Function and application of TTK gene and TTK inhibitor in treatment of restenosis after vascular injury
By knocking out the TTK gene or using the TTK inhibitor BAY 1217389, the phenotypic transformation of smooth muscle cells after vascular injury was inhibited, solving the mechanism problem of restenosis after vascular injury, significantly reducing neointimal area and vascular remodeling, and providing new prevention and treatment methods.
Patent Information
- Application Number
- CN202310722320.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-06-16
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2043-06-16
AI Technical Summary
The mechanism of restenosis after vascular injury is still unclear. Current technologies lack effective targets to inhibit smooth muscle cell phenotypic transformation and vascular remodeling, resulting in a high incidence of restenosis and affecting the long-term efficacy of treatment.
By targeting the TTK gene, gene knockout or the use of TTK inhibitors such as BAY 1217389 can inhibit the phenotypic transformation of smooth muscle cells, reduce the area of neovascularized intima, and alleviate vascular remodeling and restenosis.
Significantly reducing the area of new intima after vascular injury and inhibiting the conversion of smooth muscle cells from a contractile phenotype to a dedifferentiated phenotype provides a new strategy for the prevention and treatment of vascular stenosis.
Smart Images

Figure CN117065023B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of medicine, and relates to the function and application of TTK gene in smooth muscle cell phenotype conversion and treatment of restenosis after vascular injury, in particular to TTK gene as a target in screening drugs for preventing and treating restenosis after vascular injury. BACKGROUND
[0002] Vascular remodeling and intimal thickening after vascular injury is a pathological change that occurs under the stimulation of various injury factors, and is a pathological process common to various cardiovascular diseases including hypertensive vascular disease, pulmonary arterial hypertension, end-stage renal disease, post-transplant arterial disease, diabetic vascular disease, ischemic stroke or coronary heart disease caused by atherosclerosis, etc. On the other hand, surgical treatment of blood vessels that have been narrowed or occluded, including balloon dilation, stent implantation, endarterectomy, and coronary artery bypass surgery, helps to improve blood perfusion and thus alleviate clinical symptoms, but the incidence of vascular restenosis is still high, which seriously affects the long-term efficacy of patients.
[0003] The specific mechanism of restenosis after vascular injury is not clear, but current research has shown that vascular smooth muscle cell (VSMC) phenotype conversion leading to vascular remodeling and intimal thickening is the main pathological basis for restenosis. VSMC phenotype conversion mainly refers to the transformation of VSMC from a contractile phenotype to a dedifferentiated phenotype, accompanied by increased secretion and decreased expression of contractile phenotype markers. Among them, the contractile phenotype markers of VSMC mainly include α-smooth muscle actin (α-SMA), smooth muscle 22 alpha (SM22α), and smooth muscle-specific calponin, etc. VSMC phenotype conversion plays an important role in the process of restenosis after vascular injury, but the mechanism of this process has not been fully elucidated. Finding new effective targets for inhibiting VSMC phenotype conversion and triggering vascular remodeling has important clinical significance and application prospects for the prevention and treatment of restenosis.
[0004] TTK gene is located on chromosome 6q13-q21, encoding threonine and tyrosine kinase (TTK), also known as Monopolar Spindle 1 (Mps1), which is currently identified as a dual specificity kinase. TTK is an important component of spindle assembly checkpoint (SAC), and it has been found that the increase of TTK level is closely related to the occurrence of tumor and poor prognosis, and TTK has become a candidate target for anti-cancer therapy. However, there is no research on the role of TTK gene in vascular restenosis after vascular injury, especially the vascular remodeling caused by VSMC phenotype conversion. SUMMARY
[0005] In order to solve the defects and deficiencies of the prior art, the purpose of the present application is to provide the function and application of TTK gene and TTK inhibitor in the treatment of vascular restenosis after vascular injury, specifically the application of TTK gene as a target in the screening of drugs for preventing and treating vascular restenosis after vascular injury, and the application of TTK inhibitor in the preparation of drugs for preventing and treating vascular restenosis after vascular injury.
