Use of a lncrna and its downstream cascade in aromatase inhibitor-resistant er-positive breast cancer

Abstract

The application of a kind of lncRNA and its downstream cascade material in aromatase inhibitor (AI) resistant ER positive breast cancer. The long-chain non-coding RNA is a key regulatory factor for estrogen-independent breast cancer cell growth and proliferation. Based on the research route of the long-chain non-coding RNA, the inventors found that it can be used as a diagnostic marker for AI-resistant ER-positive breast cancer and AI treatment prognosis. It is expected to realize the corresponding diagnosis by using the long-chain non-coding RNA, so as to adjust the treatment strategy for the corresponding patients as soon as possible, so as to improve the corresponding treatment effect. Knocking down DIO3OS and PTBP1 can effectively inhibit the growth and proliferation of estrogen-independent AI-resistant breast cancer cells, and play a certain killing treatment role. It is expected to be applied in clinic to improve the treatment effect of AI-resistant ER-positive breast cancer, prolong the survival period of patients, reduce or avoid the recurrence of patients, and improve the survival rate.

Description

Technical Field

[0001] This invention relates to the field of tumor molecular biology, and more specifically, to the use of a lncRNA and its downstream cascade substances in aromatase inhibitor-resistant ER-positive breast cancer. Background Technology

[0002] Approximately 75% of breast cancer types express the estrogen receptor (ER), termed ER-positive breast cancer, and its occurrence and development primarily depend on estrogen stimulation. Therefore, depriving ER signaling is a key component of hormone therapy for ER-positive breast cancer. Third-generation aromatase inhibitors (AIs) are currently the standard first-line treatment for postmenopausal ER-positive breast cancer patients, offering advantages over tamoxifen. This advantage is particularly pronounced in postmenopausal women experiencing ovarian atrophy. Since aromatase in peripheral tissues catalyzes androgen precursors secreted by the adrenal glands, the primary source of estrogen, AIs initially inhibit endogenous estrogen production by specifically inactivating aromatase, thereby affecting the uncontrolled proliferation of breast cancer cells. However, the clinical efficacy rate of AI treatment is only 25%–45%, with many patients developing significant drug resistance in later stages of treatment, leading to disease progression and recurrence. Therefore, secondary resistance to AIs significantly limits its therapeutic effectiveness. Despite numerous studies on AI resistance, the molecular mechanisms underlying AI resistance remain unclear, leaving no effective therapeutic targets or technological solutions. Existing technologies urgently need to be further investigated to elucidate the mechanisms underlying AI resistance in breast cancer, in order to develop products or treatment plans that can diagnose, reverse, and enhance the efficacy of AI therapies, thereby improving the treatment sensitivity of ER-positive breast cancer and enhancing patient prognosis. Summary of the Invention

[0003] This invention aims to overcome at least one deficiency of the prior art and provides the use of long non-coding RNA (lncRNA) and its downstream cascade substances in the diagnosis and treatment of AI-resistant ER-positive breast cancer. This long non-coding RNA can serve as a biomarker to diagnose AI resistance in ER-positive breast cancer and the prognosis of corresponding patients. Simultaneously, this long non-coding RNA promotes the binding reaction of downstream PTBP1 to LDHA 3'UTR, enabling estrogen-independent proliferation of the corresponding ER-positive breast cancer cells. Based on this, the invention provides corresponding long non-coding RNA and its downstream binding reaction inhibitors to achieve corresponding killing and therapeutic effects, thereby improving the efficacy of AI treatment for this type of AI-resistant breast cancer.

[0004] One object of this invention is to provide the use of the aforementioned long non-coding RNA in the preparation of products for diagnosing AI-resistant ER-positive breast cancer, assessing prognosis of AI-resistant ER-positive breast cancer, and treating AI-resistant ER-positive breast cancer, wherein the long non-coding RNA is DIO3OS. In one embodiment of this invention, the long non-coding RNA DIO3OS is specifically upregulated in long-term estrogen deprivation (LTED) ER-positive breast cancer cells and AI-resistant ER-positive breast cancer tissues, and it is significantly associated with poor patient prognosis, thus enabling the corresponding diagnostic applications. Furthermore, knocking down the long non-coding RNA DIO3OS can also inhibit estrogen-independent growth and proliferation of LTED cells, achieving corresponding therapeutic effects. Similarly, for actual AI-resistant ER-positive breast cancer cells, which are also estrogen-independent, knocking out this long non-coding RNA is also beneficial for achieving corresponding therapeutic effects.

[0005] Another object of the present invention is to provide a diagnostic biomarker for AI resistance in ER-positive breast cancer, including lncRNA DIO3OS.

[0006] Another object of the present invention is to provide a long non-coding RNA detection reagent for use in the preparation of products for diagnosing AI-resistant breast cancer, wherein the long non-coding RNA is DIO3OS.

[0007] Furthermore, the product for diagnosing AI-resistant ER-positive breast cancer includes a real-time quantitative PCR detection reagent.

[0008] In one embodiment of the present invention, the expression level of DIO3OS can be detected by a detection reagent targeting DIO3OS, including a real-time PCR detection reagent. Combined with the aforementioned function of the long non-coding RNA marker, the detection reagent can be used to prepare a product for diagnosing AI-resistant breast cancer.

[0009] Furthermore, the product for diagnosing AI-resistant ER-positive breast cancer contains specific primers designed based on the nucleotide sequence of the long non-coding RNA DIO3OS for detecting the long non-coding RNA DIO3OS. In one or more embodiments of the present invention, DIO3OS can be successfully detected by real-time quantitative PCR using specific primers corresponding to the long non-coding RNA.

[0010] Furthermore, the specific primers include the primers described below: DIO3OS_Forward: 5'-AAGCCCAGCCCAATAGGAA-3' (sequence shown in SEQ ID NO.1); DIO3OS_Reverse: 5'-GGCCCAAGAAACAGCAACA-3' (sequence shown in SEQ ID NO.2).

[0011] Another object of the present invention is to provide the use of DIO3OS inhibitors in the preparation of products that inhibit aerobic glycolysis in AI-resistant ER-positive breast cancer, treat AI-resistant ER-positive breast cancer, enhance the sensitivity of ER-positive breast cancer to AI therapy, and / or reduce LDHA RNA stability. In one embodiment of the present invention, by silencing the expression of DIO3OS, aerobic glycolysis in the corresponding LTED cells can be inhibited, thereby inhibiting the growth and proliferation of estrogen-independent LTED breast cancer cells. Similarly, this is beneficial for enhancing the sensitivity of ER-positive breast cancer to AI therapy.

[0012] Furthermore, DIO3OS inhibitors include inhibitors designed based on the sequence contained in DIO3OS:Entrez GeneID:64150. Further, DIO3OS:Entrez GeneID:64150 corresponds to Ensembl ID: ENST00000554735.1.

[0013] Furthermore, DIO3OS inhibitors include LNA, siRNA, and / or shRNA that silence DIO3OS expression.

[0014] Furthermore, DIO3OS inhibitors include LNA, siRNA, and shRNA designed based on the sequence contained in DIO3OS: Entrez GeneID:64150 to silence DIO3OS expression;

[0015] Furthermore, DIO3OS inhibitors include LNA, siRNA, and shRNA that silence DIO3OS expression. In one embodiment of the invention, DIO3OS expression is effectively silenced by inducing RNase-H-mediated degradation via LNA. DIO3OS expression can also be effectively silenced via shRNA.

[0016] Furthermore, LNA includes: LNA-1: 5'-AGAAAGAGTGTGGATC-3' (sequence as shown in SEQ ID NO. 3); and / or, LNA-2: 5'-GACAAACGGCCAGTGG-3' (sequence as shown in SEQ ID NO. 4); and / or, LNA-3: 5'-GGTTAGTCACTGTAGA-3' (sequence as shown in SEQ ID NO. 5); and / or, LNA-4: 5'-CCATTCACCAGCACTC-3' (sequence as shown in SEQ ID NO. 6); and / or, LNA-5: 5'-CCGAGGTGTGGAGTGT-3' (sequence as shown in SEQ ID NO. 7); And / or, The shRNAs include: shRNA-1, with the sequence 5'-CAGTGACTAACCCAAACCA-3' (as shown in SEQ ID NO. 8); and / or, shRNA-2, with the sequence 5'-CCTCGGGACTCCATAATAT-3' (as shown in SEQ ID NO. 9); and / or, shRNA-3, with the sequence 5'-GCACCTGATCCACACTCTT-3' (as shown in SEQ ID NO. 10).

[0017] Another object of the present invention is to provide an expression vector containing the lncRNADIO3OS gene fragment.

[0018] Furthermore, the pcDNA3.1 vector carries the T7 promoter and contains lncRNA DIO3OS.

[0019] Another object of the present invention is to provide a lentiviral vector containing shRNA targeting lncRNA DIO3OS; further, the shRNA targeting lncRNA DIO3OS includes: shRNA-1, with the sequence 5'-CAGTGACTAACCCAAACCA-3' (sequence shown in SEQ ID NO. 8); and / or, shRNA-2, with the sequence 5'-CCTCGGGACTCCATAATAT-3' (sequence shown in SEQ ID NO. 9); and / or, shRNA-3, with the sequence 5'-GCACCTGATCCACACTCTT-3' (sequence shown in SEQ ID NO. 10).

[0020] Another object of this invention is to provide the use of PTBP1 inhibitors in the preparation of agents that inhibit aerobic glycolytic metabolism in AI-resistant ER-positive breast cancer, treat AI-resistant ER-positive breast cancer, enhance the sensitivity of AI-resistant ER-positive breast cancer to AI treatment, and / or reduce LDHA RNA stability. In one embodiment of this invention, the inventors discovered that the long non-coding RNA DIO3OS mainly promotes the binding of PTBP1 to the LDHA 3'UTR, thereby promoting LDHA mRNA stability and promoting glycolysis to ensure the growth and proliferation of estrogen-independent breast cancer cells. By inhibiting the expression of the PTBP1 gene, the inventors can effectively inhibit the aerobic glycolytic metabolism of estrogen-independent breast cancer cells, and also inhibit the growth and proliferation of the corresponding breast cancer cells, achieving an effective therapeutic effect. Similarly, for AI-resistant ER-positive breast cancer cells, which are estrogen-independent breast cancer cells, it can also achieve corresponding therapeutic and AI-sensitivity-enhancing effects.

[0021] Furthermore, PTBP1 inhibitors include inhibitors designed based on the sequence contained in PTBP1:Entrez GeneID:5725.

[0022] Furthermore, the PTBP1 inhibitor includes siRNA that silences PTBP1 expression; furthermore, the PTBP1 inhibitor includes siRNA designed based on the sequence contained in PTBP1:Entrez GeneID:5725 that silences PTBP1 expression.

[0023] Furthermore, siRNAs that silence PTBP1 expression include: si-PTBP1-1: 5'-GCACAGUGUUGAAGAUCAUTT-3' (sequence shown in SEQ ID NO. 11); And / or, si-PTBP1-2: 5'-CCCAAAGCCUCUUUAUUCUTT-3' (sequence as shown in SEQ ID NO. 12); and / or, si-PTBP1-3: 5'-GCCUCAACGUCAAGUACAATT-3' (sequence as shown in SEQ ID NO. 13); and / or, si-PTBP1-4: 5'-CCCUCAUUGACCUGCACAATT-3' (sequence as shown in SEQ ID NO. 14).

[0024] Another object of the present invention is to provide a pharmaceutical composition comprising a DIO3OS inhibitor and / or a PTBP1 inhibitor; further, and a pharmaceutically acceptable carrier.

