Use of a substance inhibiting ploD2 in the manufacture of a medicament for treating liver cancer
By inhibiting the expression and activity of PLOD2 protein, and using siRNA, shRNA, or gRNA targeting PLOD2, as well as drugs prepared with minoxidil, the problem of poor efficacy of existing liver cancer treatments against liver cancer growth and metastasis has been solved. This approach has achieved significant inhibition of the proliferation, migration, and invasion of liver cancer cells, providing a new and effective treatment option for liver cancer.
Patent Information
- Application Number
- CN202210427060.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-04-21
- Publication Date
- 2026-06-12
- Estimated Expiration
- 2042-04-21
Smart Images

Figure CN116966306B_ABST
Abstract
Description
Technical Field
[0001] This disclosure relates to the field of biomedicine, and specifically to the use of substances that inhibit PLOD2 in the preparation of drugs for treating liver cancer. Background Technology
[0002] Hepatocellular carcinoma (HCC) accounts for approximately 75% of primary liver cancers. Due to high rates of postoperative tumor recurrence and metastasis, the overall prognosis for HCC patients is poor. Currently, the main treatments for liver cancer include sorafenib, lenvatinib, regorafenib, and PD-L1 antibodies. However, there is still a pressing need to develop more effective treatments for HCC, especially those that can inhibit both the growth and metastasis of liver cancer. Summary of the Invention
[0003] The purpose of this disclosure is to provide a new drug that can inhibit both the growth and metastasis of liver cancer.
[0004] The inventors of this disclosure discovered that inhibiting PLOD2 in liver cancer cells can significantly reduce the ability of liver cancer cells to proliferate and / or migrate and / or invade and / or metastasize, thereby obtaining the present invention.
[0005] To achieve the above objectives, this disclosure provides the use of a substance that inhibits PLOD2 in the preparation of a drug for treating liver cancer, wherein the substance that inhibits PLOD2 is a substance that can reduce at least one of the expression level, content, and specific activity of PLOD2 protein in cells.
[0006] Preferably, the substance inhibiting PLOD2 is at least one of siRNA targeting PLOD2, an expression plasmid containing a fragment encoding shRNA targeting PLOD2, and a gene editing vector containing a fragment encoding gRNA targeting PLOD2.
[0007] Preferably, the sequence of the shRNA fragment encoding PLOD2 is shown in any one of SEQ ID NO.2-4.
[0008] Preferably, the substance that inhibits PLOD2 is minoxidil.
[0009] Preferably, the drug for treating liver cancer is a drug that inhibits the proliferation and / or migration and / or invasion and / or metastasis of liver cancer cells.
[0010] Preferably, the liver cancer is hepatocellular carcinoma.
[0011] Preferably, the liver cancer is a liver cancer characterized by high expression of the PLOD2 protein, a tumor marker.
[0012] Preferably, the PLOD2 protein is procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2.
[0013] Preferably, the PLOD2 protein is either (a) or (b) as follows: (a) a protein with the amino acid sequence shown in SEQ ID NO.1; or (b) a protein with the amino acid sequence shown in SEQ ID NO.1 having one or more amino acid residues substituted and / or deleted and / or added, and having procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 activity.
[0014] Through the above technical solution, this disclosure provides a new drug that can inhibit the growth and metastasis of liver cancer, thus providing a new treatment option for liver cancer.
[0015] Other features and advantages of this disclosure will be described in detail in the following detailed description section. Attached Figure Description
[0016] The accompanying drawings are provided to further illustrate the present disclosure and form part of the specification. They are used together with the following detailed description to explain the present disclosure, but do not constitute a limitation thereof. In the drawings:
[0017] Figure 1 To construct a recombinant plasmid and screen for the HCC cell line with the best PLOD2 knockdown effect, further experiments were conducted.
[0018] Figure 2 To investigate the effect of PLOD2 knockdown on the proliferation of HCC cells in a cell proliferation assay. (A) PLOD2 knockdown inhibited the proliferation of MHCC97H cells (n=4); (B) PLOD2 knockdown inhibited the proliferation of Huh7 cells (n=4). (*** indicates P<0.001; **** indicates P<0.0001).
