of E. coli 7 to E. coli 16

[0109] The specific steps are as follows:

[0110] (1) Construction of gene expression vectors with different RBS levels

[0111] Based on the expression vectors with different gene copy numbers successfully constructed in Example 5, the optimal three-enzyme gene combination vector (pCDF-EctC / pRSF-EctB) was obtained by evaluating the biotransformation after biotransformation (Example 5) using sodium aspartate as a substrate. T15S / T49A / Y293M -EctA), designed 10 RBSs of different intensities (their sequence listing 4) to replace the RBS (native RBS, named RBS0) in the vector preceding the EctA gene, such as Figure 4 As shown.

[0112] pRSF-EctB T15S / T49A / Y293M In -RBS0-EctA, replace RBS0 with RBS1 to RBS1 respectively. 10 .

[0113] Table 4: RBS sequences used

[0114]

[0115] First, whole-plasmid PCR was performed. The PCR product was purified, and the original template was removed using DPNI. The digested product was transformed into BL21 competent cells, and colony PCR was performed to verify the correct bands before sequencing. Correct sequencing indicates successful construction of gene expression vectors at different RBS levels. A total of 10 recombinant bacteria were obtained, namely:

[0116] E.coli BL21(DE3) / pCDF-EctC / pRSF-EctB T15S / T49A / Y293M -RBS1-EctA, named E.coli7;

[0117] E.coli BL21(DE3) / pCDF-EctC / pRSF-EctB T15S / T49A / Y293M -RBS2-EctA, named E.coli8;

[0118] E.coli BL21(DE3) / pCDF-EctC / pRSF-EctB T15S / T49A / Y293M -RBS3-EctA, named E.coli9;

[0119] E.coli BL21(DE3) / pCDF-EctC / pRSF-EctB T15S / T49A / Y293M -RBS4-EctA, named E.coli10;

[0120] E.coli BL21(DE3) / pCDF-EctC / pRSF-EctB T15S / T49A / Y293M -RBS5-EctA, named E.coli11;

[0121] E.coli BL21(DE3) / pCDF-EctC / pRSF-EctB T15S / T49A / Y293M -RBS6-EctA, named E.coli12;

[0122] E.coli BL21(DE3) / pCDF-EctC / pRSF-EctB T15S / T49A / Y293M-RBS7-EctA, named E.coli13;

[0123] E.coli BL21(DE3) / pCDF-EctC / pRSF-EctB T15S / T49A / Y293M -RBS8-EctA, named E.coli14;

[0124] E.coli BL21(DE3) / pCDF-EctC / pRSF-EctB T15S / T49A / Y293M -RBS9-EctA, named E.coli15;

[0125] E.coli BL21(DE3) / pCDF-EctC / pRSF-EctB T15S / T49A / Y293M -RBS 10 -EctA, named E.coli16;

[0126] (2) Comparison of shake-flask transformation

[0127] The culture and transformation conditions for the recombinant bacteria are the same as in Example 5:

[0128] The prepared whole-cell catalyst was suspended in 100 mM pH 7.0 PBS buffer to obtain wet cells;

[0129] Add 20 g / L wet cells to a reaction system containing 200 mM L-aspartate sodium and 100 mM glucose, and perform the transformation reaction at 30 °C for 24 h.

[0130] Based on the yield determination of tetrahydropyrimidine, the results are as follows: Figure 5 As shown, after 24 hours of transformation, the optimal recombinant strain was E. coli 9 (E. coli BL21(DE3) / pCDF-EctC / pRSF-EctB). T15S / T49A / Y293M -RBS3-EctA) can produce 18.23 g / L tetrahydropyrimidine with a conversion rate of 58.8% (substrate feed: 31 g / L L-aspartate sodium, 18 g / L L-glucose).

[0131] Example 7: Fed-batch transformation of the optimal recombinant strain E. coli 9 in a 5L fermenter

[0132] The specific steps are as follows:

[0133] (1) Recombinant bacterial culture:

[0134] Recombinant E. coli strain 9 was selected for fermentation in a fermenter. Single clones were inoculated into 50 mL (250 mL shake flask) LB culture medium and cultured at 37 °C and 200 rpm for 10 h to serve as the seed culture for fermentation.

[0135] The pH was controlled at around 7.0 throughout the fermentation process. The volume of the fermentation tank was 2L. The fermentation medium consisted of: glucose 25g / L, yeast powder 10g / L, peptone 13g / L, disodium hydrogen phosphate 5g / L, potassium dihydrogen phosphate 3g / L, magnesium sulfate 3g / L, and ferrous sulfate 1g / L.