[0025] Another object of the present invention is to provide a pharmaceutical composition comprising an LDHARNA stabilizer. The LDHARNA stabilizer includes a DIO3OS inhibitor and / or a PTBP1 inhibitor.

[0026] Furthermore, the pharmaceutical composition is an ER-positive breast cancer treatment drug; furthermore, the ER-positive breast cancer is AI-resistant ER-positive breast cancer.

[0027] Compared with existing technologies, the beneficial effects of this invention are as follows: It provides a key regulatory factor for the growth and proliferation of estrogen-independent ER-positive breast cancer cells, the long non-coding RNA DIO3OS, and studies its mechanism of action, discovering the binding of PTBP1 and the crucial role of this protein in LDHA mRNA. Based on this main research route, the inventors have found that it can serve as a predictive biomarker for AI resistance and prognosis in ER-positive breast cancer, and it is expected that this long non-coding RNA can be used to achieve corresponding diagnoses, thereby adjusting treatment strategies for corresponding patients as early as possible to improve the corresponding treatment effects. Simultaneously, the inventors of this application further studied the role of this long non-coding RNA and PTBP1 in promoting the growth and proliferation of estrogen-independent ER-positive breast cancer cells by knocking down DIO3OS and PTBP1, finding that knocking down DIO3OS and PTBP1 can effectively inhibit the growth and proliferation of estrogen-independent breast cancer cells (such as LTED cells), playing a certain role in killing and treating these cells. This application further clarifies the relationship between DIO3OS, PTBP1, and LDHA. Based on the research content of this invention, it is expected to provide a treatment strategy that effectively enhances the sensitivity of ER-positive breast cancer to AI therapy, based on this key long non-coding RNA. This is expected to be applied clinically to improve the treatment effect of AI-resistant ER-positive breast cancer, prolong patient survival, reduce or avoid recurrence, and improve survival rates. Attached Figure Description

[0028] Figure 1The results show that AI-resistant ER-positive breast cancer exhibits enhanced aerobic glycolysis and upregulation of lncRNA DIO3OS; among them, a, sequencing heatmap of expression profiles of ER-positive breast cancer tissues obtained from AI-sensitive and AI-resistant patients; b, GSEA results of differential gene expression profiles between AI-resistant and AI-sensitive ER-positive breast cancer; c, glucose uptake of MCF-7 / T47D LTED cells compared with parental cells that underwent one week of estrogen deprivation; d, lactate production of MCF-7 / T47D LTED cells compared with parental cells that underwent one week of estrogen deprivation; e, f, ECAR values ​​and calculated glycolytic capacity of MCF-7LTED(e) and T47D LTED(f) cells compared with their parental counterparts that underwent one week of estrogen deprivation; g, LC-MS analysis of MCF-7LTED cells and parental MCF-7 cells that underwent three days of estrogen deprivation; h, volcano plot of lncRNA sequencing data from ER-positive breast cancer tissues of AI-sensitive and AI-resistant patients; i, MCF-7 / T47D qRT-PCR of the top ten candidate lncRNAs in LTED cells and comparison with their parental counterparts; j, qRT-PCR of lncRNA DIO3OS in tumor tissues of AI-sensitive and AI-resistant ER-positive breast cancer patients; k, Representative ISH images of DIO3OS in paraffin-embedded ER-positive breast cancer tissues (n=257) (left) and correlation analysis between DIO3OS levels and AI treatment response (right); Tumor tissues obtained from AI-sensitive (n=133) and AI-resistant (n=124) ER-positive breast cancer patients, scale bar: 50 μm; l, Statistical analysis of AI-resistant and AI-sensitive ER-positive breast cancer tumor tissues under different DIO3OS expression states in the cohort; m, Kaplan-Meier survival curves for recurrence-free survival (left) and overall survival (right) of AI-treated ER-positive breast cancer patients with high (n=112) or low (n=145) DIO3OS expression levels; HR, hazard ratio; n, Recurrence-free survival (left), overall survival (right) of different clinical features (tumor size, Ki67 index, and metastatic status) and DIO3OS. A heatmap showing the correlation between AI treatment for ER-positive breast tumors with high expression and low expression of DIO3OS.

[0029] Figure 2The images show DIO3OS regulating the proliferation and aerobic glycolysis of LTED cells; a, Northern blot showing the DIO3OS knockdown efficacy in MCF-7 / T47D LTED cells, with DIO3OS knocked down via LNAs (left); Northern blot showing the DIO3OS overexpression efficacy in parental MCF-7 / T47D cells (right), with ACTB used as loading control RNA; b, c, growth curves of MCF-7 / T47D LTED cells transfected with control or DIO3OS LNAs (b) and parental MCF-7 / T47D cells transfected with control or DIO3OS overexpression plasmids (c); d, e, representative immunofluorescence images and quantifications of eduMCF-7LTED cells transfected with control or DIO3OS LNAs (d) and parental MCF-7 cells transfected with DIO3OS overexpression plasmids or control plasmids (e), scale bar: 50 μm; f, g, transfection with DIO3OS Representative images and quantifications of plate colony formation of MCF-7 / T47D LTED cells (f) with LNAs or control LNAs and parental MCF-7 / T47D cells (g) transfected with control or DIO3OS overexpression plasmids; h, i, ECAR values ​​of MCF-7 / T47D LTED cells transfected with control or DIO3OS LNAs; j, k, ECAR values ​​of parental MCF-7 / T47D cells transfected with control or DIO3OS overexpression plasmids; l, m, lactate production of MCF-7 / T47D LTED cells (l) transfected with control or DIO3OS LNAs and parental MCF-7 / T47D cells (m) transfected with control or DIO3OS overexpression plasmids.

[0030] Figure 3The interaction between DIO3OS and PTBP1 in the cell nucleus is shown; a, Biotin-RNA pull-down assay using full-length DIO3OS transcript (sense) and antisense RNA, followed by silver staining; the red box indicates the differential band; b, High-scoring mass spectra of the DIO3OS-binding protein PTBP1; c, Biotin-RNA pull-down assay followed by Western blotting, demonstrating the interaction between DIO3OS and PTBP1; d, RNA immunoprecipitation assay using anti-PTBP1 antibody, indicating the interaction between DIO3OS and PTBP1 in MCF-7 / T47D LTED cells; e, Fluorescence assessment of subcellular colocalization of DIO3OS and PTBP1 in MCF-7 / T47D LTED cells; DIO3OS and PTBP1 were detected by RNA FISH (green) and immunofluorescence (red) staining, respectively; Scale bar: 10 μm; f, g, Control or PTBP1. Cell count (f) and MTT assay (g) of siRNA-transfected MCF-7LTED cells; h, i, ECAR values ​​of MCF-7LTED cells (h) and T47DLTED cells (i) transfected with control or PTBP1 siRNA; j, glucose uptake of MCF-7 / T47DLTED cells transiently transfected with control or PTBP1 siRNA; k, lactate production of MCF-7 / T47DLTED cells transiently transfected with control or PTBP1 siRNA.

[0031] Figure 4 The results show that DIO3OS regulates LTED cell proliferation and glycolysis via PTBP1; a, lactate production in MCF-7 / T47D LTED cells co-transfected with control LNA / DIO3OS-targeted LNA and control vector / PTBP1 overexpression plasmid; b, c, ECAR values ​​of MCF-7LTED(b) and T47D LTED(c) cells; d, lactate production in parental MCF-7 / T47D cells transfected with control construct or co-transfected with DIO3OS expression plasmid and PTBP1 siRNA / control siRNA; e, f, ECAR values ​​of parental MCF-7(e) and T47D(f) cells; g, h, MCF-7 / T47D LTED cell count (g) and parental MCF-7 / T47D cell count (h); i, Edu-bound MCF-7LTED cell representative immunofluorescence image (left) and quantitative analysis (right); scale bar: 50 μm; j, MCF-7LTED cell plate colony formation representative image (left) and quantitative analysis (right).

[0032] Figure 5The interaction between DIO3OS and PTBP1 upregulates LDHA mRNA stability; a) Venn diagram of differential splicing events in MCF-7LTED cells transfected with control LNA / siRNA and DIO3OS LNA or PTBP1 siRNA; b) KEGG pathway analysis of differentially spliced ​​mRNA in DIO3OS or PTBP1 knockdown MCF-7LTED cells; c) LC-MS analysis of lactate production in MCF-7LTED cells; d) PCR and agarose gel electrophoresis of LDHA mRNA 5' / 3' UTR in MCF-7LTED cells; e) qRT-PCR of LDHA mRNA in MCF-7LTED cells; f) Western blot of LDHA expression in MCF-7LTED cells; g) Determination of LDHA expression in MCF-7LTED cells by using 10 μg / mL actinomycin D at specified time points. Half-life of mRNA under specified treatment; h, RNA immunoprecipitation assay with anti-PTBP1 antibody revealing the interaction between PTBP1 and LDHA variants carrying the 3'UTR in parental (left) and LTED (right) MCF-7 cells; i, full-length schematic diagram of two different LDHA variant expression plasmids, with the luciferase reporter plasmid fused with different LDHA-5'utr and 3'UTR regions; indicating the nucleotide positions of the LDHA-5'UTR and 3'UTR; j, Biotin-RNA pull-down followed by Western blotting demonstrating the interaction between PTBP1 and different LDHA variants (with or without the complete 3'UTR); k, RNA immunoprecipitation assay with anti-PTBP1 antibody revealing the interaction between PTBP1 and the LDHA 5' / 3'UTR in MCF-7LTED cells transfected with luciferase reporter plasmids fused with different LDHA UTRs; l, luciferase reporter gene assay in MCF-7LTED.

[0033] Figure 6The following data were observed: a) PCR and agarose gel electrophoresis of LDHA mRNA 5' / 3'UTR in parental MCF-7 / T47D cells and their LTD derivatives; b) determination of LDHA mRNA half-life in parental MCF-7 / T47D cells and their LTD derivatives at specified time points using 10 μg / mL actinomycin D; c) Western blotting of LDHA protein expression in parental MCF-7 / T47D cells and their LTD derivatives; d) qRT-PCR of LDHA mRNA 5' / 3'UTR in AI-sensitive or AI-resistant ER-positive breast cancer tissues; n = 18 replicates; e) LDHA mRNA expression in AI-sensitive or AI-resistant ER-positive breast cancer tissues. PCR and agarose gel of mRNA 5' / 3'UTR; n = 8 replicates; f, g, cell count (f) and lactate production (g) of parental MCF-7 / T47D cells transiently transfected with different LDHA variant expression plasmids or control vectors; h, i, ECAR values ​​of parental MCF-7 / T47D cells; j, illustration of the DIO3OS / PTBP1 / LDHA glycolysis cascade, demonstrating how stabilizing LDHA mRNA acts as a switch regulating glucose metabolism in ER-positive breast cancer adapting to LTED.

