A nucleic acid detection device

Abstract

The application provides a nucleic acid detection device, which comprises, from top to bottom, a sample processing cavity, a sample reaction cavity and a detection cavity, and integrates the functions of sample adding, nucleic acid purification, constant temperature amplification and immunochromatography result reading into one device, so that a simple and compact nucleic acid detection device is prepared, nucleic acid detection can be completed through twice rotation, and free fall of sample adding or reagent adding to the target area can be ensured without additional drainage facilities; the nucleic acid detection device has lower cost, is more convenient to operate, has high detection sensitivity, requires short time, and can be used for nucleic acid detection of various samples such as human and animals.

Description

[0001] This application claims priority to the earlier Chinese application, application number 2022100300570, filed on January 11, 2022; all its contents are part of this invention. Technical Field

[0002] This invention belongs to the field of biological detection technology and relates to a nucleic acid detection device. Background Technology

[0003] With the development of science and technology, detection technologies and equipment in fields such as pathogens, environmental microorganisms, biochemical indicators, tumor and organ markers, and drugs have made significant progress. For example, PCR instruments and isothermal amplification instruments, which apply the principle of nucleic acid amplification, are gradually replacing traditional smear or microscopic examination methods in the field of pathogen and environmental microorganism detection; automated chemiluminescence platforms provide sensitive, rapid, and high-throughput solutions for the detection of biochemical indicators, tumor markers, and other items.

[0004] The expanding demand for testing and the diversification of testing scenarios have made point-of-care (POCT) testing one of the main directions of development in the testing field in recent years. POCT testing refers to a form of testing where analysis is performed immediately at the sampling site, providing rapid test results. For example, a POCT nucleic acid testing instrument integrates nucleic acid extraction, amplification, and fluorescence detection functions into a miniaturized instrument, enabling rapid and accurate nucleic acid testing under non-laboratory conditions.

[0005] Compared to traditional large-scale equipment or standard laboratories, POCT testing devices provide on-site testing methods for grassroots units, remote areas, or other scenarios with insufficient medical resources. At the same time, they also offer convenient and rapid solutions for testing items that are sensitive to testing time. Many POCT products, such as mini blood glucose meters and urine glucose test strips, are beginning to be used in home settings, allowing users to complete tests themselves.

[0006] In many cases, people prefer to complete the testing themselves; however, in some field environments or where there is a lack of professional personnel and equipment, there is an urgent need for a low-cost, fast, simple, and accurate testing device that can be used without professional training. This device should have broad adaptability to various scenarios and be safe to use.

[0007] However, current small-scale testing devices still have many problems: 1. The cost of miniaturized testing instruments remains too high for ordinary people; 2. Since nucleic acid testing often requires nucleic acid amplification or fluorescence signal collection and analysis, it requires relatively complex equipment and professional skills. Currently, domestic home self-testing devices cannot perform nucleic acid testing; 3. Although current test strip self-testing products meet certain requirements, they still have problems such as inaccurate sample addition, difficulty in quantification, and difficulty in multiplexing; 4. The detection sensitivity of current self-testing devices is low; 5. The testing time required by current self-testing devices is relatively long; 6. Current home testing devices lack flexibility, resulting in redundant development and waste of resources.

[0008] CN113512490A provides a self-driven microfluidic detection device that uses a microfluidic flow guiding component to achieve sample addition, amplification, and detection. However, the microfluidic flow guiding process is complex and easily affected by ambient temperature and humidity, leading to detection errors. WO2022 / 043697A1 provides a device for analyzing biological samples, but it requires selective opening of different regions using levers, pistons, or other control methods to transfer the sample from one region to another. This process is cumbersome, prone to errors, and structurally complex.

[0009] Therefore, the market needs a disposable testing device that is low in cost, simple in structure, fast and easy to use, can achieve precise control of the sample addition and testing process, has high detection sensitivity, short detection time, is safe and reliable, and can be used without professional training. Summary of the Invention

[0010] To overcome the shortcomings of existing technologies, this invention provides a nucleic acid detection device that integrates sample addition, nucleic acid purification, isothermal amplification, and immunochromatographic result reading into a single device. First, nucleic acid is adsorbed through a nucleic acid adsorption membrane. Excess sample enters a filter paper storage tank. Nucleic acid amplification and detection are completed through two rotations: the first rotation transfers the nucleic acid on the adsorption membrane to the amplification reaction chamber, and the second rotation transfers the amplification reaction chamber along with the amplification product to the test strip for detection. The nucleic acid detection device prepared by this invention is simple and compact. The two-rotation method ensures that each sample or reagent addition reaches the target area via free fall, eliminating the need for additional drainage facilities. This results in lower cost, simpler operation, higher detection sensitivity, shorter detection time, and applicability to nucleic acid detection of various samples, including human and animal samples.

