Use of ruxolitinib in the preparation of a medicament for treating intracranial fusiform aneurysms

Abstract

The application provides application of ruxolitinib in preparation of a drug for treating intracranial fusiform aneurysm and belongs to the technical field of biological medicine. The ruxolitinib inhibits activation of a JAK2-STAT path, reverses phenotypic transformation of vascular smooth muscle cells caused by a PDGFRbeta Y562D gene mutation, weakens proliferation and migration ability of the vascular smooth muscle cells caused by the PDGFRbeta Y562D gene mutation, and thus has a certain treatment effect on occurrence and development of the intracranial fusiform aneurysm.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of ruxolitinib in the preparation of drugs for treating intracranial fusiform aneurysms. Background Technology

[0002] Intracranial dissecting aneurysms (IDA) are a special type of intracranial aneurysm formed by the expansion of the vessel wall into surrounding tissues. Intracranial dissecting aneurysms are relatively rare compared to saccular aneurysms, with an incidence of 3-13%, primarily occurring in young patients. They commonly occur in the intracranial vertebrobasilar artery system, but can also involve the anterior circulation. The risk of rupture for dissecting aneurysms is higher than that for ordinary saccular intracranial aneurysms. Furthermore, dissecting aneurysms can cause brainstem and cranial nerve compression symptoms due to their mass effect, especially progressively enlarging intracranial dissecting aneurysms, which pose a greater threat to patients, making surgical and endovascular interventional treatments challenging. Therefore, research into the pathophysiological mechanisms of intracranial dissecting aneurysms and the identification of key pathogenic genes are crucial for developing safe and effective targeted interventions for this disease.

[0003] The pathogenesis of intracranial fusiform aneurysms is currently unclear. Pathologically, intracranial fusiform aneurysms are mainly characterized by the destruction of the internal elastic lamina and intermediate elastic lamina, accompanied by irregular arrangement of smooth muscle and degeneration of elastic fibers. Treatment drugs include nimodipine, mannitol, and aminocaproic acid. Nimodipine can dilate small cerebral blood vessels and improve the prognosis of hemorrhage in patients with aneurysms; mannitol can reduce intracranial pressure and improve cerebral edema; aminocaproic acid can inhibit fibrinolysis, and at high concentrations, it directly inhibits plasmin activity, achieving a hemostatic effect. No research has been reported on the application of ruxolitinib in intracranial fusiform aneurysms. Summary of the Invention

[0004] In view of this, the object of the present invention is to provide the use of ruxolitinib in the preparation of a drug for treating intracranial fusiform aneurysms, wherein ruxolitinib is able to inhibit the activation of the JAK2-STAT pathway in intracranial fusiform aneurysms and reverse the PDGFRβ in intracranial fusiform aneurysms. Y562D Phenotypic transformation of vascular smooth muscle cells caused by gene mutation has a significant therapeutic effect on intracranial fusiform aneurysms.

[0005] To solve the above-mentioned technical problems, the present invention provides the following technical solutions:

[0006] This invention provides the use of ruxolitinib in the preparation of drugs for treating intracranial fusiform aneurysms.

[0007] This invention provides the application of ruxolitinib in the preparation of drugs that inhibit JAK2-STAT pathway activation in intracranial fusiform aneurysms.

[0008] This invention provides the use of ruxolitinib in the preparation of PDGFRβ for reversing intracranial fusiform aneurysms. Y562D Application in drugs for phenotypic transformation of vascular smooth muscle cells caused by gene mutations.

[0009] Preferably, the effective concentration of ruxolitinib is 50 nM to 150 nM.

[0010] Preferably, the drug comprises a pharmaceutically acceptable carrier.

[0011] Preferably, the drug dosage form includes one of injection, tablet, pill, capsule, and granule.

[0012] This invention provides a drug for treating intracranial fusiform aneurysms, wherein the active pharmaceutical ingredient comprises ruxolitinib.