[0034] Figure 7The following data are presented: a) Growth curves of tumor xenografts in nude mice stably transfected with MCF-7 cells carrying plasmids overexpressing DIO3OS or control plasmids; b) Pretreatment of mice with low- or high-dose estrogen tablets; c) Tumor growth (b) or tumor weight (c) in mice orally injected with MCF-7 cells containing control or DIO3OS-overexpressing plasmids; d) Representative PET-CT scans of glucose accumulation in tumor xenografts. Scanned images from parental MCF-7 cells stably transfected with a plasmid overexpressing DIO3OS or a control plasmid under low- or high-dose estrogen treatment; PET-CT scans of mice were performed 8 weeks after tumor implantation; colored circles indicate tumor xenografts with the specified treatment; e, f, tumor growth (e) or tumor volume (f) in mice orally injected with MCF-7 cells containing a DIO3OS-overexpressing plasmid or a control vector without estrogen; g, representative PET-CT scan images of glucose accumulation in tumor xenografts, from mice treated with a plasmid overexpressing DIO3OS or a control vector without estrogen. Parental MCF-7 cells stably transfected with control plasmids without estrogen treatment; colored circles indicate tumor xenografts with DIO3OS overexpression; h, i, DIO3OS representative ISH staining and LDHA / Ki67 expression IHC staining (h) and quantitative analysis (i) in tumor xenografts stably transfected with parental MCF-7 cells overexpressing DIO3OS plasmids or control plasmids under low or high doses of estrogen; scale bar: 50 μm; j, MCF-7 LTED cells transfected with lenti-shDIO3OS or lenti-control plasmids by in situ injection. Growth curves of tumor xenografts in mice; mice pretreated with low-dose estrogen tablets; k, l, tumor growth (k) and tumor weight (l) in mice orally injected with MCF-7LTED cells transduced with lenti-shDIO3OS or lenti-control; m, representative PET-CT scan images of glucose accumulation in tumor xenografts from MCF-7LTED cells transduced with lenti-shDIO3OS or lenti-control; colored circles indicate xenografts with specified treatments; n, o, representative ISH staining of DIO3OS in MCF-7LTED cells transduced with lenti-shDIO3OS or lenti-control and IHC staining (n) and quantitative analysis of LDHA / Ki67 expression in xenografts; scale bar, 50 μm; each point represents one mouse (c, f, i, l, o).

[0035] Figure 8The AI-resistant ER-positive breast cancer exhibits enhanced aerobic glycolysis and upregulation of lncRNA DIO3OS; a, growth curves of MCF-7 / T47D LTED cells and parental MCF-7 / T47D cells; b, cell count of MCF-7 / T47D LTED cells; c, comparison of cells with their parental cells; d, 3'-RACE (left) and 5'-RACE (right) of DIO3OS; e, qRT-PCR detection of DIO3OS expression in the nucleus and cytoplasm of parental and LTED MCF-7 cells; MALAT-1 was used as a positive control for nuclear gene expression, while GAPDH RNA was used as a positive control for cytoplasmic gene expression; f, representative FISH image of nuclear localization of DIO3OS in MCF-7 / T47D LTED cells; scale bar, 10 μm; g, full-length DIO3OS cloned into the eukaryotic expression vector pcDNA3.1 with the N-terminal codon ATG in three expression modes; GFP was used as a positive control.

[0036] Figure 9 The following data are presented: a) qRT-PCR showing the DIO3OS regulation of LTED cell proliferation and aerobic glycolysis; b) qRT-PCR showing the efficiency of DIO3OS knockout in MCF-7 / T47D LTED cells with specified LNAs; c) MTT assay of parental MCF-7 / T47D LTED cells transfected with specified LNAs; d, e) representative immunofluorescence images and quantifications of EdU-bound T47D LTED cells (d) and parental T47D cells (e) with specified treatments; scale bar, 50 μm; f) representative immunofluorescence images and quantifications of Ki67 staining in MCF-7 / T47D LTED cells (transfected with specified LNAs); scale bar: 50 μm; g, h) glucose uptake (g) and lactate production (h) in MCF-7 / T47D LTED cells; i, j) cell count (i) and MTT assay of parental MCF-7 cells. Measurement (j); k, representative image and quantification of parental MCF-7 cell plate colony formation; l, representative immunofluorescence image (left) and quantification (right) of parental MCF-7 cells incorporating EdU; scale bar, 50 μm.

[0037] Figure 10The interaction of DIO3OS with PTBP1 in the cell nucleus is shown; A, qRT-PCR showing the knockdown efficiency of PTBP1 in MCF-7 / T47D LTED cells; b, Western blot showing the knockdown efficiency of PTBP1 in MCF-7 / T47D LTED cells; c, representative immunofluorescence images (left) and quantifications (right) of EdU-bound MCF-7LTED cells transfected with control or PTBP1 siRNA; scale bar, 50 μm.

[0038] Figure 11 A) Western blot analysis showing PTBP1 regulation of LTED cell proliferation and glycolysis; B) Representative images (left) and quantification (right) of T47D LTED cell colony formation on agar plates; C) and D) Representative immunofluorescence images and quantification of Edu-bound parental MCF-7(c) / T47D(d) cells; Scale bar: 50 μm; E) Representative images and quantification of parental MCF-7 / T47D cell colony formation on agar plates.

[0039] Figure 12 The results showed that DIO3OS and PTBP1 had almost no effect on the expression of other candidate genes related to glycolysis. a, Analysis of the production of glycolytic intermediates in MCF-7LTED cells by LC-MS; b, Figure 7 d. PCR products purified by gel extraction and their Sanger sequencing; c. qRT-PCR of other glycolysis-related candidate genes in MCF-7LTED cells; d. Western blot of PTBP1 expression in MCF-7LTED cells. Detailed Implementation

[0040] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0041] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments according to this application. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0042] The present invention will now be further illustrated with specific examples. The following embodiments are only for explaining the present invention and do not constitute a limitation thereof. The test samples and test procedures used in the following embodiments include the following (if the specific experimental conditions are not specified in the embodiments, they are usually performed according to conventional conditions or the conditions recommended by the reagent company; the reagents, consumables, etc. used in the following embodiments can be obtained commercially unless otherwise specified). Example 1

[0043] Materials and Methods

[0044] 1. Experimental reagents

[0045] Includes: EdU proliferation kit (Guangzhou Ribobio Biotechnology Co., Ltd.), ER antibody (8644) (CST Biotech, USA), G-418 (Geneticin) (Thermo Fisher Scientific, USA), LDHA antibody (3582) (CST Biotech, USA), LNA Oligo (Clontech, Denmark), pcDNA TM 3.1 (+) plasmid (Thermo Fisher Scientific, USA), PTBP1 antibody (57246) (CST Biosciences, USA), anastrozole (Sigma-Aldrich, USA), estrogen tablets (IRA Biosciences, USA), digoxigenin-labeled lncRNA DIO3OS probe (LGC Biosciences, USA), letrozole (Sigma-Aldrich, USA), phosphorylated (Ser118) ER antibody (2511) (CST Biosciences, USA), phosphorylated (Ser167) ER antibody (64508) (CST Biosciences, USA), donkey anti-rabbit IgG-Alexa Fluor 555 (Abcam Biosciences, UK), donkey anti-mouse IgG-Alexa Fluor 488 (Abcam Biosciences, UK), lentivirus (Suzhou Gemma Biosciences Co., Ltd.).

[0046] 2. Cell Culture and Processing

[0047] Parental MCF-7 and T47D human breast cancer cell lines were purchased from the American Type Culture Collection (ATCC) and cultured according to standard protocols. To establish AI-resistant cell lines, MCF-7 and T47D cells were placed in steroid-free, phenol red-free RPMI 1640 medium (Gibco) containing 10% dextran-carbon-peeled (DCC) fetal bovine serum (Hyclone). TM Cells are grown in DCC medium for at least 10 months to acquire AI resistance; the resulting cells are called LTED cells. For functional experiments, cells are cultured in DCC medium for 3–7 days. To assess AI drug sensitivity, 10 mg / L fresh medium is added every two days. -8 ~10 -4Letrozole (Sigma) and anastrozole (Sigma) were used to culture LTED cells, and the cells were counted using an automated cell counter (Countstar IC1000) on day 8.

[0048] 3. Patient tissue specimens

[0049] Tumor samples (n=257) were obtained from female patients diagnosed with ER-positive breast cancer who underwent surgical resection followed by AI therapy and signed informed consent forms at Sun Yat-sen Memorial Hospital, Sun Yat-sen University, between 2011 and 2018. All experiments in this embodiment were conducted under the approval and guidance of the internal review and ethics committee of Sun Yat-sen Memorial Hospital, Sun Yat-sen University. Specifically, acquired endocrine resistance in breast cancer in this embodiment includes: recurrence and metastasis after more than 2 years of endocrine therapy following breast cancer surgery, recurrence and metastasis within 1 year after the end of adjuvant endocrine therapy, or disease progression in metastatic breast cancer after more than 6 months of first-line endocrine therapy.

[0050] 4. Seahorse Analysis

[0051] Following the manufacturer's instructions, in vitro cell metabolic changes were analyzed using the Seahorse XF24 extracellular flux analyzer (SeahorseBioscience).

[0052] 5. Detection of glucose uptake, lactate production, and acetyl-CoA levels

[0053] Follow the instructions for the Glucose Uptake Assay Kit (ab136955, Abcam) to detect glucose uptake; follow the instructions for the Lactate Colorimetric Assay Kit II (K627-100, Biovision) to detect lactate production; and follow the instructions for the PicoProbe kit. TM The Acetyl CoA Assay Kit (#K317-100, BioVision) is used to detect acetyl-CoA levels.

[0054] 6. Rapid Amplification of cDNA Ends (RACE) at the 5' and 3' cDNA ends.

[0055] The 5' / 3' RACE experiment for DIO3OS RNA was performed using the SMARTer RACE 5' / 3' kit (#634860, Clontech) according to the manufacturer's instructions. The main procedures included: extracting the DIO3OS RNA template from MCF-7LTED cells and designing and synthesizing all gene-specific primers based on the sequence information from the UCSC Genome Browser (http: / / genome.ucsc.edu / ).

[0056] The primers required for the lncRNA DIO3OS 3'RACE and 5'RACE in this study are as follows: 3'GSP_F1: 5'-CGTCAAGCCCAGCCCAATAGGAAGCACCTG-3' (sequence shown in SEQ ID NO. 15); 3'GSP_F2: 5'-ACAGAATACACTCCACACCTCGGGACTCCA-3' (sequence shown in SEQ ID NO. 16); 3'GSP_F3: 5'-TGGAGGAGAGTGCTGGTGAATGGCAGGTGT-3' (sequence shown in SEQ ID NO. 17); 3'GSP_F4: 5'-AGGTGTGTGCCTCAGTGTCCTTGCTGCCA-3' (sequence shown in SEQ ID NO. 18); 5'GSP_R1: 5'-GGTCCCTGCCTGGTGCTGGTTTGGGTTAGT-3' (sequence shown in SEQ ID NO. 19); 5'GSP_R2: 5'-ACACCTGCCATTCACCAGCACTCTCCTCCA-3' (sequence shown in SEQ ID NO. 20); 5'GSP_R3: 5'-TGTAAGAGGGCAGGCAGAAAGGGAGGTGGG-3' (sequence shown in SEQ ID NO. 21); 5'GSP_R4: 5'-CCCTCCTGACCACTGGGATGGGACAAGACA-3' (sequence shown in SEQ ID NO. 22); Full Length_F: 5'-CTCTCGCCGCTTGCCTCG-3' (sequence shown in SEQ ID NO. 23); Full Length_R: 5'-CCTGGTGCTGGTTTGGGTTAGTC-3' (sequence shown in SEQ ID NO. 24).

[0057] 7. Northern Imprint.

[0058] Total RNA premixed with RNA loading buffer was loaded onto a 2% formaldehyde-MOPS agarose gel, separated by electrophoresis, and then transferred to a nylon membrane (GE Healthcare) and incubated for over 6 hours. Subsequently, the blot membrane was prehybridized at 52°C with DIG Easy Hyb buffer (#11796895001, Roche) for 30 minutes; and further incubated overnight with digoxigenin (DIG)-labeled DIO3OS LNA oligonucleotides (5DiGN / CCCAGAACAGATGACAGCCCT / 3DiG_N; ACTB, 5DiGN / CTCATTGTAGAAGGTGTGGTGCCA / 3DiG_N; Qiagen). Probe-target hybrids were detected using a DIG luminescence detection kit (#11363514910, Roche).

