A barcode prepared based on a gene polymorphism fragment of a chloroplast genome of atractylodes chinensis and application thereof

Abstract

The application provides a group of gene polymorphic fragments of a chloroplast genome of Atractylodes chinensis and a DNA barcode prepared by using the gene polymorphic fragments, the gene polymorphic fragments can be used for identifying Atractylodes chinensis germplasm resources, and the DNA barcode can be used for plant seed batch anti-counterfeiting. Through the technical scheme provided by the application, dual anti-counterfeiting of high-quality plant varieties and seeds can be realized, and the uniqueness, the recognizability and the traceability of variety identification and scientific seed management are achieved.

Description

Technical Field

[0001] This invention relates to a method for identifying Atractylodes lancea, specifically a method for identifying the authenticity, batch, and origin of Atractylodes lancea using polymorphic fragments of the Atractylodes lancea chloroplast genome. Background Technology

[0002] Atractylodes chinensis Koidz., commonly known as Northern Atractylodes, is a perennial herb belonging to the genus Atractylodes in the Asteraceae family. Its rhizome is used medicinally as a spleen-strengthening herb, possessing a bitter, warm, and pungent taste, and is believed to have effects of drying dampness, resolving turbidity, and relieving pain. It is mainly distributed in northern China and exhibits strong resistance to various environmental stresses. The 20th edition of the Pharmacopoeia of the People's Republic of China clearly stipulates that Northern Atractylodes originates from the dried rhizome of Atractylodes chinensis (DC.) Koidz. Although relevant literature has reported on the characteristics and physicochemical identification of Northern Atractylodes and its interspecific or adulterants, there is still a lack of research on how to trace the origin of the medicinal material, distinguish different production batches, select high-quality varieties, and determine the growth period.

[0003] The complex origins and unstable quality of medicinal materials are major contributing factors to the challenges in the development of traditional Chinese medicine (TCM). When multiple plants of the same genus are used as medicinal materials, traditional identification methods, such as morphological and structural similarities, are difficult due to their similarity. Even experienced professionals and pharmacists find these methods time-consuming and laborious, and accuracy cannot be guaranteed. In recent years, DNA barcoding molecular identification technology has been widely applied in the field of TCM identification. Maternally inherited double-stranded circular DNA from chloroplasts exhibits strong sequence conservation and a stable genome structure, making it a valuable tool for phylogenetic analysis and identification. Research has revealed polymorphic regions in the chloroplast genome, such as the matK and rbcl gene fragments, which are frequently used to identify medicinal materials and their phylogenetic relationships. For example, Zhang Xiaoqin used the matK gene fragment to identify the origin of rhubarb, Wang Yujin used the trnL-F gene fragment to explore the phylogeny of the genus *Chrysanthemum*, and Wu Zhigang used the rbcl gene fragment to study the origin and phylogenetic relationships of yam-like plants. These polymorphic gene fragments can provide molecular markers for identification at the plant species level, and can also provide accurate genetic diversity and population structure for species, further providing valuable information for variety selection and breeding. However, there are currently no reports, either domestically or internationally, of polymorphic gene regions that can be used for germplasm identification of Atractylodes lancea. Summary of the Invention

[0004] To fill the gap in the existing technology, the present invention provides a polymorphic fragment of the chloroplast genome of Atractylodes lancea and its application, wherein the gene fragment is a polymorphic fragment of the ccsA and / or ndhD genes.

[0005] A first aspect of the present invention provides an application of ccsA and / or ndhD gene polymorphic fragments as a DNA barcode for identifying Atractylodes lancea. In one embodiment, the identifying DNA barcode can be used for germplasm identification of Atractylodes lancea, more specifically, the germplasm identification includes the identification of the sample's origin, place of origin, quality, and authenticity.

[0006] A second aspect of the present invention provides a method for batch anti-counterfeiting of Atractylodes lancea seeds using polymorphic fragments of the ccsA and / or ndhD genes, the method comprising:

[0007] (1) Haplotype selection and cultivation of Atractylodes lancea

[0008] Haplotype seeds will be collected, and haplotypes carrying different ccsA and / or ndhD gene polymorphic fragments will be combined before being planted in batches.

[0009] (2) Identification of batches of Atractylodes lancea samples

[0010] The above-mentioned Atractylodes lancea samples were collected, DNA was extracted, and the ccsA and / or ndhD gene fragments in the chloroplast polymorphic region of Atractylodes lancea were amplified and sequenced. The sequencing results were analyzed, and the batch of Atractylodes lancea samples planted were determined based on the haplotype sequence and combination.

[0011] A third aspect of the present invention provides a kit for identifying germplasm of Atractylodes lancea and its application, the kit comprising primers and reagents for amplifying polymorphic fragments of the chloroplast ccsA and / or ndhD genes of Acanthopanax senticosus.

[0012] In a fourth aspect, the present invention provides a kit for batch anti-counterfeiting of Atractylodes lancea seeds and its application, the kit comprising primers and reagents for amplifying polymorphic fragments of the chloroplast ccsA and / or ndhD genes of Acanthopanax senticosus.

[0013] Compared with the prior art, the present invention has achieved at least the following beneficial technical effects:

[0014] 1. The polymorphic fragment of Atractylodes lancea gene provided by this invention can be used to identify the germplasm of Atractylodes lancea medicinal material. The method is simple to operate, highly accurate, and can distinguish Atractylodes lancea from different origins and germplasms.

[0015] 2. The polymorphic fragment of Atractylodes macrocephala gene provided by this invention can be used as a DNA barcode to identify the authenticity of Atractylodes macrocephala medicinal materials, which can quickly and effectively identify the authenticity of different batches of Atractylodes macrocephala medicinal materials and ensure the stability of the Atractylodes macrocephala medicinal material market order.

[0016] 3. The polymorphic fragments of Atractylodes macrocephala provided by this invention can provide valuable information for accurate genetic diversity and population structure analysis of Atractylodes macrocephala species. Attached Figure Description

[0017] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used in conjunction with embodiments of the invention to explain the invention and do not constitute a limitation thereof. In the drawings:

[0018] Figure 1 Different haplotype sequences of the ccsA gene fragment;

[0019] Figure 2 Evolutionary tree constructed from ccsA haplotype sequences;

[0020] Figure 3 Genetic distance constructed from ccsA haplotype sequences;

[0021] Figure 4 Different haplotype sequences of the ndhD gene fragment;

[0022] Figure 5 Evolutionary tree constructed from ndhD haplotype sequences;

[0023] Figure 6 Genetic distance constructed from ndhD haplotype sequences;

[0024] Figure 7 Sequencing peak diagrams of haplotype Hap5 (HLJDXAL1) and haplotype Hap8 (HLJDXAL8) ccsA fragments;

[0025] Figure 8 Sequencing peak diagrams of ccsA fragments of haplotype Hap5 (number SXLF21) and haplotype Hap7 (number HNXX5);

[0026] Figure 9 Sequencing peak diagrams of ndhD fragments of haplotype Hap2 (NMGARQ 8) and haplotype Hap1 (NMGARQ 12);

[0027] Figure 10 Sequencing peak diagrams of ndhD fragments of haplotypes HNNY7 (Hap1) and HNXX2 (Hap3). Detailed Implementation

[0028] Example 1: Screening of polymorphic regions in the chloroplast genome of Atractylodes lancea

[0029] 1.1 Results of chloroplast genome gene region alignment (initial screening of polymorphic regions)

[0030] First, four Atractylodes lancea samples from four regions—Xingan League in Inner Mongolia, Baoding in Hebei, Shangluo in Shaanxi, and Chaoyang in Liaoning—were collected. Chloroplast genomes were extracted and sequenced. The sequencing results were compared with two existing chloroplast genome datasets (MG874805 and MT834519) from NCBI using the ClutalW2 software, yielding 74 comparison results. Of these, 42 genes showed 100% similarity. Two genes had only one differentially expressed site; these 44 genes could not be used for DNA barcoding. The remaining 30 samples with the highest chloroplast gene similarity were sorted from lowest to highest, as shown in Table 1-1. The data in the table demonstrates the high sequence similarity of the Atractylodes lancea chloroplast gene regions.