[0013] Preferably, the dosage of ruxolitinib is 50 nM to 150 nM.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] This invention, through laser microdissection, Sanger sequencing, and immunofluorescence detection of intracranial fusiform aneurysm samples, has for the first time discovered that intracranial fusiform aneurysms have a Y562D mutation in the PDGFRβ gene, and that the mutation is located in human brain vascular smooth muscle cells (HBVSMCs). This mutation leads to phenotypic transformation of vascular smooth muscle cells, and the mutated vascular smooth muscle cells have JAK2-STAT pathway activation.

[0016] This invention, through cell and animal experiments, found that ruxolitinib inhibits the activation of the JAK2-STAT pathway and weakens PDGFRβ. Y562D Mutant vascular smooth muscle cells (PDGFRβ) Y562D The proliferation and migration of HBVSMCs reversed PDGFRβ. Y562D Phenotypic transformation of gene-mutated vascular smooth muscle cells has a significant therapeutic effect on intracranial fusiform aneurysms. Attached Figure Description

[0017] Figure 1 Laser capture microdissection technique and Sanger sequencing results (a represents the sampling location of endothelial cell microdissection, b represents the sampling location of vascular smooth muscle microdissection).

[0018] Figure 2 PDGFRβ Y562DResults of somatic mutation-induced smooth muscle cell phenotypic regulation (A: Western blot results; B and C: RT-PCR results of changes in contraction and inflammatory markers (different test methods); D: Edu staining results; E: Statistical analysis of the proportion of positive cells in different groups; F: Scratch test results; G: Statistical analysis of wound healing rate (8H shrinkage area / 0H area) in different groups; ns in the figure indicates no significance, * indicates p<0.05, ** indicates p<0.01, *** indicates p<0.001, **** indicates p<0.0001).

[0019] Figure 3 The JAK2-STAT pathway is a mutant PDGFRβ pathway Y562D Results of studies on major downstream signaling pathways of PDGFRB (A: Markers of important downstream signaling pathways of PDGFRB (p-JAK, p-Src, p-Erk1 / 2 and p-PLCy) in FIA and NCA sections, scale bar 50 μm; B: Detection of p-STAT1 and p-STAT3 expression downstream of p-JAK2 in FIAs and NCAs by mIF, scale bar 50 μm; C: Statistical analysis of the average fluorescence intensity of different signaling markers between NCAs (n=4) and FIAs (n=5) in Figure A; D: Statistical analysis of the average fluorescence intensity between NCAs (n=4) and FIAs (n=5) in Figure B; E: Western blot detection of the expression of important downstream signaling pathway markers of PDGFRB in HBVSMCs under different treatments in vitro; F: Statistical analysis of immunoblotting results; In the figures, ns indicates no significance, * indicates p<0.05, ** indicates p<0.01, *** indicates p<0.001, and *** indicates p<0.0001.

[0020] Figure 4 Ruxolitinib reverses PDGFRB Y562D Results of induced HBVSMC phenotypic regulation (A and C: Western blot results; B: Statistical analysis of the relative density of immunoblot bands in Figure A; D: Statistical analysis of the relative density of marker bands associated with HBVSMC phenotypic transformation; E: rt-qPCR results of smooth muscle cell (SMC) markers and inflammatory markers in HBVSMCs under different treatment conditions; F: Edu staining results; G: Statistical analysis of the proportion of positive cells in different groups; H: Scratch test results; I: Statistical analysis of wound healing rate (area reduced at 8h / area at 0h) in different groups; T bars in the figure represent SD, ns indicate no significance, * indicates p<0.05, ** indicates p<0.01, *** indicates p<0.001, *** indicates p<0.0001).