[0011] On one hand, the present invention provides a detection device, characterized in that it comprises:

[0012] A chamber for processing a sample; a chamber for reacting a sample, in which the reaction products of the sample are obtained; and a detection chamber for detecting the reaction products;

[0013] The sample processing chamber has a first position, a second position, and a third position; the sample reaction chamber has a first position and a second position.

[0014] When the sample processing chamber and the sample reaction chamber are in the first position, the sample processing chamber, the sample reaction chamber, and the detection chamber are not fluidly connected to each other.

[0015] In some methods, when the sample processing chamber is in the second position, the sample processing chamber is in fluid communication with the sample reaction chamber, while the sample reaction chamber is not in fluid communication with the detection chamber.

[0016] In some configurations, when the sample processing chamber is in the third position, the sample reaction chamber and the detection chamber are in fluid communication.

[0017] In some embodiments, when the sample processing chamber moves from the first position to the second position, the sample reaction chamber is in the first position; when the sample processing chamber moves from the second position to the third position, the sample reaction chamber is in the second position, or the sample reaction chamber moves from the first position to the second position.

[0018] In some methods, when the sample reaction chamber is in the second position, the sample reaction chamber and the detection chamber are in fluid communication.

[0019] In some methods, the sample processing chamber moves from the second position to the third position while the sample reaction chamber moves from the first position to the second position; or, the sample processing chamber and the sample reaction chamber move simultaneously, thereby causing the sample processing chamber to move from the second position to the third position and the sample reaction chamber to move from the first position to the second position.

[0020] In some configurations, the sample processing chamber, the sample reaction chamber, and the detection chamber are arranged sequentially from top to bottom.

[0021] In some methods, the sample processing chamber and sample reaction chamber are rotated to change their positions.

[0022] In some embodiments, the rotation comprises two rotations; the first rotation moves the sample processing chamber from a first position to a second position while the sample reaction chamber and the detection chamber remain stationary; after the first rotation, the sample processing chamber and the sample reaction chamber are in fluid communication, while the sample reaction chamber is not in fluid communication with the detection chamber.

[0023] In some methods, the first rotation is performed by the sample processing chamber rotating independently, while the sample reaction chamber and the detection chamber remain stationary.

[0024] In some configurations, the second rotation moves the sample processing chamber from the second position to the third position, while the sample reaction chamber moves from the first position to the second position. After the second rotation, the sample processing chamber, the sample reaction chamber, and the detection chamber are in fluid communication.

[0025] In some configurations, the second rotation involves the sample processing chamber and the sample reaction chamber rotating together, while the detection chamber remains stationary.

[0026] In some embodiments, the sample processing chamber is used to extract nucleic acid material from a sample.

[0027] In some embodiments, the sample reaction chamber is used for the amplification of nucleic acid material to generate amplification products.

[0028] In some embodiments, the target analyte is nucleic acid; the sample processing chamber is used to adsorb and purify the nucleic acid in the sample; and the sample reaction chamber is used to provide nucleic acid amplification reagents for nucleic acid amplification reaction.

[0029] In some embodiments, the detection chamber is used to detect the quantity of amplification products or the presence of amplification products.

[0030] In some embodiments, the sample reaction chamber includes reagents for nucleic acid amplification, wherein the reagents are present in a dry state.

[0031] In some embodiments, the detection chamber includes a transverse flow test strip used to detect the quantity of amplification products or the presence of amplification products.

[0032] In some embodiments, the present invention provides a nucleic acid detection device, wherein the sample processing chamber is used to adsorb nucleic acids in a sample; the sample reaction chamber is used to complete a nucleic acid amplification reaction; and the detection chamber is used to detect nucleic acids in the amplification products.