[0019] Figure 3To investigate the effect of knockdown of PLOD2 expression on the migration ability of HCC cells using a cell scratch assay. (A) Schematic diagram of scratch assay on the MHCC97H-shPLOD2 stable cell line; (B) Migration rate analysis of the MHCC97H-shPLOD2 stable cell line (n=4); (C) Western blot analysis of the MHCC97H-shPLOD2 stable cell line; (D) Schematic diagram of scratch assay on the Huh7-shPLOD2 stable cell line; (E) Migration rate analysis of the Huh7-shPLOD2 stable cell line (n=4); (F) Western blot analysis of the Huh7-shPLOD2 stable cell line. (* indicates P<0.05; ** indicates P<0.01; *** indicates P<0.001).
[0020] Figure 4 To investigate the effect of PLOD2 knockdown on the invasive ability of HCC cells in a Transwell cell invasion assay. (A) Schematic diagram of PLOD2 knockdown inhibiting Huh7 cell invasion and cell membrane penetration; (B) Statistical analysis of the number of Huh7 cells that penetrated the cell membrane after PLOD2 knockdown (n=5), **** indicates P<0.0001; (C) Western blot analysis of Huh7-shPLOD2 stable cell lines and control cells.
[0021] Figure 5 The effect of different concentrations of Minoxidil on PLOD2 protein expression in HCC cells.
[0022] Figure 6 The effect of Minoxidil on the proliferation capacity of HCC cells. (A) Proliferation curve of MHCC97H cells (n=5); (B) Proliferation curve of Huh7 cells (n=5); (C) Schematic diagram of MHCC97H cell colony formation experiment; (D) Statistical analysis of MHCC97H cell colony number (**** indicates P<0.0001).
[0023] Figure 7 The effect of Minoxidil on HCC cell apoptosis. (A) Flow cytometry analysis of MHCC97H cell apoptosis rate; (B) Statistical analysis of MHCC97H cell apoptosis rate (n=3), no significant difference between the Minoxidil treatment group and the PBS group; (C) Flow cytometry analysis of Huh7 cell apoptosis rate; (D) Statistical analysis of Huh7 cell apoptosis rate (n=3), no significant difference between the Minoxidil treatment group and the PBS group.
[0024] Figure 8The effect of Minoxidil on the migration ability of HCC cells. (A) Schematic diagram of scratch-induced MHCC97H cell; (B) Migration rate analysis of MHCC97H cells (n=4); (C) Schematic diagram of scratch-induced MHCC97H cell; (D) Migration rate analysis of MHCC97H cells (n=5). (** indicates P<0.01; *** indicates P<0.001).
[0025] Figure 9 The effect of minoxidil on the invasive ability of HCC cells. (A) Representative image of Huh7 cells penetrating the cell membrane; (B) Statistical analysis of the number of Huh7 cells penetrating the cell membrane (n=4), ** indicates P<0.01; (C) Representative image of MHCC97H cells penetrating the cell membrane; (D) Statistical analysis of the number of MHCC97H cells penetrating the cell membrane (n=5), *** indicates P<0.001. Detailed Implementation
[0026] The following provides a detailed description of specific embodiments of this disclosure. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit this disclosure.
[0027] This disclosure provides the use of a substance that inhibits PLOD2 in the preparation of a drug for treating liver cancer, wherein the substance that inhibits PLOD2 is a substance that can reduce at least one of the expression level, content, and specific activity of PLOD2 protein in cells.
[0028] Preferably, the substance inhibiting PLOD2 is at least one of siRNA targeting PLOD2, an expression plasmid containing a fragment encoding shRNA targeting PLOD2, and a gene editing vector containing a fragment encoding gRNA targeting PLOD2.
[0029] Preferably, the sequence of the shRNA fragment encoding PLOD2 is shown in any one of SEQ ID NO.2-4.
[0030] Preferably, the substance that inhibits PLOD2 is minoxidil.
[0031] Minoxidil, chemically named 6-(1-piperidinyl)-2,4-pyrimidinediamine-3-oxide, is a potassium channel opener and an oral medication used to lower blood pressure. It directly relaxes vascular smooth muscle, has a strong arteriolar vasodilatory effect, and reduces peripheral resistance, thereby lowering blood pressure. Additionally, because minoxidil is a peripheral vasodilator, long-term local use can stimulate hair growth in areas of hair loss, thus it can be used to treat hair loss. In this disclosure, minoxidil, as an inhibitor of the PLOD2 protein, can significantly reduce the proliferation and / or migration and / or invasion and / or metastasis of liver cancer cells, thus serving as an active ingredient in a drug for treating liver cancer.