[0006] In order to achieve the above purpose, the present application adopts the following technical measures:
[0007] The present application obtains the relationship between TTK gene and vascular restenosis after vascular injury:
[0008] 1. TTK gene knockout significantly reduces the intimal area and smooth muscle cell phenotype conversion after injury
[0009] The present application takes TTK f / f The control mice and TTK iΔSM The mice were used as experimental objects, and the vascular injury model of mice was induced by carotid guidewire injury operation. The vascular morphology and intimal area after carotid injury were studied, and the smooth muscle cell phenotype was detected. The results showed that TTK gene knockout could significantly reduce the neointimal area after carotid injury, and inhibit the conversion of smooth muscle cells from contractile phenotype to dedifferentiated phenotype.
[0010] 2. TTK inhibitor BAY 1217389 significantly reduces the intimal area and smooth muscle cell phenotype conversion after injury
[0011] The present application takes C57BL / 6 mice as experimental objects, and a mouse vascular injury model is induced by carotid artery guide wire injury operation. After treatment with a control vector and a TTK inhibitor, the vascular morphology and intimal area after carotid artery injury are studied, and the smooth muscle cell phenotype is detected. The results show that the TTK inhibitor can significantly reduce the neointimal area after carotid artery injury, and inhibit the conversion of smooth muscle cells from the contractile phenotype to the dedifferentiated phenotype.
[0012] From the above results, it can be known that after vascular injury, TTK gene deficiency or TTK inhibitor reduces the vascular neointimal area, and inhibits the phenotype conversion of smooth muscle cells, thereby relieving vascular remodeling and restenosis caused by vascular injury. Therefore, TTK has the functions of promoting smooth muscle cell phenotype conversion and vascular remodeling, and promoting the occurrence of restenosis after vascular injury. The present application provides a theoretical basis and clinical basis for studying new targets and new strategies for preventing and treating restenosis after vascular injury.
[0013] In view of the functions of TTK in promoting smooth muscle cell phenotype conversion and vascular remodeling, the present application provides an application of TTK gene as a drug target in screening drugs for preventing and treating vascular stenosis diseases and / or post-angioplasty restenosis and / or post-stent restenosis.
[0014] In view of the functions of TTK in promoting smooth muscle cell phenotype conversion and vascular remodeling, the present application further provides an application of a TTK inhibitor in preparing a drug for preventing and treating vascular stenosis diseases and / or post-angioplasty restenosis and / or post-stent restenosis.
[0015] In the present application, the vascular stenosis disease is caused by vascular smooth muscle phenotype conversion and vascular remodeling.
[0016] Further, the vascular stenosis disease in the present application includes vascular stenosis in the state of hypertension vascular lesion, pulmonary arterial hypertension, end-stage renal disease, post-transplant arterial disease, diabetic vascular disease, ischemic stroke or coronary heart disease caused by atherosclerosis.
[0017] In the present application, the post-angioplasty restenosis is the restenosis of the vascular lumen caused by the phenotype conversion of the affected smooth muscle cells after angioplasty.
[0018] Further, the angioplasty in the present application is percutaneous transluminal coronary angioplasty, carotid angioplasty, other arterial angioplasty and arteriovenous fistuloplasty.
[0019] Still further, the angioplasty in the present application is selected from balloon angioplasty, laser angioplasty, atherectomy and intravascular support.
[0020] In the present application, the restenosis after stent placement refers to the restenosis of the blood vessel lumen caused by the phenotypic conversion of the vascular smooth muscle cells in the stent after the stent is placed in the stenotic blood vessel.
[0021] In the present application, the TTK inhibitor is one of the siRNA of the TTK gene, the RNA interference vector of the TTK gene or other inhibitors capable of inhibiting the expression or activity of TTK; including the TTK inhibitor BAY 1217389.
[0022] The present application has the following advantages and effects relative to the prior art:
[0023] (1) The present application discovers the new function of the TTK gene, i.e., the TTK gene has the effect of promoting the phenotypic conversion of the smooth muscle cells and the vascular remodeling and promoting the occurrence of the restenosis after the vascular injury.