[0033] In some methods, after the first rotation, the sample processing chamber is connected to the sample reaction chamber, and the extracted nucleic acid is transferred to the sample reaction chamber for nucleic acid amplification; after the second rotation, the sample reaction chamber is connected to the detection chamber, and the amplification product is transferred to the transverse flow test strip in the detection chamber for detection.

[0034] In some embodiments, the sample processing chamber is provided with an inlet, and an inlet channel is connected below the inlet. A nucleic acid adsorption membrane is fixed at the bottom of the inlet channel, and the nucleic acid adsorption membrane is used to adsorb nucleic acids in the sample.

[0035] In some embodiments, the sample reaction chamber is provided with a reaction chamber and a filter paper storage tank; the filter paper storage tank is filled with filter paper for adsorbing excess sample; the reaction chamber is filled with a nucleic acid amplification reaction membrane or has a nucleic acid amplification reaction drying reagent fixed thereon; the detection chamber is provided with a sample application hole, and the reaction product enters the transverse flow test strip through the sample application hole to start the detection.

[0036] Furthermore, when the sample processing chamber, sample reaction chamber, and detection chamber are not connected, the sample inlet of the sample processing chamber is vertically connected to the filter paper storage tank; when the sample processing chamber and sample reaction chamber are connected, the sample inlet of the sample processing chamber is vertically connected to the reaction chamber of the sample reaction chamber; when the sample processing chamber, sample reaction chamber, and detection chamber are all connected, the sample inlet of the sample processing chamber, the reaction chamber of the sample reaction chamber, and the sample dispensing port of the detection chamber are all vertically connected.

[0037] This invention completes nucleic acid amplification and detection through a two-stage rotation. The sample processing chamber first adsorbs nucleic acid through a nucleic acid adsorption membrane. The first rotation transfers the nucleic acid adsorption membrane with adsorbed nucleic acid to the top of the amplification reaction chamber, and the nucleic acid on the adsorption membrane is washed into the reaction chamber by free fall of the elution buffer through the shortest distance for isothermal amplification. The second rotation transfers the reaction chamber along with the amplification product to a transversely flowing test strip. The amplification product is then dripped into the test strip for detection by free fall. This method is more convenient, flexible, and error-free to use.

[0038] Therefore, this invention, through a two-rotation design, ensures that each sample or reagent addition reaches the target area in a free-fall manner. Moreover, the compact and small structure eliminates the need for additional drainage facilities, thereby improving efficiency and detection sensitivity.

[0039] In some designs, both the sample processing chamber and the sample reaction chamber are cylindrical in shape, which makes them easy to hold and rotate.

[0040] In some embodiments, the sample processing chamber includes an upper cover and a lower cover. The upper cover has a sample inlet, and a sample inlet channel is connected below the sample inlet. A nucleic acid adsorption membrane is fixed at the bottom of the sample inlet channel. The nucleic acid adsorption membrane is used to adsorb nucleic acids in the sample. The lower cover includes an outer wall and a bottom surface, and the bottom surface has a through-hole. The upper cover and the lower cover are fixed together, and the through-hole is always aligned with the sample inlet channel.

[0041] In some embodiments, the inlet diameter is 5–10 mm, the inlet channel is cylindrical with a bottom diameter consistent with the inlet and a height of 15–25 mm, extending directly downwards from the inlet, and the sample reaches the nucleic acid adsorption membrane from the inlet through the inlet channel.

[0042] The sample enters through the inlet and is accelerated through a certain height of the injection channel, where it impacts the nucleic acid adsorption membrane with greater force. This promotes more complete adsorption of nucleic acids from the sample by the nucleic acid adsorption membrane, thereby improving the sensitivity of nucleic acid detection.

[0043] In some embodiments, the nucleic acid adsorption membrane is a circular thin film, which may be made of silica or polysiloxane (silica gel); its diameter is the same as or slightly larger than the diameter of the inlet. The nucleic acid adsorption membrane is fixed at the bottom of the inlet channel and must completely cover the bottom outlet of the inlet channel. After the sample enters from the inlet, it must pass entirely through the nucleic acid adsorption membrane, and almost all the nucleic acids in the sample are adsorbed by the nucleic acid adsorption membrane.