[0032] Preferably, the drug for treating liver cancer is a drug that inhibits the proliferation and / or migration and / or invasion and / or metastasis of liver cancer cells.
[0033] Preferably, the liver cancer is hepatocellular carcinoma.
[0034] Preferably, the liver cancer is a liver cancer characterized by high expression of the PLOD2 protein, a tumor marker.
[0035] Preferably, the full name of the PLOD2 protein is Procollagen-Lysine,2-Oxoglutarate 5-Dioxygenase 2, the UniProtKB / Swiss-Prot protein number is O00469, the gene name is PLOD2, and the gene registry number (NCBI Entrez Gene ID) in the NCBI database is 5352.
[0036] Preferably, the PLOD2 protein is either (a) or (b) as follows: (a) a protein with the amino acid sequence shown in SEQ ID NO.1; or (b) a protein with the amino acid sequence shown in SEQ ID NO.1 having one or more amino acid residues substituted and / or deleted and / or added, and having procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 activity.
[0037] The following examples are provided to better understand the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores. Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.
[0038] Human high-metastatic potential hepatocellular carcinoma cells (Huh7 cells) were purchased from Beijing Beina Chuanglian Biotechnology Research Institute, and MHCC97H cells were provided by the Liver Cancer Institute of Zhongshan Hospital affiliated to Fudan University. The PLOD2-shRNA interference plasmid was constructed in our laboratory. DMEM basal medium, 0.25% trypsin, fetal bovine serum (FBS), and 1× phosphate-buffered saline (1× PBS) were purchased from Gibco (USA). Penicillin-Streptomycin solution (PS) was purchased from Cell Technology (China). Lipofectamine 2000 Reagent transfection reagent, protein marker, and ECL chemiluminescence reagent were purchased from Thermo Fisher Scientific (USA). Puromycin was purchased from Sellectchem (USA). Minoxidil was purchased from SIGMA (USA). Passive Lysis 5X Buffer was purchased from Promega (USA). BCA protein concentration assay kit, plasmid extraction kit, and anti-GAPDH mouse monoclonal antibody were purchased from Kangwei Century Co., Ltd. (China). CCK-8 reagent was purchased from Dojin Chemical Research Institute (Japan). Anti-PLOD2 mouse monoclonal antibody was purchased from Proteintech (USA). HRP and Goat Anti-Mouse IgG were purchased from Beijing Yimabo Technology Co., Ltd. APC Annexin V Apoptosis Detection Kit with PI kit was purchased from Biolegend (USA). 4% paraformaldehyde solution was purchased from Solarbio (China). Matrigel Invasion Chamber was purchased from Corning (USA).
[0039] The conventional cell culture medium used in the experimental example was 90% DMEM basal medium, 10% FBS, and 1% PS.
[0040] Example 1: Screening MHCC97H and Huh7 cell lines with the best PLOD2 knockdown effect
[0041] (1) Preparation before the experiment: routine disinfection of the cell laboratory, ultraviolet irradiation of the biosafety cabinet for more than 30 minutes, and preheating of the routine cell culture medium in a 37°C constant temperature water bath.
[0042] (2) Inoculate each well of a six-well plate with 2 × 10⁶ cells. 6 MHCC97H and Huh7 cells were transfected 16-20 hours after the cell growth density reached 90%-95%.
[0043] (3) Preheat antibiotic-free complete culture medium (90% DMEM + 10% FBS), and equilibrate Opti-MEM culture medium at room temperature for 5 min.
[0044] (4) Dilute Lipofectamine 2000: Take an EP tube, add (250 μL × number of wells) of Opti-MEM medium, then add (9 μL × number of wells) of Lipofectamine 2000, and incubate at room temperature for 5 min.
[0045] (5) Packaging Lentiviral Virus: Prepare one EP tube for each well of cells, add 250 μL of Opti-MEM medium to each tube, and calculate the volume of each reagent required for each well according to the concentration of shRNA interference plasmid, psPAX2, and pVSV-G, using a system of 1.6 μg shRNA interference plasmid, 1.2 μg psPAX2, and 0.8 μg pVSV-G. Add the reagents to each EP tube in sequence and mix well. The coding sequence of shRNA in the shPLOD2 interference plasmid is as follows:
[0046] shPLOD2-1 (SEQ ID NO.2):
[0047] CGATTTATGCAGTCAGCCAAACTCGAGTTTGGCTGACTGCATAAATCG;
[0048] shPLOD2-2 (SEQ ID NO.3):
[0049] GCTCCTCTTGTAACTCGTCATCTCGAGATGACGAGTTACAAGAGGAGC;
[0050] shPLOD2-3 (SEQ ID NO.4):
[0051] GGAACACTATGCTGATCAAGATTCAAGAGATCTTGATCAGCATAGTGTTCC.