[0024] (2) Based on the effect of the TTK in promoting the phenotypic conversion of the smooth muscle cells and the occurrence of the restenosis after the vascular injury, the inhibitor of the TTK can inhibit the phenotypic conversion of the smooth muscle cells, so that it can be widely used as a drug for preventing and treating the vascular stenosis disease and the restenosis after the vascular injury. BRIEF DESCRIPTION OF DRAWINGS
[0025] Figure 1 is the HE staining diagram of the carotid artery of the control mice and the TTK iΔSM mice in Example 1;
[0026] Figure 2 is the intima area result statistical diagram of the carotid artery of the control mice and the TTK iΔSM mice in Example 1;
[0027] Figure 3 is the mRNA level result statistical diagram of the expression of the smooth muscle cell contraction phenotype markers α-SMA, SM22α and Calponin molecules of the blood vessels of the control mice and the TTK iΔSM mice in Example 2;
[0028] Figure 4 is the HE staining diagram of the carotid artery of the mice treated with the control vector and BAY 1217389 in Example 3;
[0029] Figure 5 is the intima area result statistical diagram of the carotid artery of the mice treated with the control vector and BAY 1217389 in Example 3;
[0030] Figure 6 is the mRNA level result statistical diagram of the expression of the smooth muscle cell contraction phenotype markers α-SMA, SM22α and Calponin molecules of the blood vessels of the mice treated with the control vector and BAY 1217389, respectively. DETAILED DESCRIPTION
[0031] The technical solutions of the present application will be further described in detail below in combination with specific examples. It should be understood that the following examples are only illustratively and explain the present application, and should not be interpreted as limiting the scope of protection of the present application. Any technology achieved based on the above description of the present application is covered within the scope intended to be protected by the present application.
[0032] The terms used in the following examples, without special description, have the same meaning as generally understood by those skilled in the art. The experimental methods not marked with specific conditions are usually completed according to the conventional schemes in the art or the schemes suggested by the manufacturers. The reagents and materials not marked with special description can be purchased on the market.
[0033] Experimental animals and feeding: TTK f / f Mice were purchased from Jiangsu Jicui Yaoke Biotechnology Co., Ltd.;
[0034] Myh11 CreERT2 Mice were purchased from Jackson lab; TTK f / f smooth muscle-specific knockout mice (TTK
[0035] Myh11 CreERT2 referred to as TTK iΔSM ) were obtained by crossing TTK f / f Myh11 CreERT2 mice.
[0036] Animal feeding conditions: All experimental mice were fed in the SPF animal room of Tongji Medical College, Huazhong University of Science and Technology. The light was turned on every 12 hours, the temperature was 24±2℃, the humidity was 40%-70%, and the mice were free to drink water and eat food.
[0037] Mouse carotid wire injury model: Carotid wire injury was performed in 8-10 week old male mice using a 0.015 inch diameter wire (Cook, Bloomington, IN); the left carotid artery was dissected through a midline incision in the neck, and the left common carotid artery and the left internal carotid artery were temporarily ligated to temporarily interrupt blood flow during the operation, and then the distal end of the left external carotid artery was ligated, and an incision was made proximal to the ligation, and the wire was inserted into the left common carotid artery 1 cm through the incision. The wire was rotated out to the carotid bifurcation to injure the endothelium, and the wire was removed after repeating the process 3 times. Then the proximal end of the external carotid artery was ligated, and the blood flow in the left common carotid artery and the left internal carotid artery was restored, and the skin was sutured with 6-0 suture. The carotid artery was collected on day 28 after injury for further study.
[0038] Animal jelly administration: Splenda powder was added to double distilled water and stirred uniformly to prepare a 20% (w / v) solution. The solution was administered to the mice by gavage at a dose of 0.5 ml / 100 g body weight.
[0039] (wt / vol) Splenda solution. Gelatin was added to the prepared Splenda solution to make a 14% (wt / vol) gelatin stock solution, which was stirred and heated to 55-60°C until the solution became clear. The calculated dose of drug solution (1 mg / kg) and gelatin stock solution were added to each well of the jelly mold, with a total volume of 200 μl, mixed well, and placed at -20°C for 3 hours or so until the jelly was solidified. The carotid artery surgery was performed on the next day, and the mice were given control jelly and TTK inhibitor drug jelly twice a day, respectively, starting from the first and second day of each week. The mice were kept as undisturbed as possible, and waited until the mice finished eating the jelly. The intermittent administration was used, i.e., two days of administration per week, and five days of rest, for a total of four weeks.