[0031] Table 1-1 The 30 chloroplast genes with the highest variability in Atractylodes lancea

[0032]

[0033]

[0034] 1.2 Screening for polymorphic regions in the chloroplast genome of Atractylodes lancea (rescreening of polymorphic regions)

[0035] For an efficient barcode sequence to be effective, in addition to having sufficient variability to distinguish different species, it also needs to meet the experimental requirements of PCR amplification and PCR product sequencing. Therefore, sequence length is also one of the screening factors. Intergenic regions with sequence similarity <99.8% and alignment lengths between 500bp and 1500bp, as well as gene regions that can effectively distinguish species, were manually checked. The results (Table 1-2) show that, among the sequences that meet the requirements, the ccsA and ndhD gene regions each have their specific variant sites in their respective regions of each sample. Specifically, the ccsA gene region has variants at bases 310, 395, 588, 596, 636, 783, 798, and 817; the ndhD gene region has variants at bases 107, 214, 501, 549, 746, 870, 994, and 1096.

[0036] Another gene sequence, rpl16, which meets the above requirements, is unsuitable for identification due to its few variant sites and the presence of deleted or inserted bases. Therefore, it was manually checked and screened to obtain the following results: The intergenic region between ccsA and ndhD genes can serve as a basis for the development of northern regions. DNA barcoding for the specific identification of Atractylodes lancea terroir core germplasm.

[0037] Table 1-2 Specific DNA Barcode Fragments of Atractylodes lancea Core Germplasm

[0038]

[0039]

[0040] Example 2 uses the ccsA and ndhD gene regions as an example to achieve the identification of different authentic core species of Atractylodes lancea. Quality identification

[0041] 2.1 Collect Atractylodes macrocephala seeds from different regions

[0042] Multiple samples of medicinal materials from different regions across the country were collected (regions listed in Table 2-1). DNA was extracted and the ccsA and ndhD gene fragments were amplified by PCR using specific primers ccsA-F: ATGATATTTTCAACTTTAGAGCA; ccsA-R: AAACGAACCATAACTATGTAGCC; ndhD-F: GAACTTCTTCTAACAACCTATGC; ndhD-R: AATACCTTCAACCTTGTCAACTG. After gel extraction, the fragments were sequenced.

[0043] Table 2-1 Sample collection table of Atractylodes lancea from different regions

[0044]

[0045]

[0046] 2.2 Analysis of haplotype sequence characteristics and genetic distance of Atractylodes lancea from different regions using gene regions

[0047] By using the barcode sequences obtained through screening in the above embodiments, haplotype detection was performed on Atractylodes lancea samples from different origins, thereby examining the identification ability of the screened barcode sequences.

[0048] 2.2.1 Haplotype sequence characteristics of Atractylodes lancea from different regions were analyzed using CCSA.

[0049] The mutation sites of the ccsA gene are mainly distributed between 310 and 817 bp, with 10 haplotypes, namely ccsA Hap1-Hap10. Specifically, the specific bases at position 310 of haplotypes Hap3, Hap4, Hap5, Hap7, Hap8, Hap9, and Hap10 are C; at position 395 of Hap3, it is G; at position 588 of Hap10, it is C; at position 596 of Hap3, Hap8, and Hap10, it is T; at position 636 of Hap2 and Hap7, it is T; at position 783 of Hap4, it is T; at position 798 of Hap6, it is G; and at position 817 of Hap9, it is C. Figure 1 ).

[0050] Sequencing analysis of Atractylodes lancea samples from 10 origins listed in Table 2-1 revealed that all 10 ccsA gene haplotypes could be distinguished. The sequences of each ccsA gene haplotype are shown in SEQ ID NO.:1-10.

[0051] Phylogenetic trees and genetic distances were constructed from haplotype sequences of Atractylodes lancea using MEGA X software. Figure 2 It can be seen that the phylogenetic tree constructed from haplotype sequences can be divided into two major branches; Hap8, Hap3 and Hap10 form one major branch with a support rate of 65%; Hap1, Hap2, Hap4, Hap6, Hap7 and Hap9 are distributed on the other branch with a support rate of 23%.

[0052] from Figure 3 It can be seen that the genetic distances of different haplotypes of Atractylodes lancea ccsA sequences range from 0.00130 to 0.00524, with an intraspecific average genetic distance of 0.00. Among them, the genetic distances between haplotypes Hap6 and Hap1, Hap3 and Hap8, and Hap2 and Hap7 are the smallest, at 0.00130; while the genetic distance between haplotypes Hap10 and Hap2 is the largest, at 0.00542. The structure of the genetic distance analysis is consistent with the structure of the phylogenetic tree.

[0053] 2.2.3 Analysis of haplotype characteristics of Atractylodes lancea from different regions using ndhD

[0054] The ndhD gene mutation sites are mainly distributed between 107 and 1259 bp, with 9 haplotypes, namely ndhD Hap1-Hap9. The specific bases at positions 107 and 214 of haplotype Hap4 are A; at position 214 of Hap3, A; at position 501 of Hap2 and Hap9, A; at position 746 of Hap8, T; at position 870 of Hap5, A; at position 994 of Hap6, A; at position 1096 of Hap7, A; and at position 1259 of Hap9, T. Figure 4 ).

[0055] Sequencing analysis of Atractylodes lancea samples from 10 origins listed in Table 2-1 revealed that all 9 ndhD gene haplotypes could be distinguished. The sequences of each ndhD gene haplotype are shown in SEQ ID NO.:11-19.

[0056] Depend on Figure 5As can be seen, the phylogenetic tree constructed from haplotype sequences can be divided into two major branches, similar to the sequencing results analysis above; Hap2 and Hap0 form one major branch with a support rate of 68%; Hap1, Hap3, Hap4, Hap5, Hap6, Hap7, and Hap8 are distributed on the other branch with a support rate of 13%.

[0057] from Figure 6 It can be seen that the genetic distances of different haplotypes of Atractylodes lancea range from 0.00000 to 0.00327, with an intraspecific average genetic distance of 0.00. The genetic distance between haplotypes Hap3 and Hap1 is the smallest, at 0.00000; while the genetic distance between haplotypes Hap4, Hap5, Hap6, Hap7, Hap8, and Hap9 is the largest, at 0.00327. The structure of the genetic distance analysis is consistent with the structure of the phylogenetic tree.

[0058] Example 3: Anti-counterfeiting of Atractylodes lancea seeds using chloroplast polymorphic gene regions.