[0052] (6) Mixing: Dispense the liquid from (4) into each EP tube in (5) after standing, mix well, and let stand for no less than 20 minutes.
[0053] (7) Take out the 6-well plate that was plated 16-20 hours ago, discard the original culture medium, and add new antibiotic-free complete culture medium, 1.5 mL / well.
[0054] (8) Transfection: Add the mixture from (6) to each well corresponding to the cells, and gently shake.
[0055] (9) Record the transfection time, observe it under a microscope, and continue to incubate it in a 37°C, 5% CO2 incubator.
[0056] (10) After culturing for 48 hours, the virus supernatant was harvested, added to a 15 mL centrifuge tube, centrifuged at 4℃ and 4500 g for 10 min, and then filtered through a 0.22 μm filter.
[0057] (11) Take out the target cells from the 12-well plate that were cultured 16-20 hours ago, add 600 μL of virus suspension to each well of target cells, then add complete culture medium to make up to 1 mL, add 1 μL of polybrene to each well and mix gently, then place in an incubator to continue culturing.
[0058] (12) 24 hours after infection, the culture medium was replaced with a complete medium containing puromycin for drug screening; one week after screening, the protein expression level of PLOD2 was detected by Western blot to evaluate the knockdown effect.
[0059] (13) Western blot procedure: Dilute 5×PLB cell lysis buffer to 1×, discard the original culture medium in the 24-well plate to be tested, add 70-100 μL of 1×PLB lysis buffer, and lyse at room temperature for 10 min; collect lysed cells in EP tubes, centrifuge at 14000g for 3 min at 4℃, and transfer the supernatant to a new EP tube for BCA protein quantification. Take 30 μg of protein sample for 10% SDS-PAGE electrophoresis, remove the gel and transfer to a membrane, block with 5% skim milk at room temperature for 90 min, add PLOD2 monoclonal antibody and incubate overnight at 4℃, wash three times with TBST, add secondary antibody and incubate at room temperature for 1 h, wash three times with TBST, add chromogenic buffer, and detect with a high-sensitivity multi-functional imaging system. GAPDH was used as an internal control.
[0060] See results Figure 1 MHCC97H and Huh7 cells were transfected with Scr (control group empty plasmid), shPLOD2-1 (PLOD2 interference plasmid #1), shPLOD2-2 (PLOD2 interference plasmid #2), and shPLOD2-3 (PLOD2 interference plasmid #3). Stable cell lines were selected using puromycin, and PLOD2 protein expression levels were detected by Western blot. It was found that compared to the control group, the PLOD2 protein levels in the MHCC97H-shPLOD2-1, MHCC97H-shPLOD2-3, Huh7-shPLOD2-1, and Huh7-shPLOD2-3 cell lines were significantly lower than those in the control group. Therefore, these cell lines were selected as materials for subsequent experiments.
[0061] Example 2: Detection of the effect of low PLOD2 expression on the proliferation ability of HCC cells
[0062] (1) Cell plating: Cells were digested and counted, and then diluted to 8 × 10⁶ cells / mL. 4 / mL.
[0063] (2) Cells were seeded in 96-well plates at 100 μL / well, with 4 replicates of the same cell type, for a total of 4 plates. The plates were incubated at 37°C in a 5% CO2 incubator. Cells were detected at 0h, 24h, 48h and 72h after cell attachment.
[0064] (3) CCK-8 assay: CCK-8 reagent was mixed with DMEM medium at a ratio of 1:9 and added to each well in the form of medium replacement, 100 μL / well (note that air bubbles should not be generated). The culture plate was placed in an incubator and incubated for 90 min. The absorbance value of each well at 450 nm was measured using a microplate reader. The OD values of each cell type were statistically analyzed at different time points to evaluate the cell proliferation capacity.