[0021] Figure 5Ruxolitinib reverses PDGFRβ in zebrafish Y562D Phenotypic changes resulting from gene mutations (A: human WT / PDGFRβ) Y562D A: Timeline of mRNA treatment and drug administration; B: Immunostaining results of kdrt:eGFP+ cells and erythrocytes in the heads of 3dpf embryos treated with or without ruxolitinib; C: Statistical analysis results of kdr1 immunostaining in the heads of 3dpf zebrafish embryos; ns indicates no significant difference, * indicates P<0.05, ** indicates P<0.01, *** indicates P<0.001, **** indicates P<0.0001). Detailed Implementation

[0022] This invention provides the use of ruxolitinib in the preparation of drugs for treating intracranial fusiform aneurysms. The ruxolitinib described in this invention can be purchased commercially or prepared using conventional methods.

[0023] This invention provides the use of ruxolitinib in the preparation of drugs that inhibit JAK2-STAT pathway activation in intracranial fusiform aneurysms. The JAK2-STAT pathway activation described in this invention is caused by elevated levels of phosphorylated JAK2 (p-JAK2).

[0024] This invention provides the use of ruxolitinib in the preparation of PDGFRβ for reversing intracranial fusiform aneurysms. Y562D Application of PDGFRβ in drugs for phenotypic transformation of vascular smooth muscle cells caused by gene mutation. Y562D Gene mutation refers to a mutation at the Y562D site in the PDGFRβ gene.

[0025] The present invention also provides a medicament for treating ruxolitinib, wherein the active pharmaceutical ingredient comprises ruxolitinib.

[0026] In this invention, the effective concentration of ruxolitinib is 50 nM to 150 nM, preferably 100 nM.

[0027] In this invention, the drug comprises a pharmaceutically acceptable carrier. The pharmaceutically acceptable carriers of this invention include, but are not limited to, isotonic agents, buffers, flavoring agents, excipients, fillers, binders, disintegrants, lubricants, emulsifiers, solubilizers, antibacterial agents, analgesics, and antioxidants.

[0028] In this invention, the drug dosage forms include, but are not limited to, injections, tablets, pills, capsules, granules, creams, powders, etc.

[0029] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments thereof.

[0030] Example 1: Study on the pathogenesis of intracranial fusiform aneurysms

[0031] 1. Laser microdissection and Sanger sequencing

[0032] Intraoperative samples were taken from 7 patients with intracranial fusiform aneurysms (the patients in this trial signed written informed consent, and all procedures involved were approved by the Institutional Ethics Committee of Beijing Tiantan Hospital), and immediately fixed in 4% formalin solution, followed by paraffin embedding of the fixed tissue.

[0033] Three paraffin sections (5 μm thick) were excised from each of the seven samples and stained with hematoxylin and eosin. To determine whether the PDGFRβ mutation was located in vascular smooth muscle cells or vascular endothelial cells, the endothelial cell region and the vascular smooth muscle region were excised from the sections using a Veritas microdissection system (Arcturus Bioscience, MountainView, CA, USA). The excised tissues were collected onto LCM caps (Arcturus Bioscience).

[0034] The obtained cut tissue was mixed with tissue lysis buffer (Qiagen, Hilden) and heat-treated at 98°C for 15 min, followed by digestion with proteinase K at 56°C for 3 days. DNA was extracted using the DNeasy tissue and blood kit (Qiagen) (see instruction manual for detailed procedures). The extracted DNA was quantified using a NanoDrop ND-1000 fluorescence spectrometer (NanoDrop, Wilmington, DE). The PDGFRβ gene was amplified by PCR to a specific region (detection site chr5149505131). The PCR primers for PDGFRβ were designed using a modified version of Primer 3 software, and the primer sequences are as follows: forward: CCAGAGAAGGCAAGACACCA (SEQ ID No. 1), reverse: CTGAGACTCCCTCTGATAAC (SEQ ID No. 2). The PCR amplification products were purified by gel extraction and bidirectional sequencing was performed using an ABI 3730XL sequencer. After obtaining the sequence peak diagram, mutation analysis of the gene sequence was performed using SnapGene software.

[0035] Depend on Figure 1 As shown, intracranial fusiform aneurysms have a mutation at the Y562D site in the PDGFRβ gene, and the mutation is located in vascular smooth muscle cells.