[0044] In some designs, the upper cover has a protrusion on the outer periphery of its side wall, and the lower cover has a groove in its side wall that matches the protrusion. The upper and lower covers are fixed together by the protrusion and the groove, respectively. In other words, the positions of the upper and lower covers are fixed, and the through-hole on the bottom surface of the lower cover is always aligned with the sample inlet channel. To rotate, they can only be rotated together, and the upper or lower cover cannot be rotated separately.

[0045] In some designs, the diameter of the upper cover sidewall is slightly smaller than that of the lower cover sidewall, allowing the upper cover to fit inside the lower cover sidewall. By providing a protruding ring inside the lower cover sidewall, the upper surface of the upper cover is flush with the highest point of the lower cover sidewall after the upper and lower covers are combined.

[0046] In the initial position, before rotation, the sample inlet channel on the upper cover of the sample chamber and the through-hole on the lower cover are located above the filter paper storage tank, forming a vertical straight line. Therefore, during initial sample addition, the nucleic acids in the sample are adsorbed by the nucleic acid adsorption membrane, while the remaining liquid permeates through the membrane into the filter paper storage tank and is adsorbed by the filter paper inside.

[0047] The reaction chamber is used for nucleic acid amplification reaction. In order to make the detection process more convenient and flexible, the present invention requires that fixed and dried nucleic acid amplification reaction reagents be placed in the reaction chamber in advance. This avoids the need to add multiple reagents from the sample dispensing port multiple times during the detection process, and prevents the reagents from being adsorbed by the nucleic acid adsorption membrane of the sample dispensing port, affecting the isothermal amplification reaction and causing detection errors.

[0048] Furthermore, the outer wall of the sample processing chamber is provided with a first rotating buckle, and the side wall of the sample reaction chamber is provided with a hollowed-out first rotating slot. When rotated for the first time, the first rotating buckle moves from one end of the first rotating slot to the other end. The number of the first rotating buckle and the first rotating slot is more than one.

[0049] In some methods, the lower diameter of the side wall of the sample processing chamber is reduced, so that the side wall of the lower cover can fit into the side wall of the sample reaction chamber. This results in the sample processing chamber and the sample reaction chamber being combined into a regular cylindrical shape, which is more aesthetically pleasing and easier to rotate.

[0050] In some embodiments, the lower periphery of the side wall of the sample processing chamber cover is provided with one or more protruding first rotating buckles, such as two first rotating buckles, symmetrically distributed on the lower periphery of the outer wall; the upper part of the outer wall of the sample reaction chamber is provided with one or more first rotating slots, such as two first rotating slots, symmetrically distributed on the upper part of the outer wall; the first rotating slot is a long strip-shaped transverse hollowed-out groove provided on the outer wall, and when the lower end of the side wall of the cover is fitted into the side wall of the sample reaction chamber, the protruding first rotating buckle is exactly located in the hollowed-out first rotating slot.

[0051] In some configurations, raised limiting blocks are provided at both the left and right ends of the first rotating slot. Initially, the first rotating latch is located at the leftmost end of the first rotating slot and is fixed by the limiting blocks. After nucleic acid extraction is completed (sample loading, and after the nucleic acid in the sample is adsorbed by the nucleic acid adsorption membrane), the first rotation begins. The first rotating latch must overcome the obstruction of the left-end limiting block and slide to the right along the first rotating slot until it overcomes the right-end limiting block and enters the rightmost end, where it is fixed by the limiting block and cannot continue rotating to the right. At this point, the sample injection channel and the nucleic acid adsorption membrane are positioned above the amplification reaction chamber, ready for nucleic acid rinsing and isothermal amplification reaction.

[0052] The first rotation involves holding the nucleic acid detection device in place with one hand and rotating it by gripping the top of the device with the other hand. This rotation is of the sample processing chamber relative to the sample reaction chamber.

[0053] The nucleic acid adsorption membrane has a first position and a second position. The first position is that the nucleic acid adsorption membrane is located above the filter paper storage tank, and the second position is that the nucleic acid adsorption membrane is located above the reaction chamber. When the first rotating buckle is located at one end of the first rotating slot, the nucleic acid adsorption membrane is located at the first position. When the first rotating buckle moves to the other end of the first rotating slot, the nucleic acid adsorption membrane is located at the second position.