[0059] 8. RNA decay assay.

[0060] The treated cells were seeded into 6-well plates, and mRNA transcription was inhibited in the culture medium with 10 μg / mL actinomycin D (APExBio) to estimate the mRNA decay rate; an equal volume of DMSO was used as a negative control. The relative amount of specific mRNA remaining in each sample was correlated with mRNA degradation, and RNA was extracted at specific time points for further qRT-PCR analysis to obtain further detection results. The results were normalized to the expression level of the internal reference gene GAPDH in each sample.

[0061] 9. In vitro translation assay.

[0062] To generate the putative DIO3OS-GFP fusion protein, the full-length sequence of DIO3OS was amplified by reverse transcription PCR and then cloned into the mammalian expression vector pcDNA3.1 (which has a GFP fused to its C-terminus). After verification by Sanger sequencing, the fusion plasmid was used for cell transfection.

[0063] 10. Transfection and transduction of tumor cells.

[0064] The DIO3OS and DIO3OS-GFP fusion proteins, PTBP1, LDHA variants, luciferase-LDHA 5' / 3'UTR chimeric RNA in PCDNA3.1 plasmid, and pGL3 luciferase reporter plasmid were used for ectopic expression in cell lines.

[0065] Following the manufacturer's recommendations, cells were transfected with the specified LNA, siRNA, or plasmid using Lipofectamine 3000 (L3000008, Invitrogen). To screen for stable DIO3OS overexpressing cells, the medium was replaced every two days with fresh medium supplemented with 1 mg / ml G418 for at least two weeks. For tumor cell transduction, cells were seeded into six-well plates at approximately 40% confluence and transduced with lentiviral particles in combination with 8 μg / mL polybrene (Sigma) when the estimated multiple of infection (MOI) was 5. To select for stable DIO3OS knockdown cells, cells were treated with 5 μg / mL puromycin (Gibco) 72 hours post-transfection.

[0066] 11. Luciferase reporter gene assay

[0067] The pGL3 luciferase reporter plasmid carrying the estrogen receptor element (ERE) sequence or the pcDNA3.1 plasmid fused with luciferase-LDHA-5' / 3'UTR chimeric RNA was co-transfected into MCF-7 cells with the pRL-TK Renilla control construct (Promega). Luciferase activity was determined using a dual luciferase reporter assay system (#E1910, Promega) and normalized to Renilla luciferase activity.

[0068] 12. RNA interference

[0069] The locked nucleotide modification sequence (LNA) that interferes with lncRNA DIO3OS in this study TMGapmeR was purchased from Exiqon, and the siRNA interfering with PTBP1 was purchased from Gemma. The interference sequence information is shown below. Specific steps: 24 hours before transfection, seed cells in wells according to the required cell volume for subsequent experiments, with a cell confluence of approximately 30-60%. Dissolve LNA or siRNA in nuclease-free water according to the instructions, select an appropriate mixing ratio, and mix with Lipofectamine 3000 (Invitrogen) to form a complex. After standing for 5 minutes, add to serum-free Opti-MEM medium, mix thoroughly, and let stand at room temperature for 10 minutes. Change the cell culture medium, add the above mixture to the cells, shake carefully, and incubate at 37°C in a cell culture incubator containing 5% CO2. After 6-8 hours, discard the medium and replace with complete medium prepared with 10% FBS, and continue culturing for another 24-96 hours. 24-48 hours after transfection, cells can be harvested to extract RNA and detect gene interference; 48-72 hours after transfection, cells can be harvested to extract protein and detect protein interference efficiency. LNA and siRNA interference sequences (5'-3'): CtrlLNA: 5'-AACACGTCTATACGC-3' (sequence shown in SEQ ID NO. 25); LNA-1: 5'-AGAAAGAGTGTGGATC-3' (sequence shown in SEQ ID NO. 3); LNA-2: 5'-GACAAACGGCCAGTGG-3' (sequence shown in SEQ ID NO. 4); si-NC: 5'-GGGUUGUAGAGUGCAUAAATT-3' (sequence shown in SEQ ID NO. 26); si-PTBP1-1: 5'-GCACAGUGUUGAAGAUCAUTT-3' (sequence shown in SEQ ID NO. 11); si-PTBP1-2: 5'-CCCAAAGCCUCUUUAUUCUTT-3' (sequence shown in SEQ ID NO. 12). In addition, shRNAs for DIO3OS are involved, including the control Sh-Ctrl: 5'-TTCTCCGAACGTGTCACGT-3' (sequence shown in SEQ ID NO. 27). Sh-DIO3OS silencing DIO3OS includes: shRNA-1: 5'-CAGTGACTAACCCAAACCA-3' (sequence shown in SEQ ID NO. 8); shRNA-2: 5'-CCTCGGGACTCCATAATAT-3' (sequence shown in SEQ ID NO. 9).Specifically, in this embodiment, the LNA and shRNA sequences targeting DIO3OS were designed based on the DIO3OS: Entrez Gene ID: 64150 gene, and the siRNA sequence targeting PTBP1 was designed based on the PTBP1: Entrez Gene ID: 5725 gene. In addition to the aforementioned interference sequences, the inventors further used the following sequences targeting DIO3OS: LNA-3: 5'-GGTTAGTCACTGTAGA-3' (sequence shown in SEQ ID NO. 5); LNA-4: 5'-CCATTCACCAGCACTC-3' (sequence shown in SEQ ID NO. 6); LNA-5: 5'-CCGAGGTGTGGAGTGT-3' (sequence shown in SEQ ID NO. 7); and shRNA-3, with the sequence 5'-GCACCTGATCCACACTCTT-3' (sequence shown in SEQ ID NO. 10), to confirm the effectiveness of LNA or shRNA. The effectiveness of silencing expression was confirmed, and the results of parallel experiments after silencing were similar to those of the aforementioned sequence silencing experiments. Similarly, the effectiveness of silencing expression via siRNA was confirmed using si-PTBP1-3: 5'-GCCUCAACGUCAAGUACAATT-3' (sequence shown in SEQ ID NO. 13) and si-PTBP1-4: 5'-CCCUCAUUGACCUGCACAATT-3' (sequence shown in SEQ ID NO. 14), and the results of parallel experiments after silencing were similar to those of the aforementioned sequence silencing experiments.

[0070] 13. Reverse transcription to synthesize cDNA

[0071] RNA reverse transcription was performed using the PrimeScript reverse transcription kit. TM The experiment was performed using RT Master Mix (RR036A, TAKARA). All pipette tips, PCR tubes, and other experimental components were enzyme-free. The cDNA samples obtained from reverse transcription can be stored at -20°C.

[0072] 14. Real-Time Quantitative PCR (RT-qPCR)

[0073] Quantitative real-time PCR was performed using SYBR Premix Ex Taq. TM (RR420L, TAKARA). The cDNA samples synthesized by reverse transcription were diluted with ultrapure water before use. The gene primers used in the qPCR experiments in this study were designed using Primer Premier 6 software and ordered from Shanghai Jierui Biotechnology Co., Ltd. Internal control genes: ACTB, GAPDH, or HSP90; the calculation method used was 2-1. -ΔΔCtCalculation. The RT-qPCR gene primer sequences are as follows:

[0074] ACTB_Forward: 5'-GATGCGTTGTTACAGGAAGTCC-3' (sequence shown in SEQ ID NO. 28); ACTB_Reverse: 5'-GGCACGAAGGCTCATCATTCA-3' (sequence shown in SEQ ID NO. 29); DIO3OS_Forward: 5'-AGGCCCAGCCCAATAGGAA-3' (sequence shown in SEQ ID NO. 1); DIO3OS_Reverse: 5'-GGCCCAAGAAACAGCAACA-3' (sequence shown in SEQ ID NO. 2); GAPDH_Forward: 5'-ATCACCATCTTCCAGGAGCGA-3' (sequence shown in SEQ ID NO. 30); GAPDH_Reverse: 5'-CCTTCTCCATGGTGGTGAAGAC-3' (sequence shown in SEQ ID NO. 31); HSP90_Forward: 5'-CCAGTTTGGTGTCGGTTTCTAT-3' (sequence shown in SEQ ID NO. 32); HSP90_Reverse: 5'-CTGGGTATCGTTGTTGTGTTTTG-3' (sequence shown in SEQ ID NO. 33); LDHA_Forward: 5'-TTGACCTACGTGGCTTGGAAG-3' (sequence shown in SEQ ID NO. 34); LDHA_Reverse: 5'-GGTAACGGAATCGGGCTGAAT-3' (sequence shown in SEQ ID NO. 35); LDHA-203 3'UTR_Forward: 5'-AGGTGGAGGTTGTGCATGTTG-3' (sequence shown in SEQ ID NO. 36); LDHA-203 3'UTR_Reverse: 5'-GCAGTACGTACAGCATTGGCA-3' (sequence shown in SEQ ID NO. 37); LDHA-220 5'UTR_Forward: 5'-AGTGGCAAATACCCCCAAAGGA-3' (sequence shown in SEQ ID NO. 38); LDHA-220 5'UTR_Reverse: 5'-ATTCTGGGGGGTCTGTTCTTCC-3' (sequence shown in SEQ ID NO. 39); Luciferase_Forward: 5'-GATTGACAAGGATGGATGGC-3' (sequence shown in SEQ ID NO. 40); Luciferase_Reverse: 5'-CGTCATCGTCGGGAAGACCT-3' (sequence shown in SEQ ID NO. 41); MALAT-1_Forward: 5'-GTCATAACCAGCCTGGCAGT-3' (sequence shown in SEQ ID NO. 42); MALAT-1_Reverse: 5'-CGAAACATTGGCACACAGCA-3' (sequence shown in SEQ ID NO. 43); PTBP1_Forward: 5'-AGCGCGTGAAGATCCTGTTC-3' (sequence shown in SEQ ID NO. 44); PTBP1_Reverse: 5'-CAGGGGTGAGTTGCCGTAG-3' (sequence shown in SEQ ID NO. 45).

[0075] 15. Nucleocytoplasmic RNA separation, silver staining and protein mass spectrometry analysis, RNA immunoprecipitation (RIP), immunohistochemistry, rapid amplification of cDNA ends (RACE), EdU incorporation assay.

[0076] Nucleocytoplasmic RNA extraction: This study used PARIS TM RNA was extracted from the cytoplasm and nucleus using a kit (AM1921, Thermo Fisher Scientific). Silver staining and protein mass spectrometry analysis: Silver staining experiments were performed using the Pierce SilverStain for Mass Spectrometry (24600, Thermo) kit. Specific bands stained with silver on the PAGE gel were excised and recovered, and protein information in the bands was analyzed using Q-TOF mass spectrometry. RNA immunoprecipitation: Magna RIP was used in this experiment. TMThe kit (17-700, Millipore), pipette tips, EP tubes, solutions, and containers were all enzyme-free. Immunohistochemistry: Antibodies used in this procedure included LDHA antibody (rabbit anti-human, #3582, CST) and Ki67 antibody (mouse anti-human, ZM-0166, Zhongshan Jinqiao). Rapid amplification of cDNA ends (RACE): 5' / 3' RACE of DIO3OS RNA was performed according to the SMARTer RACE 5' / 3' kit (#634860, Clontech). EdU incorporation assay: Cell-Light EdU Apollo was used. The 567 in vitro imaging kit (#C10310-1; Guangzhou Ruibo Biotechnology Co., Ltd.) was used.