[0065] See results Figure 2 At 72 h, the OD values of both MHCC97H-shPLOD2 cell lines and both Huh7-shPLOD2 cell lines were significantly lower than those of the Scr control group. This indicates that knockdown of PLOD2 can significantly inhibit the proliferation of liver cancer cells MHCC97H and Huh7.
[0066] Example 3: Detection of the effect of low PLOD2 expression on the migration ability of HCC cells
[0067] (1) Preparation: Irradiate the ruler and marker pen with ultraviolet light for 30 minutes before operation.
[0068] (2) First, use a marker pen to draw horizontal lines evenly on the back of the 6-hole plate with a ruler, about every 0.5 to 1.0 cm, passing through the holes, with at least 5 lines passing through each hole.
[0069] (3) Inoculate 2×10⁻⁶ cells into each well. 6 Each cell is used to cover the entire surface overnight.
[0070] (4) On the second day, use a 200μL syringe with the nozzle as perpendicular as possible to the horizontal scratch on the back. The nozzle should be vertical and not tilted.
[0071] (5) Wash the cells three times with PBS buffer to remove the cells that were cut off, add DMEM serum-free medium, and incubate at 37°C and 5% CO2.
[0072] (6) Take samples and take photos at 0h, 24h and 48h after scratching.
[0073] (7) The scratch width at each time point was analyzed using Image J software, and the scratch healing rate was calculated as (scratch area at 0 hours - scratch area at other time points) / scratch area at 0 hours × 100% to assess cell migration ability.
[0074] The results are as follows Figure 3 As shown, knockdown of PLOD2 significantly inhibited the migration of MHCC97H and Huh7 cells 24h and 48h after scratching.
[0075] Example 4: Detection of the effect of low PLOD2 expression on the invasive ability of HCC cells
[0076] (1) Take out the Transwell chamber with the matrix gel from -20℃ and put it into a 24-well plate. Add 300μL of preheated serum-free culture medium to the upper chamber and hydrate the matrix gel at room temperature for 2 hours.
[0077] (2) Collect the test cells that have been starved for 15-20 hours, digest them, count the cells, and adjust the cell density to 4×10⁶. 5 / mL.
[0078] (3) Add culture medium containing 20% FBS (i.e., 80% DMEM + 20% FBS) to the lower chamber, and inoculate 200 μL of cell suspension into the upper chamber. Note that no air bubbles should be generated between the lower culture medium and the chamber.
[0079] (4) Place it in a 37℃, 5% CO2 incubator for 48 hours and then test the membrane penetration effect.
[0080] (5) Remove the chamber, wash twice with PBS buffer, and fix with 4% paraformaldehyde for 30 min.
[0081] (6) Wash twice with PBS buffer and stain with 0.5% crystal violet solution for 1-2 hours.
[0082] (7) Wash twice with PBS buffer and wipe the matrix gel and upper chamber cells with cotton swabs.
[0083] (8) Use an upright microscope to observe extracellular cells, take photos of more than three fields of view and count them; statistically analyze the number of cells that have penetrated the membrane for each type of cell.
[0084] The results are as follows Figure 4 As shown, the number of Huh7 cells that penetrated the membrane in the shPLOD2-1 and shPLOD2-3 groups was significantly lower than that in the Scr control group, indicating that knocking down PLOD2 can significantly inhibit the invasive ability of Huh7 liver cancer cells.
[0085] Example 5: Detection of the effect of different concentrations of Minoxidil on PLOD2 protein expression in HCC cells
[0086] In a 24-well plate, at 5×10 5 Five wells of MHCC97H and Huh7 cells were seeded in each well. After 24 hours, 0 mM, 0.25 mM, 0.5 mM, 0.75 mM and 1.0 mM Minoxidil were added respectively. After 24 hours, the samples were collected and Western blot was performed to detect the protein expression level of PLOD2.
[0087] Protein samples were subjected to 10% SDS-PAGE electrophoresis, and PLOD2 protein levels were detected by Western blot: after transfer, the membrane was blocked with 5% skim milk at room temperature for 90 min, PLOD2 monoclonal antibody was added and incubated overnight at 4°C, washed three times with TBST, and then incubated with secondary antibody at room temperature for 1 h. After washing three times with TBST, chromogenic buffer was added, and detection was performed using a high-sensitivity multi-functional imaging system. GAPDH was used as an internal control.