[0036] 2. PDGFRB Y562D Mutations induce phenotypic regulation of human brain vascular smooth muscle cells

[0037] (1) Cell Culture: Human vascular smooth muscle cells (HBVSMCs, ScienceCell#1100) were seeded in culture flasks and cultured in complete smooth muscle cell culture medium (SMCM) supplemented with 10 ml fetal bovine serum (FBS), 5 ml smooth muscle cell growth supplement (SMCGS, Cat, #1152), and 5 ml penicillin / streptomycin solution (P / S, Cat, #0503) at 37°C (5% CO2). When the cells reached the logarithmic growth phase, they were digested and passaged using 0.25% trypsin (Scientific 25200056).

[0038] (2) Preparation of adenovirus: The wild-type and mutant (Y562D) gene sequences of PDGFRβ were synthesized respectively. Then, the genes constructed above were constructed into plasmid vectors respectively. AD293 cells were transfected with blank adenovirus and adenovirus containing the constructed genes above to obtain blank control adenovirus (pcADV-CMV-MCS-3xFLAG-IRES-mNeonGreen), wild-type adenovirus (pcADV-CMV-PDGFRB-3xFLAG-IRES-mNeonGreen) and mutant adenovirus (pcADV-CMV-PDGFRB(Y562D)-3xFLAG-IRES-mNeonGreen).

[0039] (3) Cell transfection and grouping: HBVSMC cells in the logarithmic growth phase of step (1) were collected and seeded into 6-well plates at a passage density of 1:3. When the cell density reached 80%, the adenoviruses prepared in step (2) (Control group, Wildtype group, and Y562D mutant group) were added at an MOI of 20. After 12 hours of transfection, the culture medium was changed and culture continued.

[0040] (4) Western blot detection: 48 h after transfection, the complete culture medium was discarded, and 1 ml of DPBS was added to each well for washing. RIPA cell lysis buffer (Sigma-Aldrich, St. Louis, USA) containing protease and phosphorylase inhibitors was then added, and the cells were lysed on ice for 30 min. The extracted protein samples were analyzed according to the BCA quantitative kit (Pierce) instructions, and the protein concentration of each sample was determined. Calculated amounts were added to 10% Precast-Gel precast gel (Solarbio PG01010) for electrophoresis, followed by transfer of the proteins to a 0.45 μm polyvinylidene fluoride (PVDF) membrane (Merck Millipore). The membrane was blocked with 5% skim milk for 1 h, and then incubated overnight with specific primary antibodies, including: anti-p-JAK2 (1:1000, #3771, CST), anti-p-STAT1 (1:1000, #9167, CST), and anti-p-STA. T3(1:1000,#9145,CST), anti-PDGFRβ(1:1000,#3169,CST), anti-α-SMA(1:1000,#19245,CST), anti-TAGLN( 1:1000,ab14106,Abcam), anti-MMP1(1:1000,ab137332,Abcam), anti-MMP9(1:1000,ab76003,Abcam), anti-V CAM1 (1:1000, ab134047, Abcam), anti-ICAM1 (1:1000, ab109361, Abcam), anti-GAPDH (1:2500, ab9485, Abcam), anti-p-Src (1:1000, #6943, CST), anti-p-PLCγ (1:1000, #14008, CST), anti-p-Erk1 / 2 (1:1000, #4370, CST). After washing three times with 1x TBST, the PVDF membrane was incubated with the horseradish peroxidase-conjugated secondary antibody for 1 hour, followed by four washes with 1x TBST. Immunoassay bands were visualized using an enhanced chemiluminescence reagent (WBKLS0500, Millipore, MA) according to the manufacturer's instructions.