[0059] 3.1 Batch anti-counterfeiting verification of Atractylodes lancea seeds using ccsA gene region sequence

[0060] Pick Figure 1 Seeds of two different haplotypes, HLJDXAL 1 (haplotype Hap5) and HLJDXAL 8 (haplotype Hap8), were mixed and sown as a single production batch in April. In August, leaves from 10 different plants were collected and mixed for DNA extraction. The ccsA fragment was amplified using PCR, recovered from the gel, and sequenced. The sequencing peak diagram is shown below. Figure 7 As shown.

[0061] Depend on Figure 7 The ccsA fragment mutation site is clearly visible: at 596bp, the Hap5 base is A and the Hap8 base is T, and the sequencing peak diagram of this site shows an AT nested peak structure.

[0062] Choose another Figure 1 Seeds of two different haplotypes, *Atractylodes lancea* (Simplified Chinese version) Hap5 (haplotype SXLF 21) and Hap7 (haplotype HNXX 5), were mixed and sown as a single production batch in April. In August, ten leaves from different plants were collected and mixed for DNA extraction. The ccsA fragment was amplified using PCR, recovered from the gel, and sequenced. The sequencing peak diagram is shown below. Figure 7 As shown.

[0063] Sequencing results show that the peak diagrams of the ccsA fragments in each batch of Atractylodes lancea samples can identify the haplotypes, with obvious variant sites and overlapping peak structures. This fragment can be used as a batch barcode anti-counterfeiting method.

[0064] 3.2 Batch anti-counterfeiting verification of Atractylodes lancea seeds using ndhD gene region sequence.

[0065] Pick Figure 1 Seeds of two different haplotypes, NMGARQ 8 (Hap2) and NMGARQ 12 (Hap1), were mixed and sown as a single production batch in April. In August, leaves from 10 different plants were collected and mixed for DNA extraction. The ndhD fragment was amplified using PCR, recovered from the gel, and sequenced. The sequencing peak diagram is shown below. Figure 9 As shown.

[0066] Depend on Figure 9 The ndhD fragment mutation site is clearly visible: at 501bp, the Hap1 base is G and the Hap2 base is A. The sequencing peak diagram of this site shows a GA nested peak structure.

[0067] Choose another Figure 1 Seeds of two different haplotypes, HNNY7 (Hap1) and HNXX (Hap3), were mixed and sown as a single production batch in April. In August, ten leaves from different plants were collected and mixed for DNA extraction. The ndhD fragment was amplified using PCR and then sequenced. The sequencing peak diagram is shown below. Figure 10 As shown.

[0068] Depend on Figure 10 The ndhD fragment mutation site is clearly visible: at 214bp, the Hap1 base is G and the Hap3 base is A, and the sequencing peak diagram at this site shows a GA nested peak structure.

[0069] Sequencing results show that the ndhD fragment peak diagrams of each batch of Atractylodes lancea samples can identify the haplotypes, with obvious variant sites and overlapping peak structures. This fragment can be used as a batch barcode anti-counterfeiting method.

