A protein RNA complex that can be used for targeted binding and delivery to plant leaves

Abstract

The present invention belongs to the field of biotechnology, and relates to a protein RNA complex that can be used for directional binding and delivery to plant leaves. The protein consists of three parts: a functional domain that can be directional bound to plant leaves, a functional domain containing surface activity, and a functional domain that binds to RNA. By co-expressing with target RNA, the protein can form a protein RNA complex with the target RNA in vivo. Droplets containing the protein RNA complex have good wettability on the surface of leaves, and the protein can fix RNA on the surface of leaves to increase the overall effect of RNA. The protein and RNA are co-expressed in Escherichia coli to form a complex, and its production is easy to scale and low cost, and has important practical promotion value.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a protein RNA complex that can be used for directional binding and delivery on plant leaves. Background Art

[0002] With the rapid development of RNA interference technology in the fields of biomedicine and genetic engineering breeding, this technology has rapidly penetrated into the field of plant protection in recent years. Biological pesticides developed based on RNAi technology can prevent and control pests and diseases without affecting the expression of crop genes. They not only combine the advantages of traditional chemical pesticides and genetically modified crops, but are also green, environmentally friendly and pollution-free, providing a new solution for sustainable agricultural development. Therefore, they are hailed as the third revolution in the history of pesticides.

[0003] RNA biopesticides are classified as nucleic acid interferons, which are polynucleotide preparations that interfere with or inhibit the transcription of specific genes in target organisms (Fletcher SJ, Reeves PT, Hoang BT, et al. A perspective on RNAi-based biopesticides [J]. Frontiers in plant science, 2020, 11: 51.). Double-stranded RNA that can specifically target specific genes in insects / pathogens (hosts) is prepared through cell factories or cell-free synthesis methods. Under the active transport or endocytosis of the midgut cells of the pest host, it enters the host cell, thereby targeting the mRNA of the host's key growth factor and interfering with its translation, causing the target pest to stop eating / reproducing or die, ultimately achieving the purpose of protecting crops. Compared with traditional chemical pesticides, RNA biopesticides are attracting more and more attention due to their advantages such as strong specificity, low resistance, low development cost, and green safety (Rodrigues TB, Mishra SK, Sridharan K, et al. First sprayable double-stranded RNA-based biopesticide product targets proteasome subunit beta type-5 in Colorado potato beetle (Leptinotarsa ​​decemlineata) [J]. Frontiers in plant science, 2021, 12: 728-52. Bramlett M, Plaetinck G, Maienfisch P. RNA-based biocontrols—a new paradigm in crop protection [J]. Engineering, 2020, 6 (5): 522-527.). Summary of the invention

[0004] In view of the short residence time of current sprayable RNA biopesticides on leaves, a method has been established to increase the wettability and residence time of droplets containing the complex on the leaf surface by co-expressing recombinant proteins and RNA with insecticidal function to increase its efficacy.

[0005] The present invention obtains a recombinant protein through rational protein design. The recombinant protein can specifically bind to RNA with insecticidal effect to form a recombinant protein RNA complex that can be used for agricultural insecticide. The recombinant protein RNA complex has the following characteristics:

[0006] 1) The recombinant protein contains three functional parts in structure: a) a surface active functional domain, which can significantly increase the wettability of the protein RNA complex droplets on the surface of plant leaves; b) the N-terminus of the recombinant protein contains a functional peptide chain, which can specifically bind to RNA with insecticidal function to form a protein RNA complex; c) the C-terminus of the recombinant protein contains a functional peptide chain, which can target the leaf wax layer of the leaf to increase the residence time of the protein RNA complex on the surface of the plant leaf.

[0007] 2) The RNA with insecticidal function consists of two parts: a) an aptamer that can specifically bind to the functional peptide chain at the N-terminus of the recombinant protein; b) a double-stranded RNA with insecticidal effect (the double-stranded RNA is absorbed by the pest through the intestine and digested in the body to form interfering RNA to interfere with the expression of the target gene, thereby causing the pest to stop eating or reproduce or die).