[0041] (5) RT-PCR: According to the instructions, total RNA was extracted from cultured cells 48 h after transfection using Trizol reagent, dissolved in RNase-free water, and quantified using NanoDrop 2000. PrimeScript was used... TMRT reagent kit (Takara) and gDNA Eraser (Takara, Kyoto, Japan) were used to reverse engineer cDNA. TB Green Premix Ex Taq (Takara) and QuantStudio were employed. TM Quantitative real-time PCR was performed using an Applied Biosystems system. Primers were synthesized by Invitrogen, and their sequences are shown in Table 1. The expression of SMC markers (α-SMA and SM22a) and inflammatory markers (VCAM-1, ICAM1, MMP-9, and MMP1) was detected. Student's t-test and Benjamini-Hochberg correction were used to assess statistical significance.

[0042] Table 1 Primer sequences used for RT-PCR

[0043]

[0044]

[0045] (6) Cell proliferation experiment:

[0046] The 5-ethynyl-2'-deoxyuridine (EdU) assay kit (C0071S, Beyotime) was used for detection. After 48 hours of transfection into 6-well plates in step (3), 1x EdU was added to each well of each group, and the cells were cultured for another 2 hours. The cells were then fixed with paraformaldehyde, permeabilized with 0.3% Triton solution, and then Click reaction solution prepared according to the manufacturer's instructions was added to each well. After incubation in the dark for 1 hour, the cell nuclei were stained with DAPI (1:1000 in PBS) for 10 minutes in the dark. After washing three times, the cells were imaged under a fluorescence microscope (Nikon, TS100-F, Japan). The proportion of EdU-positive cells in five different fields of view in each group (control group, wild-type group, and mutant group) was statistically analyzed, and the differences were statistically analyzed using Dunn's test.

[0047] (7) Cell migration experiment:

[0048] Migration experiments were performed using Ibidi silica gel culture inserts (Ibidi, Martinsried, Germany). Cells cultured for 24 hours after transfection were digested with trypsin, and the cell concentration was adjusted to 6 × 10⁶ cells / day. 5Cells / ml. 70 μL of cell suspension was seeded into each well of the μ-Dish and incubated at 37°C with 5% CO2 for 12 h. After complete cell adhesion, the silicone insert was removed with sterile forceps, and 1 ml of serum-free culture medium was added. Wound closure was observed over 48 h. Images were taken at different time points using an inverted microscope (IX51, OL YMPUS, Japan) and evaluated using ImageJ software. The proportion of wound healing rate (area reduced at 8 h / area at 0 h) in five different fields of view for each group (control group, wild-type group, and mutant group) was statistically analyzed, and Dunn's test was used to assess statistical significance.

[0049] Depend on Figure 2 As shown, the expression of human brain vascular smooth muscle cell contraction markers α-SMA and SM22α, and secretion markers VCAM-1, ICAM1, MMP-9, and MMP-1 were detected by Western blot and RT-PCR, respectively. Western blot and RT-PCR revealed upregulation of inflammatory markers and decreased expression of SMC markers in HBVSMCs with overexpression of the Y562D gene in the PDGFRβ gene. Furthermore, PDGFRβ... Y562D -HBVSMCs exhibit enhanced migration and proliferation capabilities.

[0050] 3. PDGFRβ Y562D Mutation leading to JAK2-STAT pathway activation verification

[0051] (1) Immunohistochemical staining

[0052] Seven intracranial fusiform aneurysm specimens were fixed overnight in 4% formalin (4°C), followed by embedding and preparation of paraffin (4μm) sections. Sections were washed twice with PBS (Sigma-Aldrich, USA) for 15 min each time, infiltrated with 0.2%–0.5% Triton X-100 (Solarbio, China), blocked in 5% donkey serum (Jackson Lab, USA) for 1 h, and stained overnight with primary antibody. Primary antibody detection was performed using fluorescently labeled secondary antibody. After mounting with antifluorescent quenching mounting media, fluorescence images were acquired using a Zeiss LSM880NLO microscope, and synthetic images were obtained using a Zeiss Axio ScopeAl. Primary antibodies: anti-SMC (1:1000, #19245, CST), anti-STAT1 (1:1000, #9167, CST), anti-STAT3 (1:1000, #9145, CST), and anti-MMP-9 (1:1000, ab76003, Abcam). The Mann-Whitney U test was used to assess the statistical difference between NCA and FIA.