[0070] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations. sequence list <110> Beijing University of Chinese Medicine, Inner Mongolia Jiuhe Agricultural Technology Development Co., Ltd. <120> A barcode based on polymorphic fragments of Atractylodes lancea chloroplast genome and its application <130> CP211193 <141> 2022-05-20 <160> 19 <170> SIPOSequenceListing 1.0 <210> 1 <211> 969 <212> DNA <213> Atractylodes chinensis Koidz. <400> 1 atgatatttt caactttaga gcatatatta actcatattt ccttttcgat tgtttcaatt 60 gtaattacaa ttcatttgat aaccttattg ggcaatgaaa tcataaaacc atatgattcg 120 tcagaaaagg ggatgatagc tactttttta tgtctaacag gattattaat cactcgttgg 180 atttattcgg gacatttccc actaagtgat ttatatgaat cattaatctt tctttcatgg 240 agtttctccc ttatcatat agtcccttat ttcaaaataa gaaaaaatga tttaaccgca 300 ataactgcct taagtactat ttttacccaa ggctttgcta cttcgggtct tttaactgaa 360 acatataaac ccacaatatt agtacccgct ctacaatcgg agtggttaat aatgcacgta 420 agtatgatga tttgagcta tgcggctctt ctttgtggat cattattatc agtagcactt 480 ctagtcatta catttagaaa gattttttat agttataaaa gtaataattt attaaaatta 540 aatgagtcat tttcatttgg tgaaatccaa tacaagaatg aaagaaacaa tattttaaaa 600 aaaacttatt ttttttctgc taagaattat tacaaagccc aattgattca acaattagat 660 tattggagtt atcgtgtgat tagcctagga tttatcttttt taaccatagg tattctttca 720 ggagcagtat gggctaatga agcatgggga tcatattgga gttgggatcc aaaggaaact 780 tgggcctta ttacttggat cgtattcgca attatttgc atactcgaac aaataaaaaa 840 ttgcaggggg caaattccgc aattgtggcg actctaggct ttcttataat ttggatatgc 900 tattttgggg tcaatctatt aggaataggg ctacatagtt atggttcgtt tacgttaacc 960 tctagttaa 969 <210> 2 <211> 969 <212> DNA <213> Atractylodes chinensis Koidz. <400> 2 atgatatttt caactttaga gcatatatta actcatattt ccttttcgat tgtttcaatt 60 gtaattacaa ttcatttgat aaccttattg ggcaatgaaa tcataaaacc atatgattcg 120 tcagaaaagg ggatgatagc tactttttta tgtctaacag gattattaat cactcgttgg 180 atttattcgg gacatttccc actaagtgat ttatatgaat cattaatctt tctttcatgg 240 agttctccc ttattcatat agtcccttat ttcaaaataa gaaaaaatga tttaaccgca 300 ataactgcct taagtactat ttttacccaa ggctttgcta cttcgggtct tttaactgaa 360 atacataaac ccacaatatt agtacccgct ctacaatcgg agtggttaat aatgcacgta 420 agtatgatga ttttgagcta tgcggctctt cttgtggat cattattatc agtagcactt 480 ctagtcatta catttagaaa gatttttat agttataaaa gtaataattt attaaaatta 540 aatgagtcat tttcatttgg tgaaatccaa tacaagaatg aaagaaacaa tattttaaaa 600 aaaacttatt ttttttctgc taagaattat tacaaatccc aattgattca acaattagat 660 tattggagtt atcgtgtgat tagcctagga tttatcttttt taaccatagg tattctttca 720 ggagcagtat gggctaatga agcatgggga tcatattgga gttgggatcc aaaggaaact 780 tgggcctta ttacttggat cgtattcgca attatttgc atactcgaac aaataaaaaa 840 ttgcaggggg caaattccgc aattgtggcg actctaggct ttcttataat ttggatatgc 900 tattttgggg tcaatctatt aggaataggg ctacatagtt atggttcgtt tacgttaacc 960 tctagttaa 969 <210> 3 <211> 969 <212> DNA <213> Atractylodes chinensis Koidz. <400> 3 atgatatttt caactttaga gcatatatta actcatattt ccttttcgat tgtttcaatt 60 gtaattacaa ttcatttgat aaccttattg ggcaatgaaa tcataaaacc atatgattcg 120 tcagaaaagg ggatgatagc tactttttta tgtctaacag gattattaat cactcgttgg 180 atttattcgg gacatttccc actaagtgat ttatatgaat cattaatctt tctttcatgg 240 agttctccc ttattcatat agtcccttat ttcaaaataa gaaaaaatga tttaaccgca 300 ataactgcct caagtactat ttttacccaa ggctttgcta cttcgggtct tttaactgaa 360 atacataaac ccacaatatt agtacccgct ctacagtcgg agtggttaat aatgcacgta 420 agtatgatga ttttgagcta tgcggctctt cttgtggat cattattatc agtagcactt 480 ctagtcatta catttagaaa gatttttat agttataaaa gtaataattt attaaaatta 540 aatgagtcat tttcatttgg tgaaatccaa tacaagaatg aaagaaacaa tatttttaaa 600 aaaacttatt ttttttctgc taagaattat tacaaagccc aattgattca acaattagat 660 tattggagtt atcgtgtgat tagcctagga tttatcttt taaccatagg tattctttca 720 ggagcagtat gggctaatga agcatgggga tcatattgga gttgggatcc aaaggaaact 780 tgggccttta ttacttggat cgtattcgca atttatttgc atactcgaac aaataaaaaaa 840 ttgcagggg caaattccgc aattgtggcg actctaggct ttcttataat ttggatatgc 900 tattttgggg tcaatctatt aggaataggg ctacatagtt atggttcgtt tacgttaacc 960 tctagttaa 969 <210> 4 <211> 839 <212> DNA <213> Atractylodes chinensis Koidz. <400> 4 ttgggcaatg aaatcataaa accatatgat tcgtcagaaa aggggatgat agctactttt 60 ttatgtctaa caggattatt aatcactcgt tggatttatt cgggacattt cccactaagt 120 gatttatatg aatcattaat ctttctttca tggagtttct cccttattca tatagtccct 180 tatttcaaaa taagaaaaaa tgatttaacc gcaataactg cctcaagtac tatttttacc 240 caaggctttg ctacttcggg tcttttaact gaaatacata aacccacaat attagtaccc 300 gctctacaat cggagtggtt aataatgcac gtaagtatga tgatttgag ctatgcggct 360 cttctttgtg gatcattatt atcagtagca cttctagtca ttacatttag aaagattttt 420 tatagtata aaagtaataa tttattaaaa ttaaatgagt cattttcatt tggtgaaatc 480 caatacaaga atgaaagaaa caatatttta aaaaaaactt atttttttc tgctaagaat 540 tattacaaag cccaattgat tcaacaatta gattattgga gttatcgtgt gattagccta 600 ggatttatct ttttaaccat aggtattctt tcaggagcag tatgggctaa tgaagcatgg 660 ggatcatatt ggagttggga tccaaaggaa acttggtcct ttattacttg gatcgtattc 720 gcaatttatt tgcatactcg aacaaataaa aaattgcagg gggcaaattc cgcaattgtg 780 gcgactctag gctttcttat aatttggata tgctattttg gggtcaatct attaggaat 839 <210> 5 <211> 897 <212> DNA <213> Atractylodes chinensis Koidz. <400> 5 ccttttcgat tgtttcaatt gtaattacaa ttcatttgat aaccttattg ggcaatgaaa 60 tcataaaacc atatgattcg tcagaaaagg ggatgatagc tactttttta tgtctaacag 120 gattattaat cactcgttgg atttattcgg gacatttccc actaagtgat ttatatgaat 180 cattaatctt tctttcatgg agttctccc ttattcatat agtcccttat ttcaaaataa 240 gaaaaaatga tttaaccgca ataactgcct caagtactat ttttacccaa ggctttgcta 300 cttcgggtct tttaactgaa atacataaac ccacaatatt agtacccgct ctacaatcgg 360 agtggttaat aatgcacgta agtatgatga ttttgagcta tgcggctctt ctttgtggat 420 cattattatc agtagcactt ctagtcatta cattagaaaa gatttttat agttataaaa 480 gtaataattt attaaaatta aatgagtcat tttcatttgg tgaaatccaa tacaagaatg 540 aaagaaacaa tatttaaaa aaaacttatt ttttttctgc taagaattat tacaaagcccc 600 aattgattca acaattagat tattggagtt atcgtgtgat tagcctagga tttatcttttt 660 taaccatagg tattctttca ggagcagtat gggctaatga agcatgggga tcatattgga 720 gttgggatcc aaaggaaact tgggccttta ttacttggat cgtattcgca attatttgc 780 atactcgaac aaataaaaaa ttgcaggggg caaattccgc aattgtggcg actctaggct 840 ttcttataat ttggatatgc tattttgggg tcaatctatt aggaataggc tagcaaa 897 <210> 6 <211> 835 <212> DNA <213> Atractylodes chinensis Koidz. <400> 6 ggcaatgaaa tcataaaacc atatgattcg tcagaaaagg ggatgatagc tactttttta 60 tgtctaacag gattattaat