Application of Nogo-B inhibitors in the preparation of drugs for treating colitis
By using Nogo-B inhibitors, especially small interfering RNA, and targeting Nogo-B for gene editing, the problem that existing colitis treatments cannot completely cure the disease is solved, and significant treatment of colitis with minimal side effects is achieved.
Patent Information
- Application Number
- CN202211579803.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-09
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2042-12-09
AI Technical Summary
Existing treatments for colitis mainly rely on drugs, but they can only relieve symptoms, cannot completely cure the disease, and have side effects. There is a lack of effective new gene therapy targets.
Nogo-B inhibitors, especially small interfering RNA, are used to target Nogo-B for gene editing, reduce its expression level, and prepare drugs for treating colitis.
It has significant effects in treating colitis, has good effects and few side effects, has high safety, can regulate the expression of inflammatory factors, affect the proliferation and migration of colon epithelial cells, and thus affect the pathogenesis of colitis.
Smart Images
Figure CN117045790B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to application of a Nogo-B inhibitor in preparing a medicine for treating colitis, and belongs to the technical field of biomedicine. Background Art
[0002] Colitis (UC) is an autoimmune inflammatory bowel disease (IBD) characterized by weight loss, abdominal pain, diarrhea, and, in severe cases, blood in the stool. Colitis primarily occurs in the distal colon and rectum, with diffuse edema of the intestinal mucosa, abnormal crypt architecture, crypt abscesses, and a decrease in goblet cells.
[0003] Currently, clinical treatments mainly rely on drugs, but these drugs can only alleviate colitis, not completely cure it, and also have side effects. Therefore, research on new gene therapy targets for colitis can help provide new options and directions for the treatment of colitis, which will bring huge benefits to mankind.
[0004] Nogo-B is a conserved protein located in the endoplasmic reticulum of eukaryotic cells and a member of the reticulum transmembrane protein family. Nogo-B is present in mammalian tissues and organs, including the colon, liver, blood vessels, and kidneys. Existing research has shown that Nogo-B expression is associated with a variety of diseases, including atherosclerosis, alcoholic liver disease, lipid metabolism, tumor development, intimal neoplasia, and cholestasis. While studies have shown that the Nogo-B gene can influence several inflammatory diseases, no research has yet examined the relationship between Nogo-B and colitis.
[0005] Based on this, the present invention is proposed. Summary of the Invention
[0006] The purpose of the present invention is to provide an application of a Nogo-B inhibitor in the preparation of a drug for treating colitis.
[0007] To achieve the above-mentioned and other related purposes, the preferred technical solution provided by the present invention is: use of a Nogo-B inhibitor in the preparation of a drug for treating colitis.
[0008] The preferred technical solution is: the nucleotide sequence of the Nogo-B gene is SEQ No.1.
[0009] SEQ No. 1:
[0010] ATGGACGATCAGAAGAAACGTTGGAAGGACAAGGTTGTTGACCTCCTGTACTGGAGAGACATTAAGAAGACTGGAGTGGTGTTTGGTGCCAGCTTATTCCTGCTGCTGTCTCTGACAGTGTTCAGCATTGTCAGTGTAACGGCCTACATTGCCTTGGCCCTGCTCTCTGTGACTATCAGCTTTAGGATATATAAGGGTGTGATCCAAGCTATCCAGAAATCAGATGAAGGCCACCCAT TCAGGGCATATTTGGAATCTGAAGTTGCCATATCAGAGGAATTGGTTCAGAAATATAGTAATTCTGCTCTTGGTCATGTGAACAGCACAATAAAAGAATTGAGGCGTCTCTTCTTAGTTGATGATTTAGTTGATTCCCTGAAGTTTGCAGTGTTGATGTGGGTATTTACTTACGTTGGTGCCTTGTTCAATGGTTTGACACTACTGATTTTAGCTCTGATCTCACTCTTCAGTATTCC TGTTATATATGAACGGCATCAGGCGCAGATAGATCATTATCTAGGACTTGCAAACAAGAGCGTTAAGGATGCCATGGCCAAAATCCAAGCAAAAATCCCTGGATTGAAGCGCAAAGCAGAATGA.