[0008] 3) The recombinant protein is co-expressed with RNA in E. coli to form a complex, and its production is easy to scale and low-cost.

[0009] The technical solution adopted by the present invention is as follows:

[0010] The present invention provides a protein RNA complex that can be used for targeted binding and delivery on plant leaves, characterized in that the complex contains a recombinant protein and a functional RNA that can form a complex with the protein, wherein the recombinant protein structurally contains three functional parts: a) a surface active functional domain; b) an RNA binding domain at the N-terminus that can specifically bind to the functional RNA to form a protein RNA complex; c) a leaf binding domain at the C-terminus that can target the leaf wax layer of the leaf to increase the residence time of the protein RNA complex on the surface of the plant leaf;

[0011] Preferably, the functional RNA consists of two parts: a) an RNA aptamer that can specifically bind to the functional peptide chain at the N-terminus of the recombinant protein; b) a functional double-stranded RNA, preferably a double-stranded RNA with insecticidal effect, which is absorbed by the pest through the intestine and digested in the body to form interfering RNA to interfere with the expression of the target gene, thereby causing the pest to stop eating, reproduce, or die.

[0012] Preferably, the recombinant protein and the functional RNA are co-expressed in a recombinant bacterium such as Escherichia coli to form a complex.

[0013] More preferably, the amino acid sequence of the surface active domain is: MKQLADSLHQLARQVSRLRHAGGGSMKQ LADSLHQLARQVSRLEHAGGGSMKQLADSLHQLARQVSRLEHAGGGSMKQLADSLHQLA RQVSRLRHA (SEQ ID NO: 1); the amino acid sequence of the leaf binding domain is: AENLYFQGDSHEERHHGR HGHHKYGRKFHEKHHSHRGYRSNYLYDN (SEQ ID NO: 2); the amino acid sequence of the RNA binding domain is: SYGRKKRRQRRRPPQ (SEQ ID NO: 3);

[0014] The nucleotide sequence of the TAT aptamer is: GGGAGCUUGAUCCCGUUUGCCGGUCGAUCGCUCCC (SEQ ID NO: 4), and the nucleotide sequence of the functional double-stranded RNA is: GAUGUAACUGAAUGAAAUGGUGA AGGACGGGUCCAGUAGGCUGCUUCGGCAGCCUACUUGUUGAGUAGAGUGUGAGCUC CGUAACUAGUUACAUC (SEQ ID NO: 5), which is an RNA aptamer Spinach2 that can specifically bind to DFHBI dye and emit fluorescence after excitation.

[0015] Further preferably, the RNA complex is also designed with a spacer region capable of forming a double-stranded structure;

[0016] Preferably, the spacer region capable of forming a double-stranded structure comprises two parts, spacer-1 sequence: CUAUAAGAAGUUUUCAUAGGCGUUUCAUCUAGGCG (SEQ ID NO: 6) and spacer-2 sequence: CGCCUAGAUGAAACGCCUAUGAAAACUUCUUAUAG (SEQ ID NO: 7), which can be connected together or designed with RNA aptamers or both ends of a functional double-stranded RNA;

[0017] In addition, preferably, the RNA aptamer Spinach2 aptamer or the RNA aptamer that can specifically bind to the DFHBI dye and emit fluorescence after excitation;

[0018] More specifically, the nucleotide sequence of the functional RNA of the complex is: GGGAGCUUGAUCCCGUUUGCCG GUCGAUCGCUCCCCUAUAAGAAGUUUUCAUAGGCGUUUCAUCUAGGCGGAUGUAACUGAAUGAAAUGGUGAAGGACGGGUCCAGUAGGCUGCUUCGGCAGCCUACUUGUUGAGUAGAGUGUGAGCUCCGUAACUAGUUACAUCCGCCUAGAUGAAACGCCUAUGAAAACUUCUUAUAG (SEQ ID NO: 8).

[0019] The present invention provides a nucleic acid encoding the protein RNA complex, which comprises a coding gene of a recombinant protein in the protein RNA complex and a DNA expression frame corresponding to the functional RNA.