cactcgttgg atttattcgg gacatttccc actaagtgat 120 ttatatgaat cattaatctt tctttcatgg agttctccc ttattcatat agtcccttat 180 ttcaaaataa gaaaaaatga tttaaccgca ataactgcct tagagtactat ttttacccaa 240 ggctttgcta cttcgggtct tttaactgaa atacataaac ccacaatatt agtacccgct 300 ctacaatcgg agtggttaat aatgcacgta agtatgatga tttgagcta tgcggctctt 360 ctttgtggat cattattatc agtagcactt ctagtcatta cattagaaa gatttttat 420 agttataaaa gtaataattt attaaaatta aatgagtcat tttcatttgg tgaaatccaa 480 tacaagaatg aaagaaacaa tattttaaaa aaaacttatt ttttttctgc taagaattat 540 tacaaagccc aattgattca acaattagat tattggagtt atcgtgtgat tagcctagga 600 tttatcttt taaccatagg tattctttca ggagcagtat gggctaatga agcatgggga 660 tcatattgga gttgggatcc aaaggaaact tgggccttta ttacttgggt cgtattcgca 720 atttatttgc atactcgaac aaataaaaaaa ttgcaggggg caaattccgc aattgtggcg 780 actctaggct ttcttataat ttggatatgc tattttgggg tcaatctatt aggaa 835 <210> 7 <211> 831 <212> DNA <213> Atractylodes chinensis Koidz. <400> 7 ttgggcaatg aaatcataaa accatatgat tcgtcagaaa aggggatgat agctactttt 60 ttatgtctaa caggattatt aatcactcgt tggatttatt cgggacattt cccactaagt 120 gatttatatg aatcattaat ctttctttca tggagtttct cccttattca tatagtccct 180 tatttcaaa tagaaaaaa tgatttaacc gcaatactg cctcaagtac tattttacc 240 aaggctttg ctacttcggg tctttact gaaatacata aacccacaat attagtaccc 300 gctctacaat cggagtggtt aaatgcac gtaagtatga tgatttgag ctatgcggct 360 cttctttgtg gatcattatt atcagtagca cttctagtca ttacattag aagattttt 420 tatagttaata aaagtataa tttattaaaa tttaatgagt cattttcatt tggtgaatc 480 caatacaaga atgaaagaa caatatttta aaaaaaactt atttttttc tgctaagaat 540 tattacaat cccaattgat tcaatta gattattgga gttatcgtgt gattagccta 600 ggatttatct ttttaaccat aggtattctt tcaggagcag tatggctct tgaagcatgg 660 ggatcatatt ggagttggga tccaaggaa acttgggcct ttattactg gatcgtattc 720 gcaatttatt tgcatactcg aacaaataa aaattgcagg gggcaattc cgcaattgtg 780 gcgactctag gcttcttat aatttggata tgctatttg gggtcaatct a 831 <210> 8 <211> 772 <212> DNA <213> Atractylodes chinensis Koidz. <400> 8 ttgggcaatg aaatcataaa accatatgat tcgtcagaaa aggggatgat agctactttt 60 ttatgtctaa caggattatt aatcactcgt tggatttatt cgggacattt cccactaagt 120 gatttatatg aatcattaat ctttctttca tggagtttct cccttattca tatagtccct 180 tatttcaaaa taagaaaaaa tgatttaacc gcaataactg cctcaagtac tatttttacc 240 caaggctttg ctacttcggg tcttttaact gaaatacata aacccacaat attagtaccc 300 gctctacaat cggagtggtt aataatgcac gtaagtatga tgattttgag ctatgcggct 360 cttctttgtg gatcattatt atcagtagca cttctagtca ttacatttag aaagattttt 420 tatagttata aaagtaataa tttattaaaa ttaaatgagt catttcatt tggtgaaatc 480 caatacaaga atgaaagaaa caatattttt aaaaaaaactt attttttttc tgctaagaat 540 tattacaaag cccaattgat tcaacaatta gattattgga gttatcgtgt gattagccta 600 ggatttatct ttttaaccat aggtattctt tcaggagcag tatgggctaa tgaagcatgg 660 ggatcatatt ggagttggga tccaaaggaa acttgggcct ttattacttg gatcgtattc 720 gcaatttatt tgcatactcg aacaaataaa aaattgcagg gggcaaattc cg <210> 9 <211> 835 <212> DNA <213> Atractylodes chinensis Koidz. <400> 9 taaccttatt gggcaatgaa atcataaaac catatgattc gtcagaaaag gggatgatag ctactttttt atgtctaaca ggattattaa tcactcgttg gattttcg ggacatttcc 180. 180. 180. 180. 180. 180. 180. 180. 180. 180 tagtccctta tttcaaaata agaaaaaatg atttaaccgc aataactgcc tcaagtacta tttttaccca aggctttgct acttcgggtc ttttaactga aatacataaa cccacaatat 360. tagtacccgc tctacaatcg gagtggttaa taatgcacgt aagtatgatg attttgagct atgcggctct tctttgtgga tcattattat cagtagcact tctagtcatt acatttagaa agtttttta tagttataa agtaataatt tattaaaatt aaatgagtca ttttcatttg gtgaaatcca atacaagaat gaaagaaaca atattttaa aaaaacttat tttttttctg ctaagaatta ttacaaagcc caattgattc aacaattaga ttattggagt tatcgtgtga ttagcctagg atttatcttt ttaaccatag gtattctttc aggagcagta tgggctaatg aagcatgggg atcatattgg agttgggatc caaaggaac ttggggccttt attacttgga 720 tcgtattcgc aatttattcg catactcga caataaaaa attgcagggg gcaaattccg caattgtggc gactctaggc tttcttata tttggatatg ctattttggg gtcaa <210> 10 <211> 851 <212> DNA <213> Atractylodes chinensis Koidz. <400> 10 60. the tcatttgata accttattgg gcaatgaat cataaaacca tatgattcgt cagaaaggg gatgatagct acttttttat gtctaacagg attack actcgttgga tttattcggg acatttccca ctaagtgatt fatherc attaatcttt ctttcatgga gtttctccct tattcatata gtcccttatt tcaaaataag aaaaaatgat ttaaccgcaa 300. aagtactatt tttacccaag gctttgctac ttcgggtctt ttaactgaaa tacataaacc cacaatatta gtacccgctc tacaatcgga gtggttaata atgcacgtaa 360 gtatgatgat tttgagctat gcggctcttc tttgtggatc attattatca gtagcacttc 420 tagtcattac atttagaaag atttttata gttataaaag taataattta ttaaaattaa 480 atgagtcatt ttcatttggt gaaatccaat acaagaatga aagaaaccat atttttaaaa 540 aaacttattt ttttctgct aagaattatt acaaaggccca attgattcaa caattagatt 600 attggagtta tcgtgtgatt agcctaggat ttatctttt aaccataggt attctttcag 660 gagcagtatg ggctaatgaa gcatggggat catattggag ttgggatcca aggaaactt 720 gggcctttat tacttggatc gtattcgcaa tttatttgca tactcgaaca aataaaaaat 780 tgcaggggc aaattccgca attgtggcga ctctaggctt tcttataatt tggatatgct 840 attttggggt c 851 <210> 11 <211> 1383 <212> DNA <213> Atractylodes chinensis Koidz. <400> 11 atgttcgaac ttcttctaac aacctatgca ttctgttatc atttccaatt ggacgatcca 60 ttaatccaac tagtagagga ctataaatgg atcaattttt ttgatttccg ttggaaatta 120 ggaatagatg gactgtctat aggacccgtt ttattaacag gatttatcac tactttagct 180 actttagcgg cctggcctgt tactcgggat tctcgattat tccattctct gatgttagca 240 atgtacagtg gtcaaatagg atcattttct tctcgggacc ttttacttttt tttcatcatg 300 tgggaattag aattaattcc ggtttatcta cttctatcca tgtggggagg aaagaaacgt 360 ctgtactcag ccacaaaatt tattttgtac acggcgggag gttccatttt tctcttaatg 420 ggagttctgg gtgtcggttt atatggttct aatgaaccaa cattaaattt tgaaacatca 480 gttaatcagt cgtatcctgt ggctttggaa ataatattct atattggatt ttttattgct 540 tttgctgtca aatcaccgat tctaccctta catacatggt taccagatac ccacggagag 600 gcgcattaca gtacttgtat gcttctagcc ggaattttat taaaaatggg agcgtatgga 660 ttgattcgga ttaatatgga attattacca cacgctcatt ctatattttc tccttggttg 720 atgatagtag gcacaataca aataatctat gcagcttcaa catctcccgg ccaacgtaat 780 ttaaaaaaaa gaatagccta ttcctccgta tcccatatgg gtttcatact tataggaatt 840 gcttctataa ccgatacggg gctcaatgga gctattttac aaataatctc tcatggattt 900 attggtgctg cacttttttt cttggcagga acgagttatg atagaatacg tcttgttat 960 ctcgacgaaa tgggcggagt agctatcccc atgccaaaaa tatttacgat gttcagtagc 1020 ttttccatgg cttcccttgc attaccgggt atgagtggtt ttgttgcaga agttatagtt 1080 ttttgggaa taattaccag ccaaaaatat cttttaatgc ccaaaattgc catcacttttt 1140 gtaatggcaa ttggaatgat attaactcct