[0077] 16. Construction of overexpression vectors

[0078] ① Based on the full-length DIO3OS sequence obtained from the RACE experiment, CDS sequences targeting PTBP1, full-length sequences of different LDHA transcripts and their 5'UTR and 3'UTR sequences, and the sequence of the luciferase reporter gene were retrieved from the PubMed and UCSC gene databases. ② The restriction enzyme sites of the above sequences were analyzed one by one using DNAMAN software. Restriction enzyme sites contained in the target gene (fragment) were excluded from the multiple cloning site of the cloning vector pcDNA3.1(+), and two restriction endonuclease sites were selected. ③ Primers were designed directly at the start and end of the above gene (fragment) sequence, and then the corresponding restriction enzyme sites were added to the 5' end of the primers. ④ PCR amplification was performed using cellular cDNA as a template to obtain the target gene fragment. The product was electrophoresed, and the target fragment was recovered by gel extraction. ⑤ The fragment was digested with the two restriction endonucleases and purified. ⑥ The pcDNA3.1(+) vector was linearized by treating it with the same restriction enzyme sites, and after gel recovery, the vector was ligated with the purified fragment. ⑦ The product was used for competent cell transformation, followed by bacterial coating, single clone selection, culture shaking, plasmid extraction, and identification of positive clones by PCR and sequencing.

[0079] 17. RNA pull down

[0080] Follow the manufacturer's instructions to use MEGAscript. TM T7 Transcription Kit (#AM1333, Thermo Fisher Scientific) for in vitro transcription of Biotin-16-UTP-tagged DIO3OS RNA.

[0081] 18. RNA immunoprecipitation.

[0082] Using Magna RIP TMRNA-binding protein immunoprecipitation kit (#17-700, Millipore) was used for RNA immunoprecipitation assays according to the manufacturer's protocol.

[0083] 19. Lentiviral infection

[0084] The day before infection, 6cm 3 Plant tumor cells at an appropriate density in culture dishes. Discard the culture medium before infection and add fresh medium containing 8 μg / mL polybrene (Sigma) and lentiviral particles containing shRNA targeting DIO3OS (MOI: 100). Replace the medium after 6–8 hours of incubation. Retransfect after 24 hours to improve viral infection efficiency. Replace the medium with fresh medium (containing 5 μg / mL puromycin) after 72 hours, changing the medium every 2 days for at least 14 days until a cell line stably knocked down DIO3OS is selected. Finally, extract RNA or protein as described above to verify the knockdown efficiency and for related experimental detection.

[0085] 20. Polymerase Chain Reaction (PCR) PCR was performed using Premix Taq. TM Version 2.0 (R004A, TAKARA). The cDNA samples synthesized by reverse transcription were appropriately diluted with ultrapure water before use. All gene primers used in the PCR experiments were designed using Primer Premier 6 software and ordered from Shanghai Jierui Biotechnology Co., Ltd. Internal control gene: ACTB.

[0086] The primer sequences required for PCR are as follows: LDHA-220 5'UTR_Forward: 5'-Cctgtcattaggcctttcaact-3' (sequence shown in SEQ ID NO. 46); LDHA-220 5'UTR_Reverse: 5'-TGCCATATTGGACTTGGAACC-3' (sequence shown in SEQ ID NO. 47); LDHA-203 3'UTR_Forward: 5'-GGCTACAACAGGATTCTAGGTG-3' (sequence shown in SEQ ID NO. 48); LDHA-203 3'UTR_Reverse: 5'-CACACGGTAAACATCCACCT-3' (sequence shown in SEQ ID NO. 49); ACTB_Forward: 5'-GATGCGTTGTTACAGGAAGTCC-3' (sequence shown in SEQ ID NO. 28); ACTB_Reverse: 5'-GGCACGAAGGCTCATCATTCA-3' (sequence shown in SEQ ID NO. 29).

[0087] 21. Fluorescence in situ hybridization (FISH) of cellular RNA and in situ hybridization (ISH) of tissue RNA.

[0088] All pipette tips, EP tubes, solutions, and containers used in this experiment were enzyme-free. The DIO3OS probe was purchased from Qiagen; DIO3OS probe sequence: 5DiGN / CCCAGAACAGATGACAGCCCT / 3DiG_N; ACTB probe sequence: 5DiGN / CTCATTGTAGAAGGTGTGGTGCCA / 3DiG_N.

[0089] To perform co-localization analysis of di3os and PTBP1, fixed, infiltrated, and pre-hybridized cells were incubated overnight at 52°C with dig-labeled LNA di3os probes (final hybridization solution concentration 25 nm; Qiagen). Subsequently, they were incubated overnight at 4°C with anti-DIG-fluorescein (green, #11207741910, Roche) and anti-PTBP1 (#57246, CST) antibodies. Alexa Fluor 555 conjugated with secondary antibody (red, #A-21428, Thermo Fisher Scientific) was used for signal visualization. Cell nuclei were counterstained with Hochest 33342 (#H21492, Thermo Fisher Scientific), and high-resolution fluorescence images were obtained at 63x magnification using a confocal laser scanning microscope (LSM780 / 800, Zeiss).

[0090] For RNA ISH, paraffin-embedded tissue sections were dewaxed and rehydrated according to standard protocol. After digestion with 5% trypsin for 30 minutes, tumor sections were fixed with 4% paraformaldehyde (PFA) at room temperature and pre-hybridized with hybridization solution at 52°C for 2 hours. Subsequently, hybridization was performed using a 25 nM DIG-labeled DIO3OS-targeting probe in a humidified chamber at 52°C. Cell nuclei were counterstained with nuclear solid red solution, resulting in a blue-purple ISH signal. The DIO3OS staining index (SI) was calculated as the product of the proportion and intensity score of positively stained cells counted in at least 10 random fields (target value × 20). Specifically, the proportion of DIO3OS-positive tumor cells was categorized into five levels (0, no positive cells; 1, <25% DIO3OS-positive cells; 2, 25%–50% DIO3OS-positive cells; 3, 50%–75% DIO3OS-positive cells; 4, >75% DIO3OS-positive cells). Staining intensity was scored on a four-point scale (0, no DIO3OS staining; 1, weak DIO3OS staining; 2, moderate DIO3OS staining; 3, strong DIO3OS staining). DIO3OS expression was recorded from 0 to 12 according to SI, with optimal cutoff values ​​<3 (low) and ≥3 (high).

[0091] 22. Immunofluorescence and immunohistochemical staining.

[0092] Paraffin-embedded tumor sample sections were dewaxed and then subjected to antigen retrieval. For immunofluorescence staining, cells were fixed with 4% PFA for 15 minutes at room temperature, then infiltrated with 0.1% Triton X-100 in PBS for 5 minutes on ice. Cell-adhered slides or tissue sections were blocked with 5% BSA in PBS for 15 minutes at room temperature, then incubated overnight with primary antibody at 4°C. After incubation for 1 hour with secondary antibody conjugated with Alexa Fluor or HRP (at room temperature), samples were counterstained with Hoechst 33342. High-resolution fluorescence images were obtained using a confocal laser scanning microscope (LSM780 / 800, Zeiss).

[0093] For immunohistochemical staining, DAB was used for immunoassay according to the manufacturer's instructions. Immunohistochemical staining was observed under an Olympus BX51 microscope (Olympus, Tokyo, Japan). Ki67-positive cells were quantified using ImageJ software, with at least 5×200 magnified images per section. As previously described, staining scores for LDHA-positive cells were calculated based on their proportion and intensity in 10 random fields (target ×20).

[0094] 23. Animal experiments

[0095] Six-week-old female athymic BALB / c nude mice, purchased from Vital River Laboratories (Beijing), were housed under standard conditions in the specific pathogen-free (SPF) animal facility at the Laboratory Animal Resource Center of Sun Yat-sen University. All animal experiments were conducted according to the guidelines of the Institutional Animal Care and Use Committee (IACUC) of Sun Yat-sen University. Mice were initially ovariectomized and allowed 7 days to acclimatize before subcutaneous estrogen tablet implantation. One week later, mice were implanted with 1x10... 7 0.1 mL of sterile cell suspension (cells with altered or unchanged DIO3OS expression in Matrigel (BDBiosciences)) was injected orally into the fourth pair of mammary fat pads of nude mice. Tumor volume (mm3) was monitored weekly according to the formula width 2 × length / 2. Mice were sacrificed after eight weeks when the xenograft reached approximately 10 mm in diameter.

[0096] 24. Positron emission tomography (PET) / computed tomography imaging.

[0097] Glucose accumulation in nude mice carrying xenografts of breast tumors was detected using an Inveon micro PET / CT scanner (Siemens). All mice were fasted for at least 8 hours prior to the micro-PET scan, then anesthetized and injected via tail vein with 5 μCig-1 [18F]fluorodeoxyglucose (18F-FDG) loaded in saline (100 μL). Forty minutes later, a static 15-minute PET scan was performed for static acquisition. The acquired images were further corrected for attenuation, scattering, normalization, and camera dead time, and then co-registered with the micro-CT images using Inveon Research Workplace software according to the manufacturer's instructions. 18F-FDG tumor uptake measured in the three-dimensional region of interest (ROI) was determined based on the normalized uptake value (SUV).

[0098] 25. Statistical data

[0099] All statistical analyses in this study were performed using Microsoft Excel 2016, GraphPad Prism 8.0, SPSS version 20.0, R (v.4.0.3), and RStudio (v.1.3.1093). The exact number of n, the number of independent experiments with similar results, statistical tests, and p-values ​​are illustrated in the figures and legends. Error bars in the figures typically represent sd. or sem. All experiments were performed at least three times independently. Statistical differences between groups were analyzed using the two-tailed Student t-test or the Mann-Whitney test (for quantification of ISH staining), while comparisons between more than two groups were performed using two-tailed one-way ANOVA and Dunnett's or Sidak's multiple comparison tests. All clinical and pathological data were retrospectively collected and analyzed from medical records. Immunofluorescence or immunohistochemical staining of tumor tissue samples was quantified by researchers without prior knowledge of clinical data and experimental design. Using X-tile software (version 3.6.1, Yale University), the cutoff values ​​for clinical sample grouping were determined based on the AI-processed DIO3OS staining score of breast cancer tissue. Survival data were plotted as Kaplan-Meier curves and analyzed using the log-rank test. The chi-square (χ²) test was used to compare frequency differences between groups. A p-value <0.05 was considered statistically significant.

[0100] I. AI-resistant ER-positive breast cancer exhibits enhanced aerobic glycolytic activity.

[0101] To explore the molecular characteristics of AI-resistant ER-positive breast cancer, high-throughput RNA sequencing was performed to detect the transcriptomic profile (e.g., ...) of ER-positive breast cancer tissue derived from AI-adjuvant therapy patients. Figure 1As shown in a). Gene set enrichment analysis (GSEA) showed that the glycolytic pathway was positively enriched in AI-resistant tissues compared to the AI-sensitive group. Figure 1 b) indicates that glucose metabolism reprogramming occurred after AI treatment.

[0102] Long-term estrogen deprivation (LTED) has been widely used to simulate clinical AI resistance in ER-positive breast cancer cells. To investigate whether metabolic changes occur in AI-resistant ER-positive breast cancer cells, the inventors examined glucose uptake and extracellular lactate production (a key metabolite of glycolysis) in two AI-insensitive cell models, MCF-7LTED and T47DLTED. MCF-7LTED and T47DLTED cells were insensitive to estrogen deprivation and AI drug treatment (e.g., letrozole, anastrozole). Figure 8 As shown in a, 8b.