[0088] The results are as follows Figure 5 As shown, Minoxidil can inhibit the expression of PLOD2 protein in MHCC97H cells and Huh7 cells, and the inhibitory effect on PLOD2 protein expression is more significant with increasing Minoxidil concentration, showing a dose-dependent effect.
[0089] Example 6: Detection of the effect of Minoxidil on the proliferation ability of HCC cells
[0090] 1. CCK8 detection
[0091] (1) Cell plating: Cells were digested and counted, and then diluted to 8 × 10⁶ cells / mL. 4 / mL.
[0092] (2) Cells were seeded in 96-well plates at 100 μL / well. One group was treated with 0.5 mM Minoxidil and the other group was treated with the same volume of PBS solution. Five cells were seeded in each group, and a total of five plates were seeded. The plates were incubated at 37°C in a 5% CO2 incubator. Cells were detected at 0 h, 24 h, 48 h, 72 h and 96 h after cell attachment.
[0093] (3) Mix CCK-8 reagent with DMEM medium at a ratio of 1:9 and add it to each well in the form of a liquid exchange, 100 μL / well. Note that no air bubbles should be generated.
[0094] (4) Place the culture plate in an incubator and incubate for 2 hours.
[0095] (5) The absorbance of each well at 450 nm was measured using an enzyme-linked immunosorbent assay (ELISA) reader.
[0096] (6) Statistical analysis of the OD values of each cell type at different time points was performed to assess the cell proliferation capacity.
[0097] 2. Cloning experiment
[0098] (1) MHCC97H cells were seeded into 6-well plates with 1000 cells per well. One group was given 0.5 ml Minoxidil in the culture medium, and another group was given an equal volume of PBS buffer as a control. Each group was set up with three replicates and incubated in a 37°C, 5% CO2 incubator.
[0099] (2) Change the medium every three days and culture for 14 days.
[0100] (3) Discard the original culture medium and add 1 mL / well of pure methanol solution to fix for 20 min.
[0101] (4) Discard the methanol and wash twice with PBS buffer.
[0102] (5) Add 1 mL / well of 0.5% crystal violet solution and stain for 4 h.
[0103] (6) Discard the crystal violet solution and wash repeatedly with PBS buffer until the crystal violet solution is washed away.
[0104] (7) Take pictures of the 6-well plate and count the cells.
[0105] The results are as follows Figure 6 As shown, treatment with 0.5 mM Minoxidil for 48 h, 72 h, and 96 h significantly inhibited the proliferation of both cell types, with the inhibitory effect becoming more pronounced with prolonged treatment time. Clonogenic assays examined the effect of Minoxidil on MHCC97H cell proliferation; after 14 days of culture, cell growth in the Minoxidil group was significantly inhibited. These results indicate that Minoxidil can inhibit the proliferation of liver cancer cells.
[0106] Example 7: Detection of the effect of Minoxidil on HCC cell apoptosis
[0107] (1) HCC cells were seeded in 24-well plates, with 5 × 10⁶ cells per well. 5 The cells were divided into two groups, with three replicates in each group.
[0108] (2) After 24 hours, the cells were treated with PBS buffer and 0.5 mM Minoxidil respectively.
[0109] (3) After 48 hours, digest the cells, collect the cell suspension, and stain the cells according to the instructions of APC Annexin V Apoptosis Detection Kit with PI.
[0110] (4) The apoptosis rate of each group was analyzed using a BD FACSVerse flow cytometer.
[0111] The results are as follows Figure 7 As shown, after treating MHCC97H and Huh7 cells with 0.5mM Minoxidil for 48 hours, the apoptosis rate of the cells was not significantly different from that of the PBS group.
[0112] Example 8: Detection of the effect of Minoxidil on the migration ability of HCC cells
[0113] (1) Preparation: Irradiate the ruler and marker pen with ultraviolet light for 30 minutes before operation.
[0114] (2) First, use a marker pen to draw horizontal lines evenly on the back of the 6-hole plate with a ruler, about every 0.5 to 1.0 cm, passing through the holes, with at least 5 lines passing through each hole.
[0115] (3) Inoculate 2×10⁻⁶ cells into each well. 6 Each cell is used to cover the entire surface overnight.
[0116] (4) On the second day, use a 200μL syringe with the nozzle as perpendicular as possible to the horizontal scratch on the back. The nozzle should be vertical and not tilted.