atttattcat tatctatgtc acgccagatg 1200 ttctatggat acaagttatt tatactcca aactcttatg ttttgattc tggaccgcgc 1260 gagttattg tttcgatctc catttttcta cctgtaatag gtattggtat gtatcccgat 1320 tttgttcttt cactatcagt tgacaaggtt gaaggtattc tatctaatta tttttataga 1380 tag 1383 <210> 12 <211> 1383 <212> DNA <213> Atractylodes chinensis Koidz. <400> 12 atgttagaac ttcttctaac aacctatgca ttctgttatc atttccaatt ggacgatcca 60 ttaatccaac tagtagagga ctataaatgg atcaattttt ttgatttccg ttggaaatta 120 ggaatagatg gactgtctat aggacccgtt ttattaacag gatttatcac tactttagct 180 actttagcgg cctggcctgt tactcgggat tctcgattat tccattctct gatgttagca 240 atgtacagtg gtcaaatagg atcattttct tctcgggacc ttttacttttt tttcatcatg 300 tgggaattag aattaattcc ggtttatcta cttctatcca tgtggggagg aaagaaacgt 360 ctgtactcag ccacaaaatt tattttgtac acggcgggag gttccatttt tctcttaatg 420 ggagttctgg gtgtcggttt atatggttct aatgaaccaa cattaaattt tgaaacatca 480 gttaatcagt cgtatcctgt gactttggaa ataatattct atattggatt ttttattgct 540 tttgctgtca aatcaccgat tctaccctta catacatggt taccagatac ccacggagag 600 gcgcattaca gtacttgtat gcttctagcc ggaattttat taaaaatggg agcgtatgga 660 ttgattcgga ttaatatgga attattacca cacgctcatt ctatattttc tccttggttg 720 atgatagtag gcacaataca aataatctat gcagcttcaa catctcccgg ccaacgtaat 780 ttaaaaaaaa gaatagccta ttcctccgta tcccatatgg gtttcatact tataggaatt 840 gcttctataa ccgatacggg gctcaatgga gctattttac aaataatctc tcatggattt 900 attggtgctg cacttttttt cttggcagga acgagttatg atagaatacg tcttgttat 960 ctcgacgaaa tgggcggagt agctatcccc atgccaaaaa tatttacgat gttcagtagc 1020 ttttccatgg cttcccttgc attaccgggt atgagtggtt ttgttgcaga agttatagtt 1080 ttttgggaa taattaccag ccaaaaatat cttttaatgc ccaaaattgc catcacttttt 1140 gtaatggcaa ttggaatgat attaactcct atttattcat tatctatgtc acgccagatg 1200 ttctatggat acaagttatt tatactcca aactcttatg ttttgattc tggaccgcgc 1260 gagttattg tttcgatctc catttttcta cctgtaatag gtattggtat gtatcccgat 1320 tttgttcttt cactatcagt tgacaaggtt gaaggtattc tatctaatta tttttataga 1380 tag 1383 <210> 13 <211> 1383 <212> DNA <213> Atractylodes chinensis Koidz. <400> 13 atgttagaac ttcttctaac aacctatgca ttctgttatc atttccaatt ggacgatcca 60 ttaatccaac tagtagagga ctataaatgg atcaattttt ttgatttccg ttggaaatta 120 ggaatagatg gactgtctat aggacccgtt ttattaacag gatttatcac tactttagct 180 actttagcgg cctggcctgt tactcgggat tctcgattat tccattctct gatgttagca 240 atgtacagtg gtcaaatagg atcattttct tctcgggacc ttttacttttt tttcatcatg 300 tgggaattag aattaattcc ggtttatcta cttctatcca tgtggggagg aaagaaacgt 360 ctgtactcag ccacaaaatt tattttgtac acggcgggag gttccatttt tctcttaatg 420 ggagttctgg gtgtcggttt atatggttct aatgaaccaa cattaaattt tgaaacatca 480 gttaatcagt cgtatcctgt ggctttggaa ataatattct atattggatt ttttattgct 540 tttgctgtca aatcaccgat tctaccctta catacatggt taccagatac ccacggagag 600 gcgcattaca gtacttgtat gcttctagcc ggaattttat taaaaatggg agcgtatgga 660 ttgattcgga ttaatatgga attattacca cacgctcatt ctatattttc tccttggttg 720 atgatagtag gcacaataca aataatctat gcagcttcaa catctcccgg ccaacgtaat 780 ttaaaaaaaa gaatagccta ttcctccgta tcccatatgg gtttcatact tataggaatt 840 gcttctataa ccgatacggg gctcaatgga gctattttac aaataatctc tcatggattt 900 attggtgctg cacttttttt cttggcagga acgagttatg atagaatacg tcttgttat 960 ctcgacgaaa tgggcggagt agctatcccc atgccaaaaa tatttacgat gttcagtagc 1020 ttttccatgg cttcccttgc attaccgggt atgagtggtt ttgttgcaga agttatagtt 1080 ttttgggaa taattaccag ccaaaaatat cttttaatgc ccaaaattgc catcacttttt 1140 gtaatggcaa ttggaatgat attaactcct attattcat tatctatgtc acgccagatg 1200 ttctatggat acaagttatt tatactcca aactcttatg ttttgattc tggaccgcgc 1260 gagttattg tttcgatctc catttttcta cctgtaatag gtattggtat gtatcccgat 1320 tttgttcttt cactatcagt tgacaaggtt gaaggtattc tatctaatta tttttataga 1380 tag 1383 <210> 14 <211> 1230 <212> DNA <213> Atractylodes chinensis Koidz. <400> 14 agaggactat aaatggatca atttttga tttacgttgg aattaggaa tattggact 60 gtctatagga cccgttttat tacaggatt tacctact tagctactt tagcggcctg 120 gcctgttact cgggattctc gatttattcca tttctgatg ttagcaatgt acagtggtca 180 ataggatca ttttctctc gggacctttt actttttc atcatgtggg aattagaatt 240 aattccggtt tatctacttc tatccatgtg gggaggaag aaacgtctgt actcagccac 300 aaaatttatt ttgtacacgg cgggaggttc cattttctc ttaatgggag tctgggtgt 360 cggtttatat gggttctaatg aaccaacatt aaattttgaa acatcagtta atcagtcgta 420 tcctgtggct ttggaaataa tattctatat tggattttttgctttg ctgtcaaatc 480 accgattcta cccttacata catggttacc agatacccac ggagaggcgc attackactac 540 ttgtatgctt ctagccggaa ttttaaa aatgggagcg tatggattga ttcggattaa 600 tatggaatta ttaccacacg ctcattctat attttctcct tggttgatga tagtagcac aatacaata atctatgcag cttcaacatc tcccggccaa cgtaatttaa aaaaaagat agcctattcc tccgtatccc atatgggttt catacttata ggaattgctt ctataccga tacggggctc aatggagcta ttttacaaat aatctctcat ggatttattg gtgctgcact ttttttcttg gcaggaacga gttatgatag aatacgtctt gtttatctcg acgaaatggg cggagtagct atccccatgc caaaatatt cggatgttc agtagctttt ccatggcttc ccttgcatta ccggggtatga gtggttttgt tgcagaagtt atagtttttt tgggaat 1080. 1080. 1080. 1080. 1080. 1080. 1080. 1080. 1080. 1080. 1080 aatgatatta actcctattt attcattatc tatgtcacgc cagatgttct atggatacaa gttatttaat actccaaact cttatgtttt tgattctgga ccgcgcgagt tatttgtttc gatctccatt tttctacctg 1230 <210> 15 <211> 1228 <212> DNA <213> Atractylodes chinensis Koidz. <400> 15 agaggactat aaatggatca attttttga ttccgttgg aattaggaa tagatggact 60 gtctatagga cccgttttat tacaggatt tacctact tagctactt tagcggcctg 120 gcctgttact cgggattctc gatttattcca tttctgatg ttagcaatgt acagtggtca 180 ataggatca ttttctctc gggacctttt actttttc atcatgtggg aattagaatt 240 aattccggtt tatctacttc tatccatgtg gggaggaag aaacgtctgt actcagccac 300 aaaatttatt ttgtacacgg cgggaggttc cattttctc ttaatgggag tctgggtgt 360 cggtttatat gggttctaatg aaccaacatt aaattttgaa acatcagtta atcagtcgta 420 tcctgtggct ttggaaataa tattctatat tggattttttgctttg ctgtcaaatc 480 accgattcta cccttacata catggttacc agatacccac ggagaggcgc attackactac 540 ttgtatgctt ctagccggaa ttttaaa aatgggagcg tatggattga ttcggattaa 600 tatggaatta taccacacg ctcattctat attttctcct tggttgatga tagtaggcac 660 atacaaata atctatgcag cttcacatc tcccggccaa cgtaatttaa aaaaagaat 720 agcctattcc tccgtatccc atatgggttt catacttata ggaattgctt ctataaccga 780 tacggggctc aatggaacta ttttacaaat aatctctcat ggatttattg gtgctgcact 840 ttttttcttg gcaggaacga gttatgatag aatacgtctt gtttatctcg acgaaatggg 900 cggagtagct atccccatgc caaaaatatt tacgatgttc agtagctttt ccatggcttc 960 ccttgcatta ccgggtatga gtggttttgt tgcagaagtt atagtttttt