[0054] When the nucleic acid adsorption membrane is in the first position, the nucleic acid detection device is in the initial position and sample loading can begin; after one rotation, the nucleic acid adsorption membrane is in the second position, at which point the sample inlet, the through-hole, and the reaction chamber are arranged vertically in a straight line, and the elution buffer can be added and the isothermal nucleic acid amplification reaction can begin.

[0055] It is understandable that the first and second positions of the nucleic acid adsorption membrane are relative to the sample reaction chamber. When the second rotation is performed, the nucleic acid adsorption membrane and the sample reaction chamber move together. Therefore, the position of the nucleic acid adsorption membrane relative to the sample reaction chamber does not change. However, relative to the detection chamber, the nucleic acid adsorption membrane also has a third position because after the second rotation, the nucleic acid adsorption membrane and the reaction chamber are transferred together to the top of the sample application well of the transverse flow test strip.

[0056] In some embodiments, the detection chamber includes a test strip upper cover and a test strip lower cover, with a transversely flowing test strip fixed in the upper and lower covers for detecting nucleic acids in the amplification products.

[0057] The test strip cover has a sample application hole and a test result observation window. The sample application hole is aligned with the sample application position on the test strip, and the test result observation window is aligned with the test result reading window on the test strip for reading the test result.

[0058] Furthermore, the detection chamber sidewall is provided with a hollowed-out second rotating slot; the outer wall of the sample reaction chamber is provided with a second rotating buckle. When rotated for the second time, the second rotating buckle moves from one end of the second rotating slot to the other end. The number of the second rotating buckle and the second rotating slot is more than one.

[0059] In some embodiments, the test strip has a cylindrical groove on its top cover, and a second rotating slot is provided on the groove wall; a second rotating buckle is provided on the lower part of the outer wall of the sample reaction chamber, and when the sample reaction chamber rotates relative to the detection chamber, the second rotating buckle moves from one end of the second rotating slot to the other end.

[0060] In some methods, the lower diameter of the outer wall of the sample reaction chamber is reduced so that the lower part of the outer wall of the sample reaction chamber can fit into the cylindrical groove of the test strip cover. Thus, when the sample reaction chamber and the detection chamber are combined, the sample processing chamber, the sample reaction chamber, and the cylindrical groove together form a regular cylinder.

[0061] In some embodiments, the lower part of the outer wall of the sample reaction chamber is provided with one or more protruding second rotating buckles, such as two second rotating buckles, symmetrically distributed at the lower end of the outer wall; the upper part of the cylindrical groove wall is provided with one or more second rotating slots, such as two second rotating slots, symmetrically distributed on the groove wall; the second rotating slot is a long strip-shaped horizontal hollowed-out groove set on the groove wall, and when the lower part of the outer wall of the sample reaction chamber is fitted into the cylindrical groove, the protruding second rotating buckle is exactly located in the hollowed-out second rotating slot.

[0062] In some configurations, raised limiting blocks are provided at both the left and right ends of the second rotating slot. During the first rotation, the positions of the second rotating buckle and the second rotating slot remain unchanged. The second rotating buckle is located at the leftmost end of the second rotating slot and is fixed by the limiting block at the left end. After the nucleic acid amplification reaction is completed, the second rotation begins. The second rotating buckle needs to overcome the obstruction of the left limiting block and slide to the right along the second rotating slot until the second rotating buckle overcomes the right limiting block and enters the rightmost end, where it is fixed by the limiting block. At this point, the nucleic acid adsorption membrane and the reaction chamber are transferred together above the sample application hole of the test reagent strip.

[0063] The second rotation involves holding the nucleic acid detection device in place with one hand and rotating it by gripping the middle or upper part of the device with the other hand. This rotation is the rotation of the sample reaction chamber relative to the detection chamber.

[0064] In some methods, when the sample reaction chamber rotates relative to the detection chamber, the sample processing chamber rotates along with the sample reaction chamber, and the nucleic acid adsorption membrane remains above the reaction chamber.

[0065] Furthermore, there are two of each of the first rotating buckle, the first rotating slot, the second rotating buckle, and the second rotating slot, and they are symmetrically distributed.