[0011] A preferred technical solution is: the Nogo-B inhibitor is an inhibitor that reduces the expression level of Nogo-B.
[0012] A preferred technical solution is: the Nogo-B inhibitor is a nucleic acid molecule that targets Nogo-B for gene editing, including reagents used for gene editing operations.
[0013] The preferred technical solution is: the Nogo-B inhibitor is a small interfering RNA, the sequence of which is as follows:
[0014] GCAGUGUUGAUGUGGGUAUUUTT,AAAUACCCACAUCAACACUGCTT.
[0015] To achieve the above-mentioned and other related purposes, the present invention provides a preferred technical solution: a drug for treating colitis, comprising small interfering RNA and a pharmaceutically acceptable material; the small interfering RNA has the following sequence:
[0016] GCAGUGUUGAUGUGGGUAUUUTT,AAAUACCCACAUCAACACUGCTT.
[0017] Due to the application of the above technical solution, the present invention has the following advantages compared with the prior art:
[0018] 1. It can significantly treat colitis and is a gene drug with good effects and few side effects.
[0019] 2. After the Nogo-B gene was reduced, no other abnormalities occurred, and it has high safety. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Attachment Figure 1 Comparison of HE results of colon in control and colitis mouse model.
[0021] Attachment Figure 2 Western-blot experiments were performed to compare the expression of Nogo-B and inflammatory factors IL-1β, IL-6, and tumor necrosis factor TNFα in the colon of control and colitis mouse models.
[0022] Attachment Figure 3 After THP1 cells were treated with Nogo-B small interfering RNA (siNogo-B), Western-blot experiments were performed to detect whether the Nogo-B gene was decreased at the protein level, as well as the expression changes of inflammatory factors IL-1β, IL-6, and tumor necrosis factor TNFα.
[0023] Attachment Figure 4 After culturing NCM460 with a culture medium containing the secretions of THP1 treated with siNogo-B, the proliferation of NCM460 cells was detected using the MTT assay.
[0024] Attachment Figure 5 After culturing NCM460 with culture medium containing secretions of THP1 treated with siNogo-B, the migration of NCM460 cells was detected using a scratch migration assay. DETAILED DESCRIPTION
[0025] The following describes the implementation of the present invention through specific embodiments. People skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in these embodiments.
[0026] See also Figure 1-5. It should be noted that the structures, proportions, sizes, etc. illustrated in the drawings of this specification are only used to match the contents disclosed in the specification for people familiar with this technology to understand and read, and are not used to limit the limiting conditions for the implementation of the present invention. Therefore, they have no technical substantive significance. Any modification of the structure, change in the proportional relationship or adjustment of the size. The following examples are provided for a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are all conventional methods unless otherwise specified. The experimental materials used in the following examples are all purchased from conventional biochemical reagent stores unless otherwise specified.
[0027] Example 1: Colonic injury in control and colitis mouse models
[0028] Wild-type mice (WT) were divided into two groups: one group received normal drinking water (Ctrl group) and the other group was fed 4% DSS (Dextrose Sodium Sulfate) (DSS group). After 7 days, the mice were sacrificed and dissected. The colons were fixed, dehydrated, embedded, and sectioned. The sections were stained with HE to determine whether the colon was damaged.
[0029] HE staining of colon tissue:
[0030] (1) Dewaxing: xylene 10 min - xylene 10 min - 100% ethanol 5 min - 100% ethanol 5 min - 95% ethanol 5 min - 90% ethanol 5 min - 80% ethanol 5 min - tap water 5 min - distilled water 5 min;
[0031] (2) Hematoxylin 20 s—tap water 5 min—distilled water 5 min—tap water 5 min—distilled water 5 min;
[0032] (3) Eosin 3 min;
[0033] (4) Dehydration and sealing: 80% ethanol for 5 min—90% ethanol for 5 min—95% ethanol for 5 min—100% ethanol for 5 min—100% ethanol for 5 min—xylene for 5 min—neutral resin sealing;
[0034] (5) Take photos using a Zeiss microscope.