[0103] Compared with parental control cells cultured for a short period (7 days) in estrogen-deprived medium, LTED cells cultured for a longer period (at least ten months) showed significantly upregulated glucose uptake and lactate production. Figure 1 c, d). Furthermore, glycolytic flux measured by extracellular acidification rate (ECAR) indicated that LTED cells exhibited enhanced total glycolytic flux and glycolytic capacity compared to parental MCF-7 and T47D cells deprived of estrogen for 7 days. Figure 1 e, f).

[0104] To further identify the differences in metabolic profiles between the MCF-7 parent and LTED cells, liquid chromatography-mass spectrometry (LC-MS) was used to detect and screen glycolytic metabolites. For example... Figure 1 As shown in g, phosphoenolpyruvate and lactate were significantly upregulated in LTED cells compared to parental MCF-7 cells. Overall, the data indicate enhanced aerobic glycolysis in ER-positive breast cancer cells after prolonged estrogen deprivation via LTED.

[0105] II. LncRNA DIO3OS is upregulated in AI-resistant ER-positive breast cancer and is clinically associated with AI treatment resistance.

[0106] To identify potential regulators driving the changes in glycolysis induced by AI resistance, the inventors first analyzed mRNA expression profiles and found that neither upregulated nor downregulated protein-coding genes clustered in pathways related to glucose metabolism. Then, the inventors focused on differentially expressed lncRNAs (…). Figure 1h), most of which have unknown biological functions. A total of 60 differentially expressed lncRNA genes were identified between AI-sensitive and AI-resistant tumor tissues. In the AI-resistant group, 33 lncRNAs were upregulated more than two-fold, and 27 lncRNAs were downregulated. To narrow down the range of potential regulators, the expression levels of the top ten upregulated lncRNAs in MCF-7LTED and T47D LTED cells were examined by qRT-PCR.

[0107] DIO3OS (recorded in the Ensembl database, gene ID ENST00000554735.1) was found to be the only lncRNA consistently upregulated in both LTED cell lines, with its expression level upregulated approximately three-fold compared to its parental cells. Figure 1 i). Furthermore, among the four differentially expressed lncRNAs with statistical significance in the cell model, only DIO3OS was significantly increased in AI-resistant breast cancer tissues compared to tissues without clinical recurrence. Figure 1 Furthermore, Northern blotting confirmed that DIO3OS was expressed at a higher level in LTED cells compared to parental cells. Figure 8 c).

[0108] To further evaluate the clinical and pathological significance of DIO3OS, 257 paraffin-embedded tumor tissue samples were collected from ER-positive breast cancer patients who received postoperative AI therapy. In situ hybridization (ISH) assays showed that DIO3OS expression was significantly higher in tumor tissues from patients who developed AI resistance than in patients without clinical recurrence. Figure 1 k and 1l). More importantly, high DIO3OS levels were associated with poorer relapse-free survival (HR = 2.62, 95% CI: 1.85–3.71, P < 0.0001) and overall survival (HR = 2.445, 95% CI: 1.42–4.21, P = 0.0008) in these patients. Figure 1 Furthermore, DIO3OS expression was positively correlated with tumor size and Ki67 index, but not with lymph node or distant metastasis. Figure 1 In summary, these data indicate that DIO3OS is highly expressed in AI-resistant breast cancer tissues and is clinically associated with resistance to AI-based breast cancer treatment.

[0109] III. DIO3OS regulates the proliferation and aerobic glycolysis of LTED cells.

[0110] LncRNA DIO3OS is located on human chromosome 14 and is transcribed in the reverse direction starting from the DIO3 gene locus. The inventors identified DIO3OS as an intronless transcript of 3128 nucleotides using rapid amplification of the 5'- and 3'-cDNA ends (RACE) and Sanger sequencing. Figure 8 d). To clarify whether the DIO3OS transcript has protein-coding potential, epitope labeling analysis was performed on the putative protein of the green fluorescent protein (GFP) fusion, and it was confirmed that the DIO3OS-GFP fusion does not encode any protein product. Figure 8 g). To detect the subcellular localization of DIO3OS, the inventors extracted nuclear and cytoplasmic RNA fractions from parental LTEDMCF-7 cells; subsequent qRT-PCR demonstrated that DIO3OS was mainly located in the nucleus, with a small amount also expressed in the cytoplasm. Figure 8 e). This finding was further validated by fluorescence in situ hybridization (FISH) of DIO3OS. Figure 8 f) implies that DIO3OS may perform its biological functions in the cell nucleus.

[0111] To investigate the functional role of DIO3OS in AI resistance, we performed a loss-of-function / enhancement analysis. Due to the nuclear localization of DIO3OS, locked nucleonucleotides (LNAs) were used to silence its expression. Of the five LNAs, the two most effective were selected for further knockout experiments (knockout effects are shown in Figure 1). Figure 2 left figure and Figure 9 (as shown in a).

[0112] As shown by cell counting and MTT analysis results, silencing DIO3OS significantly inhibited the growth of MCF-7LTED and T47DLTED cells. Figure 2 b and Figure 9 c). More specifically, knockdown of DIO3OS in LTED cells reduced the proportion of proliferating cells, as observed in EdU proliferation experiments ( Figure 2 d and Figure 9 d) and Ki67 staining ( Figure 9 The results are shown in f).

[0113] Meanwhile, in plate cloning assays, the clonogenic ability of LTED cells decreased after DIO3OS silencing. Figure 2 f, g). Notably, cell counting, MTT assay, colony formation, and EdU proliferation assays (f, g) showed significant results. Figure 9The study found that DIO3OS knockout had almost no effect on the growth and proliferation of parental MCF-7 cells. DIO3OS expression was extremely low in parental T47D cells, and similarly, downregulation of DIO3OS did not affect the biological behavior of T47D cells.

[0114] Given the enhanced aerobic glycolysis in AI-resistant breast cancer, the inventors next evaluated the effect of silencing DIO3OS on glycolytic metabolism in these cells. Indeed, compared to control cells, knocking out DIO3OS significantly reduced ECAR levels and glycolytic capacity in MCF-7LTED and T47D LTED cells. Figure 2 Furthermore, both glucose uptake and lactate production assays consistently demonstrated that DIO3OS silencing in LTED cells significantly impaired their glucose uptake capacity. Figure 9 g) and lactate production level ( Figure 2 l).

[0115] In the gain-of-function analysis, the inventors transfected the pcDNA3.1 plasmid expressing DIO3OS into parental MCF-7 and T47D cells, and then screened them with G418 drug to establish stable DIO3OS overexpressing cells. Figure 2 a, right, Figure 9 b). Under estrogen-deficient conditions, MCF-7 and T47D cells overexpressing DIO3OS grew faster than cells transfected with an empty vector. Figure 2 c). EdU proliferation assays further demonstrated that DIO3OS overexpression promoted estrogen-free proliferation of parental MCF-7 and T47D cells. Figure 2 e and Figure 9 e). Furthermore, MCF-7 and T47D cells overexpressing DIO3OS exhibit enhanced clonogenic capacity under estrogen deficiency. Figure 2 g)

[0116] Furthermore, overexpression of DIO3OS in parental MCF-7 and T47D cells promotes glucose metabolism, resulting in higher ECAR levels. Figure 2 j, k), glucose intake ( Figure 9 h) and lactate production ( Figure 2 Overall, the data indicate that DIO3OS promotes estrogen-independent proliferation and aerobic glycolysis of ER-positive breast cancer cells.

[0117] IV. Interaction between DIO3OS and PTBP1 in the cell nucleus

[0118] To elucidate the molecular mechanism of DIO3OS in cancer metabolism, we combined RNA pulldown and in vitro transcription of biotin-labeled DIO3OS RNA to screen for DIO3OS interacting proteins. Specific bands (non-antense control RNA) with molecular weights between 55 and 70 kDa were obtained and analyzed by mass spectrometry (MS). Figure 3 A). Among all RNA-precipitated proteins, polypyrimidine region-binding protein 1 (PTBP1, an alternative splicing regulator) had the highest content and the widest sequence coverage. Figure 3 b). Western blotting further confirmed that PTBP1 specifically binds to DIO3OS (b). Figure 3 c). Furthermore, RNA immunoprecipitation (RNA-IP) using anti-PTBP1 antibody showed that the enrichment of DIO3OS in anti-PTBP1 immunoprecipitation was approximately 15 times greater than that of the control IP reaction using IgG in LTED cells. Figure 3 d).

[0119] Based on the nuclear localization of DIO3OS, FISH confocal microscopy and immunofluorescence staining further demonstrated that DIO3OS and PTBP1 had good co-localization in the nuclei of MCF-7LTED and T47D LTED cells. Figure 3 e). These data indicate that DIO3OS specifically binds to PTBP1 in the nucleus of LTED breast cancer cells.

[0120] PTBP1 regulates alternative splicing of many genes under certain conditions, resulting in a diverse range of RNA transcripts with different functions. PTBP1 has been reported to be involved in various processes of cancer progression, including cell proliferation and metabolic reprogramming. To investigate the role of PTBP1 in LTED cells, PTBP1 was knocked down using two siRNAs. Figure 10 A and 10B) revealed that LTED cell growth was significantly inhibited. Figure 3 f, g). Furthermore, EdU proliferation experiments confirmed that PTBP1 knockdown inhibited LTED cell proliferation (f, g). Figure 10 C).

[0121] The inventors then investigated whether silencing PTBP1 affected aerobic glycolysis in LTED cells. Consistent with the function of DIO3OS in LTED cells, knockout of PTBP1 reduced ECAR levels and glycolytic capacity in MCF-7LTED and T47D LTED cells. Figure 3 H and 3I); in PTBP1 knocked-down LETD cells, glucose uptake and lactate production were also impaired (H and 3I); Figure 3 J and 3K).

[0122] Specifically, DIO3OS interacts specifically with PTBP1, a splicing regulator that promotes the growth and aerobic glycolysis of LTED breast cancer cells.

[0123] V. DIO3OS regulates LTED cell proliferation and glycolysis via PTBP1.

[0124] To verify that DIO3OS functions through PTBP1, the inventors conducted a series of rescue experiments. First, MCF-7 / T47D LTED cells were transfected with control LNA or DIO3OS LNA, along with an empty vector or PTBP1 expression plasmid. Lactate production and ECAR levels were then measured. Compared to control LNA / empty vector transfected MCF-7 / T47D LTED cells, co-transfection with DIO3OS LNA and PTBP1 expression plasmid rescued the downregulation of DIO3OS, and no impaired lactate production was observed in PTBP1 overexpression cells. Figure 4 A). Similar results were also obtained from the glycolysis seahorse assay ( Figure 4 (B and 4C).

[0125] On the other hand, compared with control siRNAs, PTBP1 siRNA inhibited the increased lactate production and ECAR levels in parental MCF-7 cells overexpressing DIO3OS. Figure 4 d left side and 4e). The same result was also detected in T47D cells (d left side and 4e). Figure 4 d, right, and 4f).

[0126] In cell growth experiments, compared with the control group, DIO3OS LNA transfection resulted in a decrease in the number of cells in MCF-7LTED and T47D LTED cells, while PTBP1 overexpression almost restored cell growth to the control level. Figure 4 G). Silencing PTBP1 with siRNA can eliminate the enhanced cell growth caused by stable DIO3OS overexpression in parental MCF-7 and T47D cells. Figure 4 H). Similar cell proliferation results were obtained from the EdU proliferation assay. Figure 4 I and 11C, 11D).

[0127] Furthermore, PTBP1 upregulation salvaged the colony-forming ability of DIO3OS knockout LTED cells. Figure 4 j and Figure 11 b), and vice versa. Figure 11 e). In summary, DIO3OS regulates aerobic glycolysis and proliferation of LTED breast cancer cells via PTBP1.