[0020] Specifically, the nucleotide sequence of the gene encoding the recombinant protein is: ATGGGCTCATATGGACGAAAGAAAA (SEQ ID NO: 9).

[0021] The nucleotide sequence of DNA corresponding to functional RNA is: GGGATCAATCATGGCAACGTCCGAAGCT TGATCCCGTTTGCCGGTCGATCGCTTCGGACGTTGCCATGTGTATGTGGGGATGTAACTGAATGAAATGGTGAAGGACGGGTCCAGTAGGCTGCTTCGGCAGCCTACTTGTTGAGTAGAGTGTGAGCTCCGTAACTAGTTACATCCCCACATACTTTGTTGATCCCGGGCACGAAGCTTGATCCCGTTTGCCGGTCGATCGCTTCGTGCCC (SEQ ID NO: 10).

[0022] The present invention provides a recombinant expression vector, which comprises the encoding nucleic acid as described above.

[0023] The present invention provides a recombinant bacterium containing the recombinant expression vector, such as Escherichia coli, which is preferably a defective strain of double-stranded RNA degrading enzyme (RNase III).

[0024] The present invention also provides a method for preparing the protein RNA complex, which comprises the steps of culturing the recombinant bacteria to produce the protein RNA complex, and collecting the protein RNA complex; and further comprises a purification step.

[0025] The present invention further provides an application of the protein RNA complex, specifically, the application is for killing insects.

[0026] The advantages of the present invention are: (1) the recombinant protein contains surface activity, which can significantly increase the wettability of the droplets containing the protein RNA complex on the leaf surface. (2) the recombinant protein can bind to the leaf, which can significantly increase the residence time of the protein RNA complex on the leaf surface. The recombinant protein and the RNA with insecticidal effect of the present invention are produced in a cell factory through artificial expression, and the process is easy to operate and control, suitable for large-scale industrial production process, and low in production cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 , schematic diagram of recombinant protein.

[0028] Figure 2 , schematic diagram of TAT-Spinach2.

[0029] Figure 3 , schematic diagram of co-expression plasmid.

[0030] Figure 4Expression and purification of protein EGFP and recombinant protein EGFP_YT. A) EGFP protein; B) EGFP_YT protein

[0031] Figure 5 , Characterization of recombinant protein EGFP_YT hanging on leaf surface. A), B) control group; C), D) experimental group.

[0032] Figure 6 , wettability characterization of recombinant protein droplets. A) Surface tension data; B) Wettability of protein droplets on leaf surface

[0033] Figure 7 , expression of recombinant protein. The figure shows that the target recombinant protein was successfully expressed and purified.

[0034] Figure 8 , RNA expression, the figure shows that TAT-Spinach2 was successfully expressed.

[0035] Fig. 9 , Characterization of recombinant protein RNA complex hanging on leaf surface. A), B) control group; C), D) experimental group. DETAILED DESCRIPTION

[0036] The present invention is further described below through specific examples in order to better understand the present invention, but it does not constitute a limitation of the present invention.

[0037] Example 1: Construction of co-expression plasmid

[0038] 1. Construction of recombinant protein

[0039] The recombinant protein (RBP_SPM1_YT) has three main functions: the surface active domain (MKQLADSLHQLARQVSRLRH AGGGSMKQLADSLHQLARQVSRLEHAGGGSMKQLADSLHQLARQVSRLEHAGGGSMKQLADSLHQLARQVSRLRHA) mainly increases the wettability of spray droplets on the leaf surface; the leaf binding domain (AENLYFQGDSHEERHHGRHGHHKYGRKFHEKHHS HRGYRSNYLYDN) (Dittrich J, Brethauer C, GoncharenkoL, et al. Rational Design Yields Molecular Insights on Leaf-Binding of AnchorPeptides[J].ACS applied mater ials&interfaces,2022,14(25):28412-28426.), can bind to the wax part in the leaves to fix the protein on the leaf surface, thereby increasing the residence time of the protein-RNA complex on the leaf surface; RNA binding domain (SYGRKKRRQRRRPPQ) (Weeks KM,Ampe C,Schultz SC,et al.Fragments ofthe HIV-1Tat Protein Specifically Bind TAR RNA[J].Science,1990,249(4974):1281-1285.), can specifically bind to RNA and form a protein-RNA complex. The recombinant protein EGFP_YT (Dittrich J, Brethauer C, Goncharenko L, et al. Rational Design Yields Molecular Insights on Leaf-Binding of Anchor Peptides[J]. ACS applied materials&interfaces, 2022, 14(25): 28412-28426.) contains a fluorescent protein domain and a leaf binding domain. Fluorescence detection can be used to identify whether the recombinant protein is bound to the leaves. It is mainly used to test the function of the leaf binding protein domain.