[0035] The results are as follows Figure 1 As shown in the figure, compared with the control group, the colon damage of mice in the colitis group was more severe, indicating that the colitis model was successfully established.
[0036] Example 2: Expression of Nogo-B, IL-1β, IL-6, and TNFα in the colon in control and colitis mouse models.
[0037] 30 mg of colon tissue from each mouse was weighed into a 2 mL EP tube, and 500 μL of lysis solution and steel balls were added to each tube for tissue grinding. After grinding, the steel balls were removed, placed on ice, and shaken every 5 minutes. After repeated twice, the tube was centrifuged at 4 ° C 12000 r / min for 10 minutes, the supernatant was aspirated, and the protein concentration was then measured by BCA. The expression of the target protein in 60 μg of protein was quantitatively detected. The sample was first heat denatured at 100 ° C for 5 minutes, and then the sample was loaded, the gel was run, the membrane was transferred, and the skim milk was blocked at room temperature for 1 hour. The primary antibody was incubated overnight, and the PBS was washed 3 times for 8 minutes each time. The secondary antibody was incubated at room temperature for 1 hour, and the PBS was washed 3 times for 8 minutes each time. Finally, the ECL colorimetric solution was used for exposure. Compared with the control group, the expression levels of Nogo-B, inflammatory factors IL-1β, IL-6 and tumor necrosis factor TNFα in the colitis group were increased ( Figure 2 ).
[0038] Example 3: siNogo-B primer synthesis design and transfection
[0039] The sequence used in this embodiment is:
[0040] si-Ctrl: UUCUCCGAACGUGUCACGUdTdT; ACGUGACACGUUCGGAGAAdTdT; si-Nogo-B: GCAGUGUUGAUGUGGGUAUUUTT; AAAUACCCACAUCAACACUGCTT.
[0041] Anneal the two si-Ctrl sequences and the two si-Nogo-B sequences separately:
[0042] (1) Materials: sense and antisense single-stranded RNA molecules of the gene, 2X annealing buffer (200 nmol / L KAc, 4 mmol / L MgAc2, 60 mmol / L Hepes-KOH pH 7.4), and DEPC-treated water.
[0043] (2) Operation method
[0044] a Use an appropriate amount of DEPC-treated sterile water to dissolve the sense and antisense siRNA RNA chains of the gene respectively.
[0045] b. Add appropriate amounts of DEPC-treated sterile water, sense RNA and antisense RNA chains to the 2X annealing buffer, respectively, so that the final concentrations of the sense RNA and antisense RNA chains are both 20 mmol / L.
[0046] c. Denature the mixture at 90°C for 1 min, then incubate at 37°C for 1 h.
[0047] After annealing, lipofectamine RNAiMAX transfection reagent was used and the instructions for the lipofectamine RNAiMAX transfection reagent were strictly followed to obtain transfected samples. THP1 cells were divided into six-well plates and PMA (100 ng / mL) was added for 24 hours.
[0048] (1) For each transfection sample, prepare the siRNA-lipofectamine RNAiMAX mixture as follows:
[0049] a Dilute the transfection reagent lipofectamine RNAiMAX. Before use, gently shake the lipofectamine RNAiMAX transfection reagent, then take 1.5 μl and dilute it with 50 μl of serum-free optimized culture medium (Opti-MEM I), mix gently, and incubate at room temperature for 5 minutes.
[0050] b. Dilute siNogo-B: dilute 1 μl of siNogo-B with 50 μl of serum-free Opti-MEM I and mix gently;
[0051] After incubation for 5 minutes, the diluted lipofectamine RNAiMAX in step c was gently mixed with the diluted siRNA in step (b) above and incubated at room temperature for 20 minutes to form a siRNA-lipofectamine RNAiMAX mixture.
[0052] (2) Add the siRNA-lipofectamine RNAiMAX mixture to the six-well plate containing cells and culture medium and shake gently to mix;
[0053] (3) Place the six-well plate in a CO2 incubator at 37°C and incubate until the test time (24-96 hours). The recommended time for silencing efficiency testing is generally 24-72 hours. Optional operation (not necessary) After the transfection operation is completed and incubated at 37°C for 4-6 hours, the culture medium containing the siRNA-lipofectamine RNAiMAX mixture in the well can be removed and replaced with fresh growth medium. This will not affect the transfection efficiency.