[0066] Furthermore, the reaction chamber is a cylindrical cavity that runs vertically through the interior; a gasket is provided around the lower end of the cylindrical cavity so that when the reaction chamber rotates and slides on the bottom surface of the cylindrical groove, the liquid inside the reaction chamber will not leak out of the reaction chamber under the protection of the gasket; a sample application hole is provided on the bottom surface of the cylindrical groove so that when the reaction chamber rotates to above the sample application hole, the amplification product is dripped into the test strip from the sample application hole in a free-fall manner for nucleic acid detection.

[0067] The reaction chamber is a cylindrical shape that runs vertically through the chamber, without a top or bottom surface. The absence of a top surface facilitates the direct rinsing of samples from the nucleic acid adsorption membrane above into the reaction chamber; the absence of a bottom surface allows for the easy transfer of the amplification reaction products from the reaction chamber to the sample application port on the bottom plate inside the nucleic acid detection device. At this point, the liquid in the reaction chamber can drip smoothly onto the nucleic acid detection reagent strip since there is no bottom plate support.

[0068] The reaction chamber does not have a bottom surface, but it is placed on the bottom cover of the test strip. A gasket is provided around the bottom of the reaction chamber to prevent the liquid inside the reaction chamber from leaking out from the gaps between the side wall of the reaction chamber and the surface of the bottom cover of the test strip. When the amplification reaction is completed and the second rotation is performed, the reaction chamber will slide on the surface of the bottom cover of the test strip. With the protection of the gasket, even if it slides, the reaction liquid will not leak out of the reaction chamber.

[0069] In some configurations, a gasket groove is provided around the lower periphery of the reaction chamber to fix the position of the gasket.

[0070] Furthermore, a drainage channel is provided on the inner wall of the reaction chamber; the drainage channel is composed of multiple trapezoidal columns arranged at equal intervals on the inner wall; a drainage channel is formed between two adjacent trapezoidal columns.

[0071] Since the sample used for nucleic acid amplification is extremely small, ensuring that all the sample is diverted into the reaction chamber is a crucial step in guaranteeing the sensitivity of nucleic acid detection. By installing drainage channels all around the inner wall of the reaction chamber, the sample to be tested can be diverted into the reaction chamber to the maximum extent, avoiding any omissions.

[0072] In some configurations, the trapezoidal column extends from the top to the bottom of the reaction chamber.

[0073] The trapezoidal column extends from the top to the bottom of the reaction chamber, allowing the sample to flow from the top to the bottom. This is mainly because the immobilized reaction membrane or drying reagent for nucleic acid amplification is placed at the bottom of the reaction chamber. Only by flowing the sample from the top to the bottom of the reaction chamber can the sample be fully contacted with the immobilized reaction membrane or drying reagent, thereby improving the amplification efficiency.

[0074] In some embodiments, the upper end of the trapezoidal column is provided with an upwardly narrowing platform; the width of the drainage channel is 0.1 to 0.5 mm.

[0075] The trapezoidal column's upper narrowing platform can contact the nucleic acid adsorption membrane above, thereby helping to absorb the sample from above into the drainage channel for full drainage.

[0076] In some designs, the height of the upward-narrowing platform is 0.2 mm.

[0077] The drainage channels formed between each trapezoidal column have a consistent width. The narrower the drainage channel, the better the drainage effect. However, if the drainage channel is too narrow, it will increase the difficulty of the manufacturing process. Therefore, it is necessary to select an appropriate drainage channel width.

[0078] In some embodiments, the number of trapezoidal columns is 13, and the number of drainage channels is 13, evenly arranged along the inner wall of the reaction chamber.

[0079] In some embodiments, the width of the drainage channel is 0.5 mm.

[0080] In some embodiments, the trapezoidal column has a base width of 0.9 mm, protrudes outward from the inner wall of the reaction chamber by a distance of 1.25 mm, and has a height of 3.7 mm.

[0081] The width and number of drainage channels (the number of drainage channels determines the number and arrangement of trapezoidal columns, which in turn determines the base width of the trapezoidal columns) determine whether the drainage effect can be maximized. The reaction chamber provided by this invention has a cylindrical cross-sectional diameter of 6mm. Extensive research has shown that when the width of the drainage channel is 0.5mm, the base width of the trapezoidal columns is 0.9mm, and the distance protruding outward from the inner wall of the reaction chamber is 1.25mm, a better drainage effect can be achieved.