[0117] (5) Wash the cells three times with PBS buffer to remove the cells that have been cut off. Add DMEM serum-free medium, add 0.5mM Minoxidil to one group and add an equal volume of PBS solution to the other group. Incubate at 37°C in a 5% CO2 incubator.
[0118] (6) Take samples and take photos at 0h, 24h, 48h and 72h after scratching.
[0119] (7) The scratch width at each time point was analyzed using Image J software, and the scratch healing rate was calculated as (scratch area at 0 hours - scratch area at other time points) / scratch area at 0 hours × 100% to assess cell migration ability.
[0120] The results are as follows Figure 8 As shown, treatment with 0.5 mM Minoxidil for 48 h and 72 h significantly inhibited the migration ability of both cell types, and the inhibitory effect became more pronounced with prolonged treatment time.
[0121] Example 9: Detection of the effect of Minoxidil on the invasive ability of HCC cells
[0122] (1) Take out the Transwell chamber with the matrix gel from -20℃ and put it into a 24-well plate. Add 300μL of preheated serum-free culture medium to the upper chamber and hydrate the matrix gel at room temperature for 2h.
[0123] (2) HCC cells that have been starved for 15–20 hours were removed, digested, and cell counts were performed. The cell density was then adjusted to 4 × 10⁶ cells / year. 5 / mL.
[0124] (3) Add culture medium containing 20% FBS (i.e., 80% DMEM + 20% FBS) to the lower chamber, and seed 200 μL of cell suspension in the upper chamber. Add 0.5 mM Minoxidil to one group and add an equal volume of PBS solution to the other group. Note that no air bubbles should be generated between the lower culture medium and the chamber.
[0125] (4) Place it in a 37℃, 5% CO2 incubator for 48 hours and then test the membrane penetration effect.
[0126] (5) Remove the chamber, wash twice with PBS buffer, and fix with 4% paraformaldehyde for 30 min.
[0127] (6) Wash twice with PBS buffer and fix with methanol for 20 min.
[0128] (7) Wash twice with PBS buffer and stain with 0.5% crystal violet solution for 1-2 hours.
[0129] (8) Wash twice with PBS buffer and wipe the matrix gel and upper chamber cells with cotton swabs.
[0130] (9) Use an upright microscope to observe extracellular cells, take photos of more than three fields of view and count them; statistically analyze the number of cells that have penetrated the membrane for each type of cell.
[0131] The results are as follows Figure 9 As shown, after 48 hours of treatment with 0.5 mM Minoxidil, the number of cells that could penetrate the membrane in MHCC97H and Huh7 cells was significantly lower than that in the PBS group.
[0132] The preferred embodiments of this disclosure have been described in detail above. However, this disclosure is not limited to the specific details of the above embodiments. Within the scope of the technical concept of this disclosure, various simple modifications can be made to the technical solutions of this disclosure, and these simple modifications all fall within the protection scope of this disclosure.
[0133] It should also be noted that the various specific technical features described in the above embodiments can be combined in any suitable manner without contradiction. To avoid unnecessary repetition, this disclosure will not describe the various possible combinations separately.
[0134] Furthermore, various different embodiments of this disclosure can be combined in any way, as long as they do not violate the spirit of this disclosure, they should also be regarded as the content disclosed in this disclosure.
Claims
1. The application of substances that inhibit PLOD2 in the preparation of drugs for treating liver cancer, among which, Substances that inhibit PLOD2 are those that can reduce at least one of the expression level, content, and specific activity of PLOD2 protein in cells; The substance that inhibits PLOD2 is an expression plasmid containing a fragment encoding shRNA targeting PLOD2. The sequence of the shRNA fragment encoding PLOD2 is shown in SEQ ID NO. 2 or SEQ ID NO.
4.
2. The application according to claim 1, wherein, The drugs mentioned for treating liver cancer are those that inhibit the proliferation and / or migration and / or invasion of liver cancer cells.
3. The application according to claim 1, wherein, The liver cancer mentioned is hepatocellular carcinoma.
4. The application according to claim 1, wherein, The liver cancer mentioned is liver cancer characterized by high expression of the PLOD2 protein, a tumor marker.
5. The application according to claim 1, wherein, The PLOD2 protein is procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2.
6. The application according to claim 1, wherein, The PLOD2 protein is a protein with the amino acid sequence shown in SEQ ID NO. 1.