tgggaataat 1020 taccagccaa aaatatcttt taatgcccaa aattgccatc acttttgtaa tggcaattgg 1080 aatgatatta actcctattt attcattatc tatgtcacgc cagatgttct atggatacaa 1140 gttatttaat actccaaact cttatgtttt tgattctgga ccgcgcgagt tatttgtttc 1200 gatctccatt tttctacctg tataggt 1228 <210> 16 <211> 1240 <212> DNA <213> Atractylodes chinensis Koidz. <400> 16 aatccaacta gtagaggact ataaatggat caattttttt gatttccgtt ggaaattagg 60 aatagatgga ctgtctatag gacccgtttt attaacagga tttatcacta ctttagctac 120 tttagcggcc tggcctgtta ctcgggattc tcgattattc catttcttga tgttagcaat 180 gtacagtggt caaataggat catttcttt tcgggacctt ttactttttt tcatcatgtg 240 ggaattagaa ttaattccgg tttatctact tctatccatg tgggggagaa agaaacgtct 300 gtactcagcc acaaaattta ttttgtacac ggcgggaggt tccatttttc tcttaatggg 360 agttctgggt gtcggtttat atggttctaa tgaaccaaca ttaaattttg aaacatcagt 420 taatcagtcg tatcctgtgg ctttggaaat aatattctat attggatttt ttattgcttt 480 tgctgtcaaa tcaccgattc tacccttaca tacatggtta ccagataccc acggagaggc 540 gcattacagt acttgtatgc ttctagccgg aattttatta aaaatgggag cgtatggatt 600 gattcggatt aatatggaat tattaccaca cgctcattct atattttctc cttggttgat 660 gatagtaggc acaatacaaa taatctatgc agcttcaaca tctccggcc aacgtaattt 720 aaaaaaaaga atagcctatt cctccgtatc ccatatgggt ttcatactta taggaattgc 780 ttctataacc gatacggggc tcaatggagc tattttacaa ataatctctc atggatttat 840 tggtgctgca ctttttttct tggcaggaac gagttatgat agaatacgtc ttgtttatct cgacgaaatg ggcggagtag ctatccccat gcaaaaaata tttacgatgt tcagtagctt ttccatggct tcccttgcat taccgggtat gagtggtttt gttgcagaag ttatagtttt tttgggata attaccagcc aaaaatatct tttaatgccc aaaattgcca tcacttttgt aatggcaatt ggaatgatat taactcctat ttattcatta tctatgtcac gccagatgtt ctatggatac aagttattta atactccaaa ctcttatgtt tttgattctg gaccgcgcga gttatttgtt tcgatctcca tttttctacc tgtaataggt 1240 <210> 17 <211> 1233 <212> DNA <213> Atractylodes chinensis Koidz. <400> 17 tagged ctataaatgg atcaattttt ttgatttccg ttggaatta ggaatagtg gactgtctat aggacccgtt ttattaacag gatttatcac tactttagct actttagcgg cctggcctgt tactcggat tctcgattat tccatttctt gatgttagca atgtacagtg 180 gtcaaatagg atcattttct tctcgggacc ttttacttttt tttcatcatg tgggaattag 240 attaattcc ggtttatcta cttctatcca tgtggggagg aaagaaacgt ctgtactcag 300 ccacaaaatt tattttgtac acggcggggag gttccatttt tctcttaatg ggagttctgg 360 gtgtcggttt atatggttct aatgaaccaa cattaaattt tgaaacatca gttaatcagt 420 cgtatcctgt ggctttggaa ataatattct atattggatt ttttattgct tttgctgtca 480 aatcaccgat tctaccctta catacatggt taccagatac ccacggagag gcgcattaca 540 gtacttgtat gcttctagcc ggaattttat taaaaatggg agcgtatgga ttgattcgga 600 ttaatatgga attattacca cacgctcatt ctatattttc tccttggttg atgatagtag 660 gcacaataca aataatctat gcagcttcaa catctcccgg ccaacgtaat ttaaaaaaaa 720 gaatagccta ttcctccgta tcccatatg gtttcatact tataggaatt gcttctataa 780 ccgatacggg gctcaatgga gctattttac aaataatctc tcatggattt attggtgctg 840 cacttttttt cttggcagga acgagttatg atagaatacg tcttgttat ctcgacgaaa 900 tgggcggagt agctatcccc atgccaaaaa tatttacgat gttcagtagc ttttccatgg 960 cttcccttgc attaccgggt atgagtggtt ttgttgcaga agttatagtt ttttgggaa 1020 taattaacag ccaaaaatat cttttaatgc ccaaaattgc catcacttttt gtaatggcaa 1080 ttggaatgat attaactcct atttattcat tatctatgtc acgccagatg ttctatggat 1140 acaagttatt tatactcca aactcttatg ttttgattc tggaccgcgc gagttattg 1200 tttcgatctc catttttcta cctgtaatag gta 1233 <210> 18 <211> 1240 <212> DNA <213> Atractylodes chinensis Koidz. <400> 18 ctagtagagg actataaatg gatcaattttt tttgatttcc gttggaaatt aggaatagat 60 ggactgtcta taggacccgt tttattaaca ggatttatca ctactttagc tactttagcg 120 gcctggcctg ttactcggga ttctcgatta ttccattct tgatgttagc aatgtacagt 180 ggtcaaatag gatcattttc ttctcgggac cttttacttt ttttcatcat gtgggaatta 240 gaattaattc cggtttatct acttctatcc atgtggggag gaaagaaacg tctgtactca 300 gccacaaaat ttatttgta cacggcggga ggttccattt ttctcttaat gggagttctg 360 ggtgtcggtt tatatggttc taatgaacca acattaatt ttgaaacatc agttaatcag 420 tcgtatcctg tggctttgga aaatattc ttttattgc tttgctgtc 480 aaatcaccga tttaccctt acatacatgg ttaccagata cccacggaga ggcgcattac 540 agtacttgta tgcttctagc cggaattta ttaaaaatgg gagcgtatgg attgattcgg 600 attatatgg aattattacc acacgctcat tctatatttt ctccttggtt gatgagta 660 ggcacaatac aaataattta tgcagcttca acatctcccg gccaacgtaa tttaaaaaaa 720 agaatagcct attcctccgt atcccatatg ggtttcatac ttataggaat tgcttctata 780 accgatacgg ggctcaatgg agctatttta caataatct ctcatggatt tattggtgct 840 gcacttttt tcttggcagg aacgagttat gatagaatac gtcttttta tctcgacgaa 900 atgggcggag tagctatccc catgccaaaa atatttacga tgttcagtag cttttccatg 960 gcttcccttg cattaccgggg tatgagtggt ttgttgcag aagttagt ttttggga 1020 attack gccaaaaata tctttaatg cccaaaattg ccatcacttt tgtaatggca 1080 attggaatga tattaaccc tatttattca tattctatgt cacgccagat gttctatgga 1140 tacaagttat ttaatactcc aaactcttat gttttgatt ctggaccgcg cgagttattt 1200 gtttcgatct ccattttttct acctgtataa ggtattggta 1240 <210> 19 <211> 1282 <212> DNA <213> Atractylodes chinensis Koidz. <400> 19 ctttcattgg acgatccatt aatccaacta gtagaggact ataatggat caattttttt 60 gatttccgtt ggaaattagg atagatgga ctgtctatag gacccgtttt atttaacagga 120 tttatcacta ctttagctac tttagcggcc tggctgtta ctcggttc tcgattattc 180 cattctctga tgttagcaat gtacagtggt caattttc tcgggacctt 240 eatttttttcatgtg ggattagaa eattccgg eattctactttcatgtg 300 tggggaggaa agaaacgtct gtactcagcc acaaaattta tttgtacac ggcgggaggt 360 tccattttc tcttaatggg agttctgggt gtcggtttat atggttctaa tgaaccaaca 420 ttaaattttg aaacatcagt taatcagtcg tatcctgtga ctttggaaat aatattctat 480 attggatttt ttattgcttt tgctgtcaaa tcaccgattc tacccttaca tacatggtta 540 ccagataccc acggagaggc gcattacagt acttgtatgc ttctagccgg aattttatta 600 aaaatgggag cgtatggatt gattcggatt aatatggaat tattaccaca cgctcattct 660 atattttctc cttggttgat gatagtaggc acaatacaaa taatctatgc agcttcaaca 720 tctcccggcc aacgtaattt aaaaaaaga atagcctatt cctccgtatc ccatatgggt 780 ttcatactta taggaattgc ttctataacc gatacggggc tcaatggagc tattttacaa 840 ataatctctc atggatttat tggtgctgca cttttttct tggcaggaac gagttatgat 900 agaatacgtc ttgtttatct cgacgaaatg ggcggagtag ctatccccat gccaaaaata 960 tttacgatgt tcagtagctt ttccatggct tcccttgcat taccgggtat gagtgattttt 1020 gttgcagaag ttatagtttt tttgggaata attaccagcc aaaaatatct tttaatgccc 1080 aaaattgcca tcacttttgt aatggcaatt ggaatgatat taactcctat ttattcatta 1140 tctatgtcac gccagatgtt ctatggatac aagttattta atactccaaa ctcttatgtt 1200 tttgattctg gaccgcgtga gttatttgtt tcgatctcca tttttctacc tgtaataggt 1260 attggtatgt atcccgattt tt 1282