[0040] 2. Double-stranded RNA design

[0041] Double-stranded RNA mainly consists of three parts: an RNA aptamer (GGGAGCUUGAUC CCGUUUGCCGGUCGAUCGCUCCC) that can specifically bind to recombinant proteins (Yamamoto R, Katahira M, Nishikawa S, et al. A novel RN A motif that binds efficiently and specifically to the Tat protein of HIV and inhibits the trans-activation by Tat of transcription invitro and in vivo [J]. Genes to Cells, 2000, 5 (5): 371-388.), a functional double-stranded RNA, and a double-stranded spacer ( Figure 2 In the experiment, the RNA aptamer Spinach2 (GAUGUAA CUGAAUGAAAUGGUGAAGGACGGGUCCAGUAGGCUGCUUCGGCAGCCUACUUGUUGAGUAGAGUGUGAGCUCCGUAACUA GUUACAUC) (Strack RL, Disney MD, Jaffrey SR. A superfolding Spinach2 reveals the dynamic nature of trinucleotide repeat–containing RNA[J]. Nature methods, 2013, 10(12): 1219-1224.) which can specifically bind to DFHBI dye and emit fluorescence after excitation was used as a functional double-stranded RNA to test the feasibility of the design. The size of TAT-Spinach2 (GGGAGCUUGAUCCCGUUUGCCGGUCGAUCGCUCCCCUAUAAGAAGUUUUCAUAGGCGUUUCAUCUAGG CGGAUGUAACUGAAUGAAAUGGUGAAGGACGGGUCCAGUAGGCUGCUUCGGCAGCCUACUUGUUGAGUAGAGUGUGAGCU CCGUAACUAGUUACAUCCGCCUAGAUGAAACGCCUAUGAAAACUUCUUAUAG) used in this patent is 200 nt.

[0042] 3. Construction of co-expression plasmid

[0043] Construction of plasmid pET-EGFP_YT / pET-EGFP:

[0044] Insert the gene sequence of the synthesized protein EGFP_YT / pET-EGFP into the pET-24a(+) plasmid ( Figure 3 A), between NheI and BamHI, resulting in plasmid pET-EGFP_YT / pET-EGFP.

[0045] Construction of co-expression plasmid pET-Duet-RBP_SPM1_YT-TAT_Spinach2:

[0046] The recombinant protein RBP_SPM1_YT gene sequence was inserted into the pET-Duet-1 plasmid ( Figure 3 B), between NcoI and EcoRI. The TAT-spinach2 expression cassette (containing T7 promoter, TAT-spinach2 template DNA and T7 terminator) gene sequence was inserted into the same co-expression plasmid, and the co-expression plasmid pET-Duet-RBP_SPM1_YT-TAT_Spinach2 was finally obtained between NotI and XhoI.

[0047] Example 2: Functional characterization of leaf-binding peptides

[0048] 1) The plasmid pET-EGFP_YT / pET-EGFP was transformed into Escherichia coli, and the positive transformants were screened and inoculated into LB medium containing 100 mg / mL ampicillin, and cultured overnight at 37°C to obtain seed solution;

[0049] 2) The seed solution was transferred into TB medium containing 100 mg / mL ampicillin at a 1% inoculum volume, cultured at 30°C until OD600 reached 0.6-0.8, 1 mM IPTG was added to induce the expression of the recombinant protein, and the cells were collected after culturing at 30°C for 6 hours.