[0053] (2) Western blot detection: Take the cultured cells of each group 24h after transfection. The primary antibodies are anti-p-JAK2 (1:1000,#3771,CST), anti-p-Src (1:1000,#6943,CST), anti-p-PLCγ (1:1000,#14008,CST), anti-p-Erk1 / 2 (1:1000,#4370,CST), and anti-GAPDH (1:2500,ab9485,Abcam). The remaining steps are the same as step (4) of step 2 in this embodiment.

[0054] like Figure 3 As shown, the downstream pathway of PDGFRβ was detected using immunofluorescence. Elevated levels of phosphorylated JAK2 (p-JAK2) were detected in mutated HBVSMCs. Furthermore, PDGFRβ was detected in vitro using Western blot. Y562D - PDGFRβ is a major downstream pathway marker in HBVSMCs cells, and the results are consistent with the findings of immunofluorescence.

[0055] Example 2: Effect of ruxolitinib on intracranial fusiform aneurysms

[0056] Primary HBVSMCs were obtained from ScienCell and seeded in smooth muscle cell culture medium (SMCM, ScienCell) containing 2% smooth muscle cell growth supplement (SMCGS, ScienCell) and 5% fetal bovine serum (FBS, ScienCell), and cultured at 37°C and 5% CO2. Constructed blank adenovirus, wild-type adenovirus, and mutant adenovirus were transfected into HBVSMCs in logarithmic growth phase. 24 hours after transfection, the medium containing mutant adenovirus was replaced with intact medium. Ruxolitinib (Selleck brand, purchased from the MCE website) was directly added to the intact medium as the ruxolitinib group. Ruxolitinib was dissolved in dimethyl sulfoxide (DMSO) to prepare a solution, with 0.1% DMSO added to a portion. The medium containing ruxolitinib was changed daily to ensure continuous ruxolitinib action.

[0057] Immunoblotting and RT-qPCR showed that it is associated with PDGFRB. Y562D- Expression of markers related to HBVSMC phenotypic regulation. RT-qPCR results were analyzed using Student's t-test and Benjamini-Hochberg correction. Edu assays demonstrated the proliferation capacity of HBVSMCs after different treatments, and the proportion of Edu-positive cells from five different fields of view in each group was statistically analyzed. Statistical differences were detected using Dunn's test. Scratch assays demonstrated the proliferation capacity of HBVSMCs after different treatments, and the wound healing rate (area reduced at 8h / area at 0h) from five different fields of view in each group was statistically analyzed. Statistical differences were detected using Dunn's test. The experimental procedures for the above detection methods are the same as in Example 1.

[0058] Depend on Figure 4 As shown, ruxolitinib can restore PDGFRβ Y562D -HBVSMCs exhibit reduced contractile phenotypic markers (α-SMA and SM22α), decreased secretory phenotypic markers (VCAM-1, ICAM1, MMP-9, and MMP-1), and inhibited the JAK2-STAT pathway, thereby reversing PDGFRβ. Y562D The process of transforming human brain vascular smooth muscle cells; ruxolitinib attenuates PDGFRβ Y562D - The proliferation and migration capacity of HBVSMCs; these results together demonstrate the reversal effect of ruxolitinib on the phenotypic transformation of human brain vascular smooth muscle cells caused by the Y562D site mutation in the PDGFRβ gene, and its therapeutic effect on intracranial fusiform aneurysms.

[0059] Example 3: Ruxolitinib against PDGFRβ Y562D The effects of genetically modified zebrafish

[0060] To further investigate human PDGFRβ Y562D The effect of mutations on angiogenesis in vivo and the effect of ruxolitinib on PDGFRβ Y562D To investigate the reversal of the phenotype transformation in smooth muscle cells, kdrl:GFP+ zebrafish were used for GFP and ae1 immunofluorescence staining.