[0082] Furthermore, a heating hole is provided at the bottom of the detection chamber, which is used to provide a heat source for the nucleic acid amplification reaction in the sample reaction chamber.

[0083] In some embodiments, the heating hole is located on the lower cover of the test strip, directly below the reaction chamber, and is used to provide a heat source for the nucleic acid amplification reaction.

[0084] In some methods, the heat source for the isothermal amplification reaction of nucleic acid can be a heating hole that is matched with an isothermal heating device. The isothermal heating device provides a heat source to the reaction chamber through the heating hole, thereby carrying out the isothermal amplification reaction.

[0085] In some methods, the heat source for the isothermal amplification reaction of nucleic acid can be directly placed inside the nucleic acid detection device, thus eliminating the need for additional isothermal heating equipment.

[0086] It is understood that the reaction chamber has a first position and a second position. The first position is when the reaction chamber is located above the heating hole, and the second position is when the reaction chamber is located above the sample feeding hole. When the second rotating buckle is located at one end of the second rotating slot, the reaction chamber is located at the first position. When the second rotating buckle moves to the other end of the second rotating slot, the reaction chamber is located at the second position.

[0087] From the moment the nucleic acid detection device is in its initial position until after the first rotation, the reaction chamber remains in the first position without changing, because the first rotation only rotates the sample chamber, and the sample reaction chamber does not move.

[0088] During the second rotation, the nucleic acid adsorption membrane and the sample reaction chamber rotate together, moving the reaction chamber from above the heating hole to above the sample loading hole, thus enabling sample loading and detection.

[0089] Furthermore, the nucleic acid amplification reaction membrane includes a first reaction membrane and a second reaction membrane; the first reaction membrane is laid flat at the lower end of the reaction chamber, and the second reaction membrane is placed horizontally with the first reaction membrane, or the second reaction membrane is placed vertically above the first reaction membrane, or the second reaction membrane is placed vertically with the first reaction membrane.

[0090] In some methods, the first reaction membrane is an immobilized reaction membrane of the recombinase reagent required for nucleic acid amplification reaction; the second reaction membrane is an immobilized reaction membrane of the PEG buffer reagent required for nucleic acid amplification reaction. Studies have shown that the recombinase reagent and the PEG buffer reagent must be placed separately before the amplification reaction, otherwise the recombinase is easily encapsulated by PEG during the amplification reaction, thereby affecting the amplification reaction efficiency. Therefore, it is necessary to set up two immobilized reagent reaction membranes.

[0091] Furthermore, the first reaction membrane is laid flat at the lower end of the reaction chamber, and the second reaction membrane is located at the center of the cylinder of the reaction chamber and is placed vertically above the first reaction membrane.

[0092] Experiments have shown that the placement of the two reaction membranes also affects the sample drainage effect. When the second reaction membrane is placed vertically above the first reaction membrane and in the middle position, it can help improve the drainage effect, thereby improving the amplification reaction efficiency and the sensitivity of nucleic acid detection.

[0093] Furthermore, two types of nucleic acid amplification reaction drying reagents are fixed in the reaction chamber, namely a first drying reagent and a second drying reagent; the first drying reagent and the second drying reagent are separated by a partition strip provided on the bottom surface of the reaction chamber.

[0094] The first drying reagent is the recombinase reagent required for nucleic acid amplification reaction; the second drying reagent is the PEG buffer reagent required for nucleic acid amplification reaction; they are first placed on both sides of the septum and dried or lyophilized to form dried reagents; during detection, the two reagents are reconstituted by adding an eluent and then mixed to start the nucleic acid amplification reaction. Therefore, the septum should not be too high, otherwise it will be difficult to mix after reconstitution.

[0095] On the other hand, the present invention provides a nucleic acid detection system, the system comprising a nucleic acid detection device and reagents, the reagents comprising a lysis buffer, an elution buffer and a nucleic acid amplification reaction reagent; the nucleic acid amplification reaction reagent is a dried and immobilized reagent, comprising a first immobilization reagent and a second immobilization reagent, the first immobilization reagent containing an enzyme and the second immobilization reagent containing PEG.