[0040] Experimental animal grouping: 8-week-old, 19-25 g, male, TTK f / f Control mice and TTK iΔSM Mice: The above mice were given tamoxifen injection (1 mg / day / mouse) for 10 consecutive days at 6 weeks to induce TTK conditional knockout in smooth muscle cells, and were given a 7-day recovery period before the surgery.
[0041] Example 1
[0042] 8-week-old, 19-25 g, male TTK f / f Control mice and TTK iΔSM Mice were given carotid artery guide wire injury or sham injury surgery, and were euthanized and the carotid artery specimens were collected 28 days after modeling. The specimens were fixed with 4% paraformaldehyde overnight, paraffin-embedded, and made into 3 μm paraffin sections, which were then subjected to oil red-hematoxylin (HE) staining to detect the vascular morphology after vascular injury in the mice, and the results are shown in Figure 1 As shown by HE staining, after vascular injury, the neointima of the carotid artery was obvious, and the neointima area of the TTK iΔSM Mice was significantly smaller than that of the control mice; the intimal area of the carotid artery of the two groups of mice was statistically analyzed, and the results are shown in Figure 2 As shown by Figure 1 and Figure 2 Compared with the TTK f / f Control mice (Control), the neointimal area after carotid artery injury in smooth muscle-specific TTK knockout mice (TTK iΔSM ) was significantly reduced.
[0043] Example 2
[0044] The carotid artery tissue collected after the guide wire injury or sham operation injury of the carotid artery of the mouse in Example 1 was taken out, and an appropriate amount of Trizol was added, and after ultrasonic crushing or glass homogenizer grinding, it was placed on ice for 30 min; the Trizol suspension of the vascular tissue was collected in a new RNAse-free EP tube, and was placed at room temperature for 5 min; 200 μl of chloroform was added, and was shaken vigorously, and was placed at room temperature for 5 min; 12000 rpm / min, 4°C centrifugation for 15 min; take the supernatant, transfer to a new RNAse-free EP tube, add an equal volume of pre-cooled isopropanol, mix well, and place on ice for 10 min; 12000 rpm / min, 4°C centrifugation for 10 min; discard the supernatant, wash the RNA with anhydrous ethanol; 12000 rpm / min, 4°C centrifugation for 5 min; discard the supernatant, dry in a clean bench, add 30-50 μl of DPEC water to dissolve; take 2 μl of RNA solution, add 98 μl of DEPC water, mix well and reserve; the concentration of RNA was determined by ultraviolet spectrophotometer. After preparing the reverse transcription system using PrimeScript TM RT Master Mix (Perfect Real Time) kit (Japan TaKaRa), the cDNA was amplified by a thermal cycler, and then TB Green TM Premix Ex Taq TM Kit (Japan TaKaRa) was used for real-time fluorescent quantitative PCR reaction to detect the mRNA levels of mouse carotid artery contraction phenotype markers α-smooth muscle actin (α-SMA), smooth muscle 22 alpha (SM22α) and smooth muscle specific calponin molecules, respectively;
[0045] The primer sequences used in the above Example 2 are as follows:
[0046] α-SMA-F, GGCATCCACGAAACCACCTA;
[0047] α-SMA-R, GCTGGAAGGTAGACAGCGAA;
[0048] SM22α-F, ACGATGGAAACTACCGTGGAG;
[0049] SM22α-R, TTGAAGGCCAATGACGTGCT;
[0050] Calponin-F, TCATCTGCACCTCTGCTTTG;
[0051] Calponin-R,GGGCCAGCTTGTTCTT ACT.
[0052] The results are as follows Figure 3 As shown, compared with control mice, smooth muscle-specific TTK knockout mice (TTK) i ΔSM α-SMA, a phenotypic marker of smooth muscle cell contraction following carotid artery injury (e.g., Figure 3 A) SM22α (e.g.) Figure 3 B) and Calponin (e.g.) Figure 3 The expression level of C) increased significantly.