[0061] Zebrafish strain development: Tg(kdrl:eGFP) and AB strain zebrafish were used. All experiments involving zebrafish were approved by the Animal Ethics Committee of South China University of Technology. Zebrafish were housed under standard conditions with a 14-hour light-10-hour dark cycle and a temperature of 28.5°C.

[0062] Synthesis and zebrafish treatment of Y562D / WT human PDGFRβ mRNA: Using the PDGFRβpcDNA3.1-HA-C plasmid (YouBio, Changsha Zeqiong Biotechnology) as a template, PDGFRβ mRNA was synthesized using pre-designed Y562D point mutation primers. Y562D Plasmids were amplified by PCR. WT / Y562D human PDGFRB mRNA was transcribed in vitro from the WT / Y562D PDGFRB pcDNA3.1-HA-C plasmid using the mMESSAGE mMACHINETM T7 in vitro transcription kit (AM1344, Invitrogen). The WT / Y562D human PDGFRB mRNA (500 ng / μl) was injected into a single zebrafish zygote. From 24 h post-fertilization to 3 days post-fertilization, the embryos were immersed in egg water containing 800 nM ruxolitinib.

[0063] Immunofluorescence staining of zebrafish: To examine the spatial patterns of blood vessels and erythrocytes, embryos were stained with goat anti-GFP (1:400 dilution, Abcam) and rabbit anti-ae1 (1:400 dilution, donated by Professor Wen's laboratory, Hong Kong University of Science and Technology). GFP staining was visualized using Alexa Fluor goat anti-mouse-488 and Alexa Fluor goat anti-mouse-555 (1:400, Invitrogen). Immunofluorescence staining images of zebrafish were captured in dual-laser-channel mode using a Zeiss LSM800 laser scanning confocal microscope to observe the relative positions of blood vessels and erythrocytes. Statistical analysis of KDR1 immunostaining results in the heads of 3-day-of-life (dpf) zebrafish embryos was performed, and statistical significance was determined using Student's t-test and Benjamini-Hochberg correction.

[0064] Depend on Figure 5 As shown, the normal group phenotype was similar to the control group, while the abnormal group showed significant differences, especially in vascular morphology. No significant differences were observed between the WT group and the control group, but a large number of abnormal individuals (approximately 87%) were observed in the experimental group. In the ruxolitinib treatment group (+Y562D+Ruxo group), approximately 74% of embryos recovered to a normal state after ruxolitinib treatment. The Y562D mutation (+Y562D group) leads to severe abnormalities in zebrafish head morphology and intracranial vascular development, characterized by reduced head size, abnormal vascular morphology, and in more severe cases, hemorrhage, cranial developmental defects (such as missing eyes), and vascular malformations. This indicates that ruxolitinib treatment can largely reduce PDGFRβ... Y562DThe mutation-induced phenotype was restored to the wild-type phenotype. Therefore, ruxolitinib can be used as a therapeutic agent to reverse the pathogenic effect of the Y562D mutation in the PDGFRβ gene and has significant efficacy in the treatment of intracranial fusiform aneurysms.

[0065] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The use of ruxolitinib in the preparation of drugs for treating intracranial fusiform aneurysms, characterized in that, Ruxolitinib inhibits JAK2-STAT pathway activation in intracranial fusiform aneurysms; ruxolitinib reverses PDGFRβ in intracranial fusiform aneurysms. Y562D Phenotypic transformation of vascular smooth muscle cells caused by gene mutation.

2. The application as described in claim 1, characterized in that, The effective concentration of ruxolitinib is 50 nM to 150 nM.

3. The application as described in claim 1, characterized in that, The drug includes ruxolitinib and a pharmaceutically acceptable carrier.

4. The application as described in claim 1, characterized in that, The dosage form of the drug includes one of the following: injection, tablet, pill, capsule, and granule.

Images