[0128] VI. The interaction between DIO3OS and PTBP1 upregulates LDHA mRNA stability.

[0129] To explore how DIO3OS exerts its effects through interaction with PTBP1, two sets of high-throughput sequencing were used to compare the transcriptomic profiles of DIO3OS knockdown, PTBP1 knockdown MCF-7LTED cells, and control cells. Given that PTBP1 is a splicing regulator, the inventors focused primarily on alternative splicing events that consistently occurred in DIO3OS knockdown and PTBP1 knockdown cells. By taking the intersection of differentially occurring alternative splicing events, 1458 alternative splicing events occurring in 657 genes but not in control cells were identified. Figure 5 A). Further KEGG analysis revealed that many alternative splicing events occur in metabolic genes, including PFKP, ENO, and LDHA in the glycolysis / gluconeogenesis pathway. Figure 5 B). This result suggests that DIO3OS and PTBP1 may regulate alternative splicing of certain key glycolysis-related genes.

[0130] To narrow down the candidate genes, LC-MS was performed to screen glycolytic metabolites affected by DIO3OS and PTBP1. It was found that both D-glucose 6-phosphate (G6P) and lactate were significantly reduced after knockdown of DIO3OS and PTBP1. Figure 5 (C and 12A). Hexokinase 2 (HK2) and lactate dehydrogenase A (LDHA) are two key metabolic enzymes that catalyze the production of G6P and lactate, respectively. Tracing back to alternative splicing genes in DIO3OS and PTBP1 knockdown cells, in addition to LDHA, ALDH3A1, ALDOC, PFKP, and ENO3 also affect lactate production. Therefore, RT-PCR was used to examine splicing events of these genes after DIO3OS and PTBP1 knockdown, revealing that alternative splicing events occurred only in LDHA mRNA (C and 12A). Figure 5 d), but not in other glycolytic enzymes (data not shown).

[0131] LDHA is a key enzyme catalyzing the conversion of pyruvate to lactate, a crucial process in glycolysis. According to the ISOexpresso database, the most common LDHA transcript in breast cancer cells is LDHA-203, which has a 357-nt 5'UTR (UTR, untranslated region) and a 567-nt 3'UTR. The LDHA isoform encoded by this transcript has also been selected as a typical sequence, as shown in the UniProtKB database.

[0132] In addition to LDHA-203, a special LDHA transcript (LDHA-220) exists in DIO3OS / PTBP1 knockdown cells. This transcript has a shorter 5'UTR and, more importantly, lacks a 3'UTR. Figure 5 (D and 12B). To verify splicing events in the 5'UTR or 3'UTR of LDHA mRNA, RT-PCR was performed using specific primers, and the products were observed on an agarose gel. Figure 5 As shown in d, in LTED cells with downregulated DIO3OS or PTBP1 genes, the 3'UTR of LDHA-203 was significantly reduced, while the 5'UTR of LDHA-220 was upregulated, indicating that the LDHA-220 transcript with 3'UTR deletion was increased after downregulation of DIO3OS or PTBP1 genes.

[0133] To further demonstrate the effects of alternative splicing on RNA and protein expression, qRT-PCR was performed. The results showed that only LDHA exhibited reduced mRNA levels in DIO3OS and PTBP1 knockdown LTED cells, while PFKP, ALDOC, ENO3, or HK2 did not. Figure 5 E and 12c). Furthermore, Western blotting confirmed that LDHA protein levels continued to decrease after DIO3OS or PTBP1 knockdown. Figure 5 F). Accordingly, the inventors will conduct further research on LDHA in the following process.

[0134] The 5'UTR and 3'UTR contain important elements regulating mRNA processing. The 5'UTR has been reported to regulate transcription initiation, while the 3'UTR is more likely involved in mRNA transport and stabilization. To test whether DIO3OS and PTBP1 play a role in stabilizing LDHA mRNA, actinomycin D was used to inhibit mRNA transcription. In MCF-7LTED cells knocked down by DIO3OS or PTBP1, a significant decrease in LDHA mRNA stability was detected. Figure 5 G).

[0135] To further analyze the interaction between PTBP1 and LDHA mRNA, and the role of DIO3OS in this interaction, this invention first examined whether DIO3OS regulates PTBP1 expression. It was found that PTBP1 protein levels did not change after DIO3OS knockdown. Figure 12d). RNA-IP analysis was then performed to determine whether PTBP1 interacted with LDHA mRNA and whether DIO3OS affected this interaction. In parental MCF-7 cells transfected with the control vector, LDHA mRNA with the 3'UTR was approximately 5-fold enriched in anti-PTBP1 immunoprecipitate compared to IgG immunoprecipitate, while in DIO3OS-overexpressing MCF-7 cells, the amount of 3'UTR-containing LDHA mRNA recovered via anti-PTBP1 antibody was significantly increased to approximately 15-fold. Figure 5 H, left). Similarly, these RNA-protein (RNP) complexes were also detected in MCF-7LTED cells; compared with DIO3OS knockout cells, anti-PTBP1 immunoprecipitation yielded more LDHA mRNA with the 3'UTR in sh-Ctrl cells. Figure 5 (h, right). These data indicate that DIO3OS promotes the interaction between PTBP1 and LDHA mRNA carrying the 3'UTR.

[0136] To test whether PTBP1 directly binds to the 3'UTR of LDHA mRNA, two plasmids, LDHA-220 and LDHA-203, were constructed. Figure 5 I); As revealed by RNA pulldown analysis and Western blot analysis, in the total protein lysate analysis, the full-length LDHA-203 containing the 3'UTR showed a significantly stronger PTBP1 band compared to LDHA-220 and the antisense control. Figure 5 J).

[0137] It has been reported that PTBP1 binds to RNA via four short single-stranded pyrimidine motifs: UCUU, UCUUC, UUCUCU, and CUCUCU. Therefore, this invention searched for these motifs in the 3'UTR of LDHA-203, identifying six UCUU sequences within the 3'UTR sequence. Then, an LDHA-203 3'UTR mutant was generated by replacing TCTT with AGAA.

[0138] Western blot analysis after RNA pulldown showed that, unlike intact LDHA-203, LDHA-203 with the 3'UTR mutation failed to enrich PTBP1, similar to LDHA-203 with the 3'UTR deletion. Figure 5The UCUU sequence in the 3'UTR indicates the binding of LDHA-203 to PTBP1. To recreate the in vivo interaction between PTBP1 and the LDHA 3'UTR or 5'UTR, LTED cells were transfected with a chimeric reporter gene construct expressing luciferase, which fused to either the LDHA-203 3'UTR or the LDHA-220 5'UTR (negative control). Immunoprecipitation of the RNP complex with an anti-PTBP1 antibody and qRT-PCR showed that the luciferase chimeric transcript containing the 3'UTR was more enriched than the 5'UTR-luciferase reporter gene, confirming that PTBP1 preferentially binds to the LDHA mRNA 3'UTR in LTED cells, rather than the 5'UTR. Figure 5 K).

[0139] To further verify that DIO3OS regulates LDHA expression by binding PTBP1 to the LDHA 3'UTR, cells containing the luciferase gene bound to LDHA-220 5'UTR, LDHA-203 5'UTR, or LDHA-203 3'UTR were transfected. Figure 5 The reporter plasmid (I) was introduced into MCF-7 LTED cells with un-knocked DIO3OS, knocked-down DIO3OS, or PTBP1 overexpression. Luciferase reporter gene analysis showed that partial silencing of DIO3OS by LNA only resulted in decreased luciferase activity in cells expressing luc-3'UTR(LDHA-203), while luciferase activity was significantly restored in the luc-3'UTR(LDHA-203) construct in the presence of the PTBP1 overexpression plasmid. Figure 5 L). However, a similar phenomenon did not occur in constructions containing a 5'UTR ( Figure 5 l).

[0140] In summary, the results of this study indicate that DIO3OS promotes the binding of PTBP1 to the LDHA 3'UTR, protects LDHA mRNA from alternative splicing, and promotes LDHA stability and lactate production.

[0141] VII. Functional LDHA-203 is upregulated in LTED cells and AI-resistant breast cancer cells.

[0142] Next, the inventors examined whether these alternative splicing events of LDHA mRNA occurred in parental MCF-7 and T47D cells and their LTED derivatives. RT-PCR using specific primers targeting the 3'UTR of LDHA-203 and the 5'UTR of LDHA-220 showed that LDHA-220 containing the specific 5'UTR was mainly present in parental MCF-7 and T47D cells, while LDHA-203 containing the 3'UTR was significantly increased in LTED cells. Figure 6 a) indicates that LDHA-220 was replaced by LDHA-203 in parental cells after LTED treatment. To determine whether this alternative splicing affected the stability of LDHA mRNA in parental and LTED cells, the inventors inhibited mRNA transcription by treatment with actinomycin D. Subsequent qRT-PCR showed that the half-life of LDHA mRNA in LTED cells exceeded 10 hours, while the stability of LDHA mRNA in parental MCF-7 or T47D cells was significantly shortened (a). Figure 6 b). Meanwhile, compared to parental cells, LTED cells exhibited higher LDHA protein levels ( Figure 6 c).

[0143] Furthermore, the inventors used qRT-PCR to detect alternative splicing events of LDHA mRNA in breast tumor tissues from AI-sensitive and AI-resistant patients. Consistent with the results from cell lines, LDHA-203 (with a 3'UTR) expression was generally higher in AI-resistant breast cancer samples than in the AI-sensitive group, while LDHA-220 (with a unique 5'UTR) expression was more upregulated in the latter. Figure 6 d, e).

[0144] To further demonstrate the function of these two LDHA transcripts in ER-positive breast cancer cells, they were overexpressed in parental MCF-7 and T47D cells. Compared with the control group, overexpression of LDHA-203 (but not LDHA-220) significantly promoted the growth of parental MCF-7 and T47D cells. Figure 6 f). The effects of the two transcripts on lactate production and glycolysis were determined by lactate production and ECAR measurements. Figure 6 The results showed that cells expressing LDHA-203 exhibited enhanced lactate production. Figure 6 g) and a high level of ECAR ( Figure 6 h,i), on the contrary, LDHA-220 transfection did not enhance glycolysis in parental MCF-7 and T47D cells (h,i), Figure 6 (gi). That is, LDHA-203 is upregulated in AI-resistant breast cancer cells, which can increase lactic acid production during glycolysis.

[0145] In summary, lncRNA DIO3OS directly interacts with the PTBP1 protein in the cell nucleus and stabilizes LDHA mRNA by blocking alternative splicing in its 3'UTR, thereby upregulating LDHA expression and activating glycolytic metabolism in LTED and AI-resistant breast cancer cells. Figure 6 j).

[0146] 8. DIO3OS promotes the progression of ER-positive breast cancer in animals.

[0147] To further investigate whether DIO3OS regulates the development of ER-positive breast cancer in vivo, parental MCF-7 cells with or without DIO3OS overexpression were injected orally into ovariectomized nude mice. These mice had previously been treated with different doses of estrogen tablets, thus being divided into three groups with different doses. Compared with the control group, tumor growth of MCF-7 xenografts overexpressing DIO3OS was significantly promoted in the low-dose (0.18 mg) estrogen treatment group. Figure 7 ac). Furthermore, under high-dose (0.72 mg) estrogen conditions, DIO3OS overexpression also accelerated tumor growth. Figure 7 ac).