[0054] Example 4: Changes in the expression of Nogo-B and inflammatory factors IL-1β, IL-6, and tumor necrosis factor TNFα after THP1 cells were treated with Nogo-B small interfering RNA (siNogo-B).
[0055] THP1 was divided into two groups, namely si-Ctrl and siNogo-B groups. After treatment (transfection) according to Example 3, 200 μL of lysate was added to each well, repeatedly pipetted, transferred to a 1.5 mL EP tube, placed on ice, and shaken every 5 minutes. After repeating twice, centrifuged at 4 ° C 12000 r / min for 10 minutes, the supernatant was aspirated, and then the protein concentration was measured by BCA. The expression of the target protein in 60 μg of protein was quantitatively detected, first heat denatured at 100 ° C for 5 minutes, then loaded, run the gel, transferred to the membrane, blocked with skim milk at room temperature for 1 hour, incubated with the primary antibody overnight, washed with PBS 3 times, each time for 8 minutes, incubated with the secondary antibody at room temperature for 1 hour, washed with PBS 3 times, each time for 8 minutes, and finally exposed in an exposure machine using ECL colorimetric solution. The results showed that after THP1 cells were treated with Nogo-B small interfering RNA (siNogo-B), the expression of Nogo-B and inflammatory factors IL-1β, IL-6, and tumor necrosis factor TNFα decreased ( Figure 3 ).
[0056] Example 5: MTT experiment to explore cell proliferation.
[0057] THP1 was divided into two groups, namely si-Ctrl and siNogo-B groups. 24 hours after gene transfection, the culture medium was discarded and fresh 1640 complete culture medium was added for 24 hours. The final culture medium was then collected and used to culture NCM460 cells in a 96-well plate for 24 hours. The culture medium was then carefully removed with a vacuum pump, and 100 μL of double-free culture medium containing MTT (MTT concentration: 0.5 mg / mL) was added or 10 μL of double-free culture medium containing MTT (MTT concentration: 5 mg / mL) was directly added to the culture medium and placed in an incubator for 2-4 hours. The culture medium was carefully removed with a vacuum pump and washed with an appropriate amount of PBS. Finally, 150 μL of DMSO was added to each well and incubated on a shaker until the color was evenly distributed. The sample absorbance was detected at 550 nm using a microplate reader, and the data was obtained. It was found that the NCM460 in the culture medium group containing the secretions of THP1 treated with siNogo-B significantly proliferated ( Figure 4 ).
[0058] Example 6: Scratch migration assay to investigate cell migration.
[0059] THP1 was divided into two groups, namely si-Ctrl and siNogo-B groups. 24 hours after gene transfection, the culture medium was discarded and fresh 1640 complete culture medium was added for 24 hours. The final culture medium was then collected. When NCM460 cells grew to 80%-90% of the well plate area, a cross mark was made in the well plate with a 200μL pipette tip. After washing with an appropriate amount of PBS, the well plate was photographed with a 5x objective lens. The collected culture medium was then added and photographed 24 hours later. It was found that NCM460 in the culture medium group containing secretions of THP1 treated with siNogo-B migrated faster ( Figure 5 ).
[0060] In summary, we concluded that Nogo-B affects the proliferation and migration of colonic epithelial cells by regulating inflammation, thereby affecting the pathogenesis of colitis. Therefore, Nogo-B inhibitors have a relatively broad application prospect in the treatment of colitis.
[0061] The above description is only used to explain the preferred embodiments of the present invention and is not intended to limit the present invention in any form. Therefore, any modifications or changes made to the present invention under the same inventive spirit should still be included in the scope of protection intended by the present invention.
Claims
1. Use of a Nogo-B inhibitor in the preparation of a drug for treating colitis, characterized in that: The Nogo-B inhibitor is a small interfering RNA, the sequence of which is as follows: GCAGUGUUGAUGUGGGUAUUUTT,AAAUACCCACAUCAACACUGCTT.