Claims

1. The application of a polymorphic fragment of the chloroplast genome gene in Atractylodes lancea as a DNA barcode for the identification of Atractylodes lancea, characterized in that, The gene polymorphic fragments are ccsA and / or ndhD gene polymorphic fragments. The ccsA gene polymorphic fragments are obtained by amplification using the following primers: ccsA-F: 5'-ATGATATTTTCAACTTTAGAGCA-3'; ccsA-R: 5'-AAACGAACCATAACTATGTAGCC-3'; the ndhD gene polymorphic fragments are obtained by amplification using the following primers: ndhD-F: 5'-GAACTTCTTCTAACAACCTATGC-3'; ndhD-R: 5'-AATACCTTCAACCTTGTCAACTG-3'. The identification is for the identification of Atractylodes lancea germplasm, including the identification of sample authenticity, origin, and batch. The application includes the following steps: amplifying and sequencing the ccsA and / or ndhD gene polymorphic fragments in the chloroplasts of the sample to be tested; analyzing the sequencing results; and identifying the germplasm of the sample to be tested based on the haplotype sequence and combination pattern combined with the sequencing peak diagram.

2. A method for batch anti-counterfeiting of Atractylodes lancea seeds using polymorphic fragments of the ccsA and ndhD genes, the method comprising: (1) Selection and cultivation of haplotypes of Atractylodes lancea Seeds of Atractylodes lancea with different ccsA and / or ndhD haplotypes were collected and combined, and then planted in batches. (2) Identification of batches of Atractylodes lancea samples Samples of cultivated Atractylodes lancea were collected, DNA was extracted, and the chloroplast gene polymorphic fragments ccsA and / or ndhD fragments of the samples were amplified and sequenced. The sequencing results were analyzed, and the batch of cultivated Atractylodes lancea was determined based on the haplotype sequence and combination pattern combined with the sequencing peak diagram. The primers used for amplifying ccsA are: ccsA-F: 5'-ATGATATTTTCAACTTTAGAGCA-3'; ccsA-R: 5'-AAACGAACCATAACTATGTAGCC-3'; and the primers used for amplifying ndhD are: ndhD-F: 5'-GAACTTCTTCTAACAACCTATGC-3'; and ndhD-R: 5'-AATACCTTCAACCTTGTCAACTG-3'.

3. The application of a kit for identifying Atractylodes lancea germplasm in the identification of Atractylodes lancea germplasm, characterized in that, The kit includes primers and reagents for amplifying the chloroplast gene polymorphic fragments ccsA and / or ndhD of Atractylodes lancea. The primers used for amplifying ccsA are: ccsA-F: 5'-ATGATATTTTCAACTTTAGAGCA-3'; ccsA-R: 5'-AAACGAACCATAACTATGTAGCC-3'; and the primers used for amplifying ndhD are: ndhD-F: 5'-GAACTTCTTCTAACAACCTATGC-3'; ndhD-R: 5'-AATACCTTCAACCTTGTCAACTG-3'.

4. The application of a reagent kit for batch anti-counterfeiting of Atractylodes lancea seeds in batch anti-counterfeiting of Atractylodes lancea seeds, characterized in that, The kit includes primers and reagents for amplifying the chloroplast gene polymorphic fragments ccsA and / or ndhD of Atractylodes lancea. The primers used for amplifying ccsA are: ccsA-F: 5'-ATGATATTTTCAACTTTAGAGCA-3'; ccsA-R: 5'-AAACGAACCATAACTATGTAGCC-3'; and the primers used for amplifying ndhD are: ndhD-F: 5'-GAACTTCTTCTAACAACCTATGC-3'; ndhD-R: 5'-AATACCTTCAACCTTGTCAACTG-3'.

Images