[0053] Example 3
[0054] Eight-week-old male C57BL / 6 mice weighing 19-25g underwent carotid artery guidewire injury or sham surgery. They were randomly divided into two groups and treated with a control jelly and a TTK inhibitor jelly, respectively: the control vehicle group and the TTK inhibitor group (BAY 1217389). Mice were euthanized 28 days post-surgery, and carotid artery specimens were collected. The specimens were fixed overnight in 4% paraformaldehyde, embedded in paraffin, and prepared into 3μm paraffin sections. Oil Red Hematoxylin (HE) staining was then performed to examine the vascular morphology of the mouse carotid artery after injury. Figure 4 As shown in the figure, HE staining revealed that after carotid artery injury surgery, mice orally administered TTK inhibitor jelly showed a significantly smaller neointima area in the carotid artery compared to mice orally administered control jelly. The carotid artery intima areas of the two groups of mice were statistically analyzed, and the results are shown below. Figure 5 As shown in the figure, the experimental results showed that the neointimal area of the TTK inhibitor group (BAY 1217389) was significantly reduced after carotid artery injury compared with the vector group (Vehicle).
[0055] Example 4
[0056] Carotid artery tissue collected from mice after guidewire injury or sham surgery in Example 3 was extracted. An appropriate amount of Trizol was added, and the tissue was homogenized using ultrasound or a glass homogenizer. Total RNA was extracted according to the manufacturer's instructions. Real-time quantitative PCR was performed, and the mRNA levels of mouse carotid artery contraction phenotype markers smooth muscle actin α-SMA, SM22α, and Calponin were detected using the same primers as in Example 2. The detection results are as follows: Figure 6 As shown; the experimental results indicate that the TTK inhibitor group (BAY 1217389) mice showed a higher level of α-SMA (a phenotypic marker of smooth muscle cell contraction after carotid artery injury) compared to the vector group (Vehicle) mice.Figure 6 A), SM22a Figure 6 B), and Calponin Figure 6 C) were significantly increased.
[0057] The above results show that TTK gene can directly promote the occurrence of restenosis after vascular injury and the phenotypic conversion of smooth muscle cells. Knocking out TTK gene or using its inhibitor can reduce the occurrence of restenosis after vascular injury and inhibit the conversion of smooth muscle cells from a contractile phenotype to a dedifferentiated phenotype, thereby relieving vascular remodeling caused by vascular injury. Therefore, it can be used for preparing a drug for preventing, relieving, and / or treating a restenosis disease after vascular injury.
[0058] The above examples are the preferred embodiments of the present application, but the embodiments of the present application are not limited by the above examples. Those skilled in the art can clearly make various modifications to the above examples, including changes, modifications, substitutions, combinations, simplifications, etc., without departing from the general spirit and concept of the present application, which are all equivalent replacement methods and are included in the protection scope of the present application. The protection scheme of the present application is subject to the claims attached to the present application.
Claims
1. An application of TTK gene as a drug target in screening drugs for the prevention and treatment of vascular stenosis; the application is for non-diagnostic and non-therapeutic purposes; the drug for the prevention and treatment of vascular stenosis is the TTK inhibitor BAY 1217389; the vascular stenosis is vascular stenosis caused by vascular smooth muscle phenotypic transformation and vascular remodeling.
2. The application of the TTK gene as a drug target in screening drugs for the prevention and treatment of vascular stenosis according to claim 1, characterized in that: The vascular stenosis diseases mentioned include hypertensive vascular disease, pulmonary hypertension, end-stage renal disease, post-transplant arterial disease, diabetic vascular disease, and vascular stenosis caused by ischemic stroke or coronary heart disease due to atherosclerosis.
3. The use of a TTK inhibitor in the preparation of a drug for the prevention and treatment of vascular stenosis, wherein the TTK inhibitor is BAY 1217389; and the vascular stenosis is vascular stenosis caused by vascular smooth muscle phenotypic transformation and vascular remodeling.
4. The use of the TTK inhibitor according to claim 3 in the preparation of a medicament for the prevention and treatment of vascular stenosis, characterized in that: The vascular stenosis diseases mentioned include hypertensive vascular disease, pulmonary hypertension, end-stage renal disease, post-transplant arterial disease, diabetic vascular disease, and vascular stenosis caused by ischemic stroke or coronary heart disease due to atherosclerosis.
Citation Information
Patent Citations
Function of transcription induction spermiogenesis gene 40(Tisp40) in treatment of angiostenosis after damage and application thereof
CN104147617A
Methods of treating cancers characterized by high expression level of spindle and kinetochore associated complex subunit 3 (SKA3) gene
CN112334135A