[0050] 3) Add lysis buffer (50 mM Tris-HCl, 50 mM NaCl, 1 mM EDTA, pH 7.4) to resuspend the cells, lyse with an ultrasonic disruptor for 30 min, and centrifuge at 12000 rpm for 30 min to collect the supernatant;

[0051] 4) Filter the supernatant containing the recombinant protein with a 0.2 μm membrane, purify the recombinant protein in the supernatant with a protein purifier (nickel column), and run a protein gel to verify the expression of the recombinant protein;

[0052] 5) In the experimental group, freshly picked leaves were immersed in a solution containing EGFP_YT protein (35.4 kDa) and shaken at room temperature for 5 minutes to allow the recombinant protein to fully bind to the leaves; in the control group, freshly picked leaves were immersed in a solution containing EGFP protein (28 kDa) (Heikal AA, Hess ST, Webb W W. Multiphoton molecular spectroscopy and excited-state dynamics of enhanced green fluorescent protein (EGFP): acid–base specificity [J]. Chemical Physics, 2001, 274 (1): 37-55.) and shaken at room temperature for 5 minutes.

[0053] 6) Take out the leaves and soak them in Tris-HCl buffer (50 mM Tris-HCl, 50 mM NaCl, 1 mM EDTA, pH 7.4), and shake them at room temperature for 3 minutes to wash away the proteins that are not bound to the leaves; repeat the same operation for the control group.

[0054] 7) Take a portion of the treated leaves for microscopic examination, and test whether the leaf surface emits fluorescence after excitation (wavelength 488nm).

[0055] Based on the above experimental results, we can conclude that: Figure 4 As shown in Figure A, the size of the eluted protein is between 20 and 31 kDa, and the fluorescent protein (EGFP) is a 28 kDa band that has been washed without any impurities, so the recombinant protein EGFP is successfully expressed. Figure 4 As shown in B, the size of the eluted recombinant protein is between 30 and 41 kDa, the size of the recombinant protein EGFP_YT is 35.4 kDa, and the band is clear, so the recombinant protein EGFP_YT is successfully expressed.

[0056] Figure 5 In the figure, A) is the bright field result of the control group leaves, and the leaves are clearly visible; B) is the result of the control group leaves excited at a wavelength of 488nm; C) is the bright field of the experimental group, and the leaves are clearly visible; D) is the result of the experimental group leaves excited at a wavelength of 488nm. Under the same experimental conditions, it can be seen from the comparison between B) and D) that after the EGFP protein-infiltrated leaves have been washed, there is no fluorescence signal under the wavelength of 488nm, indicating that the fluorescent protein is not bound to the leaf surface; while after the EGFP_YT protein-infiltrated leaves have been washed, the fluorescence signal is strong under the wavelength of 488nm, indicating that the EGFP_YT protein can successfully bind to the leaves.

[0057] Example 3: Characterization of the wettability-enhancing function of recombinant proteins on droplets

[0058] 1) The co-expression plasmid pET-Duet-RBP_SPM1_YT-TAT_Spinach2 was transformed into E. coli according to the method in Example 2. The recombinant protein RBP_SPM1_YT was purified by the same method, and the expression of the recombinant protein was verified by running a gel.

[0059] 2) Using a solution containing the same buffer (50 mM Tris-HCl, 50 mM NaCl, 1 mM EDTA, pH 7.4) as a control, a solution containing RBP_SPM1_YT protein was taken to measure its surface tension (Cwikel D, Zhao Q, Liu C, et al. Comparing contact angle measurements and surface tension assessments of solid surfaces[J]. Langmuir, 2010, 26(19): 15289-15294.).

[0060] 3) Take two similar leaves from the same tree, take 50 μl of recombinant protein RBP_SPM1_YT liquid and 50 μl of buffer solution (50 mM Tris-HCl, 50 mM NaCl, 1 mM EDTA, pH 7.4) and drop them on the two leaves respectively to observe their wettability.