[0136] Inoculate the seed culture into the fermenter at an inoculum rate of 5% (v / v), maintain a dissolved oxygen level of 25 ± 1.5%, an aeration rate of 6 L / min, a stirring speed of 100-500 rpm, and incubate at 37°C until OD reaches 100%. 600 The concentration was 30, and IPTG was added to make the final concentration 0.4 mM. The cells were induced at 25°C for 18 h. After the induction was completed, the cells were collected by centrifugation at 8000 rpm for 10 min and stored at -20°C as whole-cell catalysts for biotransformation.

[0137] (2) 5L fermenter conversion (1L reaction system):

[0138] The whole-cell catalyst was suspended in 100mM PBS buffer to obtain wet cells;

[0139] The initial feed consisted of 200 mM L-aspartate sodium, 100 mM glucose, and 20 g / L wet cells. Then, every 4 hours, 200 mM L-aspartate sodium and 100 mM glucose were fed in turn, for a total of 4 feedings. The total feed amount was 155.08 g / L L-aspartate sodium and 90.08 g / L glucose.

[0140] The conversion was carried out at 30℃, and the pH was maintained at around 7.0 using 2M NaOH. The stirring speed was 400 rpm, and the reaction was carried out for a total of 24 hours. Samples were taken every 2 hours to detect the tetrahydropyrimidine content in the samples.

[0141] Based on the yield determination of tetrahydropyrimidine, the results are as follows: Figure 6 As shown, after 20 hours of conversion, the yield of tetrahydropyrimidine reached 87.36 g / L, with a conversion rate of 56.3% (co-flux of 155.08 g / L L-aspartate sodium).

[0142] The above results demonstrate that the technology of this invention employs genetic engineering techniques to precisely regulate the enzyme L-diaminobutyrate transaminase (EctB) in the tetrahydropyrimidine cascade pathway by altering the strength and plasmid copy number of RBS. T15S / T49A / Y293M The expression levels of L-diaminobutyric acid acetyltransferase (EctA) and tetrahydropyrimidine synthase (EctC) can effectively increase the yield of tetrahydropyrimidine.

[0143] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. An L-diaminobutyric acid transaminase mutant, characterized in that, The mutant is formed by mutating threonine at position 15 of L-diaminobutyric acid transaminase, as shown in SEQ ID NO.1, to serine, threonine at position 49 to alanine, and tyrosine at position 293 to methionine.

2. The gene encoding the mutant of claim 1.

3. A recombinant vector carrying the gene of claim 2.

4. Recombinant cells expressing the mutant of claim 1, or containing the gene of claim 2, or containing the recombinant vector of claim 3.

5. The recombinant cell according to claim 4, characterized in that, The recombinant cells use prokaryotic or eukaryotic cells as expression hosts.

6. A recombinant Escherichia coli, characterized in that, The recombinant Escherichia coli simultaneously overexpressed the L-diaminobutyric acid transaminase mutant of claim 1, the L-diaminobutyric acid acetyltransferase with the amino acid sequence shown in SEQ ID NO.3, and the tetrahydropyrimidine synthase with the amino acid sequence shown in SEQ ID NO.

4.

7. The recombinant Escherichia coli according to claim 6, characterized in that, The recombinant Escherichia coli is... E. coli BL21(DE3) is the expression host.

8. The recombinant Escherichia coli according to claim 7, characterized in that, Tetrahydropyrimidine synthase was overexpressed using the pCDF-Duet-1 vector, and L-diaminobutyric acid transaminase mutant and L-diaminobutyric acid acetyltransferase were overexpressed using the pRSF-Duet-1 vector. The RBS sequence CCGTGATTGACGCCGACAAACTGGATGACG was used to replace the AAGGAG in the vector preceding the L-diaminobutyric acid acetyltransferase gene.

9. A method for preparing tetrahydropyrimidine, characterized in that, Using the recombinant cells of claim 4 or 5 or the recombinant Escherichia coli of any one of claims 6 to 8 as whole-cell catalysts, and sodium aspartate and glucose as substrates, tetrahydropyrimidine is prepared by transformation; the recombinant cells also express L-diaminobutyric acid acetyltransferase with the amino acid sequence shown in SEQ ID NO.3 and tetrahydropyrimidine synthase with the amino acid sequence shown in SEQ ID NO.

4.

10. The method according to claim 9, characterized in that, The amount of sodium aspartate added is 100-200 mM, and the amount of glucose added is 50-100 mM.

11. The use of the L-diaminobutyric acid transaminase mutant of claim 1, or the gene of claim 2, or the recombinant vector of claim 3, or the recombinant cell of claim 4 or 5, or the recombinant Escherichia coli of any one of claims 6 to 8 in the preparation of tetrahydropyrimidine or products containing tetrahydropyrimidine.

Images