[0148] Furthermore, compared to the control group (2 / 10), overexpression of DIO3OS significantly enhanced tumorigenicity in nude mice (6 / 10) after complete estrogen deprivation via ovariectomy without estrogen therapy. Figure 7 e, f).

[0149] Scans were performed using positron emission tomography (PET-CT) and computed tomography (PET-CT). Figure 7 Evaluation (d, g) revealed enhanced accumulation of 18F-fluorodeoxyglucose (18FDG) in tumor xenografts from DIO3OS-overexpressing mice, regardless of estrogen administration. Figure 7 d, g).

[0150] Furthermore, compared with the control group, xenografts with upregulated DIO3OS expression exhibited more pronounced Ki67 staining, confirming the pro-tumor effect of DIO3OS in vivo. Figure 7 h,i). Simultaneously, immunohistochemistry detected higher LDHA expression in xenografts overexpressing DIO3OS (h,i). Figure 7 This result (h,i) is consistent with the increased glycolysis levels observed after DIO3OS overexpression. These results indicate that DIO3OS promotes estrogen-independent growth of ER-positive breast tumors in vivo.

[0151] Conversely, knockout of DIO3OS inhibited the growth of MCF-7 LTED xenografts. Figure 7 jl), reducing the accumulation of 18FDG ( Figure 7 m), and reduced the expression of LDHA and Ki67 in xenograft tumors of ovariectomized nude mice in the low-dose estrogen treatment group. Figure 7 (n,o). This indicates that DIO3OS positively regulates the proliferation and glucose metabolism of estrogen-independent breast cancer cells in vivo.

[0152] Overall, this study found that lncRNA DIO3OS expression was increased in ER-positive breast cancer cells subjected to long-term estrogen deprivation. Furthermore, it interacts with the nuclear splicing regulator PTBP1 to protect the 3'UTR of LDHA mRNA from selective splicing, thus ensuring its integrity and helping to maintain LDHA RNA stability. This leads to increased expression of LDHA protein to catalyze lactate production, resulting in upregulated aerobic glycolysis activity in tumor cells and ultimately promoting estrogen-independent growth and proliferation of ER-positive breast cancer cells. By intervening in DIO3OS / PTBP1 expression, aerobic glycolysis and growth / proliferation in ER-positive breast cancer LTED cells can be effectively regulated, potentially reversing breast cancer cell tolerance to AI drugs.

[0153] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the technical solution of the present invention, and are not intended to limit the specific implementation of the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the claims of the present invention should be included within the protection scope of the claims of the present invention. SEQUENCE LISTING <110> Sun Yat-sen Memorial Hospital, Sun Yat-sen University <120> Use of a lncRNA and its downstream cascade in aromatase inhibitor-resistant ER-positive breast cancer <130> <160> 49 <170> PatentIn version 3.3 <210> 1 <211> 19 <212> DNA <213> unknown <400> 1 aagcccagcc caataggaa 19 <210> 2 <211> 19 <212> DNA <213> unknown <400> 2 ggcccaagaa acagcaaca 19 <210> 3 <211> 16 <212> DNA <213> unknown <400> 3 agaaagagtg tggatc 16 <210> 4 <211> 16 <212> DNA <213> unknown <400> 4 gacaaacggc cagtgg 16 <210> 5 <211> 16 <212> DNA <213> unknown <400> 5 ggttagtcac tgtaga 16 <210> 6 <211> 16 <212> DNA <213> unknown <400> 6 ccattcacca gcactc 16 <210> 7 <211> 16 <212> DNA <213> unknown <400> 7 ccgaggtgtg gagtgt 16 <210> 8 <211> 19 <212> DNA <213> unknown <400> 8 cagtgactaa cccaaacca 19 <210> 9 <211> 19 <212> DNA <213> unknown <400> 9 cctcgggact ccataatat 19 <210> 10 <211> 19 <212> DNA <213> Unknown <400> 10 gcacctgatc cacactctt 19 <210> 11 <211> 21 <212> DNA <213> Unknown <400> 11 gcacaguguu gaagaucaut t 21 <210> 12 <211> 21 <212> DNA <213> Unknown <400> 12 cccaaagccu cuuuauucut t 21 <210> 13 <211> 21 <212> DNA <213> Unknown <400> 13 gccucaacgu caaguacaat t 21 <210> 14 <211> 21 <212> DNA <213> Unknown <400> 14 cccucauuga ccugcacaat t 21 <210> 15 <211> 30 <212> DNA <213> Unknown <400> 15 cgtcaagccc agcccaatag gaagcacctg 30 <210> 16 <211> 30 <212> DNA <213> Unknown <400> 16 acagaataca ctccacacct cgggactcca 30 <210> 17 <211> 30 <212> DNA <213> Unknown <400> 17 tggaggagag tgctggtgaa tggcaggtgt 30 <210> 18 <211> 29 <212> DNA <213> Unknown <400> 18 aggtgtgtgc ctcagtgtcc ttgctgcca 29 <210> 19 <211> 30 <212> DNA <213> Unknown <400> 19 ggtccctgcc tggtgctggt ttgggttagt 30 <210> 20 <211> 30 <212> DNA <213> Unknown <400> 20 acacctgcca ttcaccagca ctctcctcca 30 <210> 21 <211> 30 <212> DNA <213> Unknown <400> 21 tgtaagaggg caggcagaaa gggaggtggg 30[[ID=,64]] <210> 22 <211> 30 <212> DNA <213> Unknown <400> 22 ccctcctgac cactgggatg ggacaagaca 30 <210> twenty three <211> 18 <212> DNA <213> unknown <400> twenty three ctctcgccgc ttgcctcg 18 <210> twenty four <211> twenty three <212> DNA <213> unknown <400> twenty four cctggtgctg gtttgggtta gtc 23 <210> 25 <211> 15 <212> DNA <213> unknown <400> 25 aacacgtcta tacgc 15 <210> 26 <211> twenty one <212> DNA <213> unknown <400> 26 ggguuguaga gugcauaaat t 21 <210> 27 <211> 19 <212> DNA <213> unknown <400> 27 ttctccgaac gtgtcacgt 19 <210> 28 <211> twenty two <212> DNA <213> unknown <400> 28 gatgcgttgt tacaggaagt cc 22 <210> 29 <211> twenty one <212> DNA <213> unknown <400> 29 ggcacgaagg ctcatcattc a 21 <210> 30 <211> 21 <212> DNA <213> Unknown <400> 30 atcaccatct tccaggagcg a 21 <210> 31 <211> 22 <212> DNA <213> Unknown <400> 31 ccttctccat ggtggtgaag ac 22 <210> 32 <211> 22 <212> DNA <213> Unknown <400> 32 ccagtttggt gtcggtttct at 22 <210> 33 <211> 23 <212> DNA <213> Unknown <400> 33 ctgggtatcg ttgttgtgtt ttg 23 <210> 34 <211> 21 <212> DNA <213> Unknown<(...)><400> 34 ttgacctacg tggcttggaa g 21 <210> 35 <211> 21 <212> DNA <213> Unknown <400> 35 ggtaacggaa tcgggctgaa t 21 <210> 36 <211> 21 <212> DNA <213> Unknown <400> 36 aggtggaggt tgtgcatgtt g 21 <210> 37 <211> 21 <212> DNA <213> Unknown <400> 37 gcagtacgta cagcattggc a 21 <210> 38 <211> 22 <212> DNA <213> Unknown <400> 38 agtggcaaat acccccaaag ga 22 <210> 39 <211> 22 <212> DNA <213> Unknown <400> 39 attctggggg gtctgttctt cc 22 <210> 40 <211> 20 <212> DNA <213> Unknown <400> 40 gattgacaag gatggatggc 20 <210> 41 <211> 20 <212> DNA <213> Unknown <400> 41 cgtcatcgtc gggaagacct 20 <210> 42 <211> 20 <212> DNA <213> Unknown <400> 42 gtcataacca gcctggcagt 20 <210> 43 <211> 20 <212> DNA <213> Unknown <400> 43 cgaaacattg gcacacagca 20 <210> 44 <211> 20 <212> DNA <213> Unknown <400> 44 agcgcgtgaa gatcctgttc 20 <210> 45 [[ID=S17]]<211> 19 <212> DNA <213> Unknown <400> 45 caggggtgag ttgccgtag 19 <210> 46 <211> 22 <212> DNA <213> Unknown <400> 46 cctgtcatta ggcctttcaa ct 22 <210> 47 <211> 21 <212> DNA <213> Unknown <400> 47 tgccatattg gacttggaac c 21 <210> 48 <211> 22 <212> DNA <213> Unknown <400> 48 ggctacaaca ggattctagg tg 22 <210> 49 <211> 20 <212> DNA <213> Unknown <400> 49 cacacggtaa acatccacct 20

Claims

1. Use of a lncRNA detection reagent in the preparation of a product for diagnosing aromatase inhibitor resistance in ER-positive breast cancer, wherein the lncRNA is DIO3OS.

2. The use according to claim 1, characterized in that, The products used to diagnose aromatase inhibitor resistance in ER-positive breast cancer include real-time quantitative PCR detection reagents.

3. The use according to claim 1, characterized in that, The product for diagnosing aromatase inhibitor resistance in ER-positive breast cancer contains specific primers designed based on the lncRNA DIO3OS nucleotide sequence for detecting the lncRNA DIO3OS; the specific primers include the following primers: DIO3OS_Forward, with the sequence shown in SEQ ID NO.1; and DIO3OS_Reverse, with the sequence shown in SEQ ID NO.

2.

4. Use of DIO3OS inhibitors in the preparation of products that inhibit aerobic glycolysis in aromatase inhibitor-resistant ER-positive breast cancer, enhance the sensitivity of aromatase inhibitor-resistant ER-positive breast cancer to aromatase inhibitor therapy, and / or reduce the stability of LDHA RNA in aromatase inhibitor-resistant ER-positive breast cancer. The DIO3OS inhibitors include LNA and / or shRNA that silence DIO3OS expression; The DIO3OS inhibitors include LNAs or shRNAs designed to silence DIO3OS expression based on the sequence contained in DIO3OS: Entrez GeneID: 64150; The LNA includes: LNA-1, sequence as shown in SEQ ID NO.3; Alternatively, LNA-2, with the sequence shown in SEQ ID NO.4; Alternatively, the shRNA may include: shRNA-1, the sequence of which is shown in SEQ ID NO.8; Alternatively, shRNA-2, the sequence of which is shown in SEQ ID NO.

9.

5. A lentiviral vector, characterized in that, The shRNA contains a target lncRNA DIO3OS; the shRNA includes: shRNA-1, the sequence of which is shown in SEQ ID NO.8; and / or, shRNA-2, the sequence of which is shown in SEQ ID NO.

9.

6. Use of PTBP1 inhibitors in the preparation of pharmaceutical agents that inhibit aerobic glycolysis in aromatase inhibitor-resistant ER-positive breast cancer, enhance the sensitivity of aromatase inhibitor-resistant ER-positive breast cancer to aromatase inhibitor therapy, and / or reduce the stability of LDHA RNA in aromatase inhibitor-resistant ER-positive breast cancer. The PTBP1 inhibitor includes siRNA that silences PTBP1 expression; the PTBP1 inhibitor includes siRNA designed based on the sequence contained in PTBP1:EntrezGeneID:5725 to silence PTBP1 expression; The siRNA includes: si-PTBP1-1, the sequence is shown in SEQ ID NO.11; Alternatively, si-PTBP1-2, the sequence is shown in SEQ ID NO.12; Alternatively, si-PTBP1-3, the sequence is shown in SEQ ID NO.13; Alternatively, si-PTBP1-4, the sequence is shown in SEQ ID NO.14.

Images