[0061] Depend on Figure 6 The results in A show that the surface tension of the droplets containing RBP_SPM1_YT protein is significantly lower than that of the droplets in the control group. Figure 6 From the results in Figure B, we can see that under the same conditions, the droplets in the control group still exist in the form of droplets on the leaf surface, while the droplets containing the recombinant protein RBP_SPM1_YT in the experimental group are evenly dispersed on the leaf surface without forming droplets. Based on the above results, it can be concluded that the wettability of the droplets containing the recombinant protein RBP_SPM1_YT is better than that of the buffer solution droplets.

[0062] Example 4: Co-expression of recombinant protein and RNA in Escherichia coli

[0063] 1) The co-expression plasmid pET-Duet-RBP_SPM1_YT-TAT_Spinach2 was transformed and cultured according to the method in Example 2.

[0064] 2) The seeds obtained from overnight culture were transferred into TB medium at a 1% inoculation rate and cultured at 30°C until OD 600 to 0.6-0.8, 1 mM IPTG was added to induce the expression of recombinant proteins and RNA, and the cells were collected by centrifugation four hours later.

[0065] 3) Take an appropriate amount of cells to extract total RNA using the phenol method and run RNA PAGE to verify RNA expression;

[0066] 4) Take an appropriate amount of cells and add lysis buffer (50mM Tris-HCl, 50mM NaCl, 1mM EDTA, pH 7.4) to resuspend, lyse with an ultrasonic disruptor for 30 minutes, centrifuge at 12000rpm for 30 minutes, and collect the supernatant for later use;

[0067] 5) Place an appropriate amount of His tag magnetic beads in a centrifuge tube, place the centrifuge tube on a magnetic separator, and when the solution becomes clear, use a pipette to discard the supernatant. Remove the centrifuge tube from the magnetic separator and add an appropriate amount of binding buffer to resuspend the magnetic beads. Repeat the above steps twice to balance the magnetic beads.

[0068] 6) Add the supernatant containing the target protein RNA complex to the balanced magnetic beads and mix thoroughly. Place the centrifuge tube on a mixer and incubate at 4°C for 20 minutes.

[0069] 7) Place the centrifuge tube on a magnetic separator and discard the supernatant with a pipette after the solution becomes clear. Add 1 mL of washing buffer (50 mM Tris-HCl, 50 mM NaCl, 20 mM Imidazole, pH 7.4) to the centrifuge tube to resuspend the magnetic beads, place the centrifuge tube on a magnetic separator and discard the supernatant with a pipette after the solution becomes clear. Repeat the above steps 3 times to wash away impurities that are not bound to the magnetic beads.

[0070] 8) Add an appropriate amount of elution buffer (50mM Tris-HCl, 50mM NaCl, 400mM Imidazole, pH 7.4) to the centrifuge tube, gently blow 3-5 times with a pipette to mix, place the centrifuge tube on a magnetic separator, wait for the solution to become clear, and use a pipette to aspirate the supernatant, which is the recombinant protein RNA complex component. Take part of the sample for SDS-PAGE experiment to verify the expression of the target recombinant protein.

[0071] Depend on Figure 7 The results showed that the size of the recombinant protein in the purified recombinant protein RNA complex was between 18 and 22 kDa, the size of the recombinant protein RBP_SPM1_YT was 20.2 kDa and the band was single, indicating that the recombinant protein RBP_SPM1_YT was successfully expressed. Figure 8The results show that compared with the total RNA of the strain without the co-expression plasmid, the total RNA extracted after induction containing the co-expression plasmid pET-Duet-RBP_SPM1_YT-TAT_Spinach2 contained overexpressed TAT-Spinach2 (200nt), as shown by the arrow in the figure. In summary, the recombinant protein (RBP_SPM1_YT) and RNA (TAT-Spinach2) were successfully co-expressed.

[0072] Example 5: Characterization of the binding of recombinant protein RNA complex to leaves

[0073] Experimental protocol:

[0074] 1. The control group soaked the freshly picked leaves in the recombinant protein RBP_SPM1_YT solution purified in Example 3; the experimental group soaked the freshly picked leaves in the recombinant protein RNA complex solution purified by the method of Example 4, and shook at room temperature for five minutes;

[0075] 2. Take out the leaves and soak them in Tris-HCl buffer (50mM Tris-HCl, 50mM NaCl, 1mM EDTA, pH7.4), shake at room temperature for 3 minutes to wash away unbound proteins and RNA;

[0076] 3. Take out the leaf and place it in a culture dish. Drop the dye DFHBI on the leaf surface and spread it evenly. Let it react at room temperature for 3 minutes to allow the dye to fully combine with RNA.

[0077] 4. Take some leaves for microscopic examination and test whether the leaf surface emits fluorescence after excitation at 488nm;

[0078] Fig. 9 A) is the bright field of the control group, and the leaves are clearly visible; B) is the result obtained after the leaves of the control group are excited at 488nm, and there is no fluorescence signal; C) is the bright field of the experimental group, and the leaves are clearly visible; D) is the result obtained after the leaves of the experimental group are excited at 488nm, and there is a relatively strong fluorescence signal. In summary, the recombinant protein can successfully bind to the leaves and RNA, thereby achieving the fixation of functional RNA on the leaves.

Claims

1. A protein RNA complex that can be used for targeted binding and delivery to plant leaves, characterized in that: The complex contains a recombinant protein and a functional RNA that can form a complex with the protein, wherein the recombinant protein consists of the following three functional parts: a) a surface active functional domain, whose amino acid sequence is: MKQLADSLHQLARQVSRLRHAGGGSMKQLADSLHQLARQVSRLEHAGGGSMKQLADSLHQLARQVSRLEHAGGGSMKQLADSLHQLARQVSRLRHA; b) an RNA binding domain at the N-terminus that can specifically bind to the functional RNA to form a protein-RNA complex, whose amino acid sequence is: SYGRKKRRQRRRPPQ; c) a leaf binding domain at the C-terminus that can target the leaf wax layer of the leaf to increase the residence time of the protein-RNA complex on the surface of the plant leaf, whose amino acid sequence is: AENLYFQGDSHEERHHGRHGHHKYGRKFHEKHHSHRGYRSNYLYDN; The functional RNA consists of two parts: a) an RNA aptamer that can specifically bind to the functional peptide chain at the N-terminus of the recombinant protein; b) a double-stranded RNA with insecticidal effect, which is absorbed by the pest through the intestine and digested in the body to form interfering RNA to interfere with the expression of the target gene, thereby causing the pest to stop eating or reproduce or die.

2. The protein RNA complex according to claim 1, characterized in that The recombinant protein and the functional RNA are co-expressed in the recombinant bacteria to form a complex.

3. The protein RNA complex according to claim 1, characterized in that The recombinant bacteria is Escherichia coli.

4. A nucleic acid encoding a protein RNA complex as claimed in any one of claims 1 to 3, comprising a gene encoding a recombinant protein in the protein RNA complex as claimed in any one of claims 1 to 3 and a DNA expression frame corresponding to the functional RNA as claimed in any one of claims 1 to 3.

5. The encoding nucleic acid according to claim 4, wherein the nucleotide sequence of the gene encoding the recombinant protein is shown in SEQ ID NO:

9.

6. A recombinant expression vector, characterized in that: It comprises the encoding nucleic acid as described in claim 4 or 5.

7. A recombinant bacterium containing the recombinant expression vector according to claim 6.

8. The recombinant bacterium according to claim 7, characterized in that It is Escherichia coli.

9. The recombinant bacterium according to claim 8, characterized in that It is a deficient strain for the enzyme that degrades double-stranded RNA.

10. A method for preparing the protein RNA complex according to any one of claims 1 to 3, characterized in that: The method comprises the steps of culturing the recombinant bacteria as claimed in claim 9 to produce the protein RNA complex, and collecting the protein RNA complex; and further comprises a purification step.

11. The protein RNA complex according to any one of claims 1 to 3 is used for killing insects.

Images