[0096] The nucleic acid amplification reaction reagent must contain at least recombinase, primer-probe combination, DNTP, ATP, dithiothreitol, PEG and Mg. 2+ etc., where PEG is used to provide the reaction environment, Mg 2+ It serves as an initiator for isothermal amplification reactions.

[0097] To make the detection process more convenient and flexible, this invention places fixed and dried nucleic acid amplification reaction reagents in advance inside the nucleic acid detection device, thereby avoiding the need to add multiple reagents from the sample dispensing port multiple times during the detection process. This also prevents the reagents from being adsorbed by the nucleic acid adsorption membrane at the sample dispensing port, affecting the isothermal amplification reaction and causing detection errors.

[0098] Because nucleic acid amplification reaction reagents contain complex components, after extraction, fixation, and drying, it is necessary to consider whether the immobilized reagent can be stored in the reaction chamber for a long time and whether it will affect the nucleic acid amplification reaction after reconstitution. To achieve good amplification results, PEG needs to be added to the nucleic acid amplification reaction reagents. The molecular weight of PEG is preferably 20,000-40,000. Extensive research has proven that PEG and other reagents, such as recombinant enzymes, in nucleic acid amplification reaction reagents must be dried and fixed separately. Otherwise, it will seriously affect the isothermal amplification reaction of nucleic acids, thereby affecting the detection sensitivity. The reason may be that PEG shrinks and encapsulates the enzyme during the drying process, and it is difficult to restore the enzyme activity after reconstitution, thus preventing the isothermal amplification reaction of nucleic acids from proceeding normally.

[0099] Furthermore, the first immobilization reagent also contains primers, probes, single-stranded binding proteins, protein cofactors, and DNTP.

[0100] In some methods, the second immobilization reagent may also contain magnesium acetate.

[0101] Primers and probes can be dried and solidified together with enzymes, but not with PEG. This may be because PEG can also affect the concentration of primers and probes.

[0102] Furthermore, the nucleic acid detection device includes a sample processing chamber, a sample reaction chamber, and a detection chamber arranged sequentially from top to bottom; the sample processing chamber is used to adsorb nucleic acids in the sample; the sample reaction chamber is used to complete the nucleic acid amplification reaction; and the detection chamber is used to detect nucleic acids in the amplification products.

[0103] Furthermore, the sample reaction chamber includes a reaction chamber for performing nucleic acid amplification reactions; nucleic acid amplification reaction reagents are pre-placed inside the reaction chamber of the sample reaction chamber.

[0104] Furthermore, the nucleic acid amplification reaction reagent is an immobilized reaction membrane or a drying reagent.

[0105] The immobilized reaction membrane of the present invention is made of materials such as silica gel or glass microfiber filter paper membrane. The membrane thickness is about 1 mm and the shape is circular or other arbitrary shapes. Preferably, it is a circular membrane with a diameter of 6 mm. The nucleic acid amplification reaction reagent can be fixed on the membrane by drying, lyophilization or other methods. The temperature during drying should not exceed 50°C.

[0106] Furthermore, when the nucleic acid amplification reaction reagent is an immobilized reaction membrane, the immobilized reaction membrane includes a first reaction membrane and a second reaction membrane, the first reaction membrane containing a first immobilized reagent and the second reaction membrane containing a second immobilized reagent; when the nucleic acid amplification reaction reagent is a drying reagent, the drying reagent includes a first drying reagent and a second drying reagent, the first drying reagent containing a first immobilized reagent and the second drying reagent containing a second immobilized reagent; when the nucleic acid amplification reaction reagent is a drying reagent, a partition strip needs to be provided at the bottom of the reaction chamber, and the first drying reagent and the second drying reagent are separated by the partition strip.

[0107] In some methods, the drying agent can be prepared by drying or freeze-drying, wherein the drying temperature should not exceed 50°C.

[0108] In some methods, the septum at the bottom of the reaction chamber can be in the form of a partition in the middle of a hot pot, as long as it can separate the two reagents. The two reagents can be added to the two sides of the septum in the reaction chamber respectively, and then freeze-dried or dried to obtain a nucleic acid detection device pre-loaded with nucleic acid amplification reaction reagents.

[0109] In some methods, the height of the septum at the bottom of the reaction chamber should not be too high, generally 2 mm, just enough to pre-separate the two reagents. After reconstitution, when performing isothermal amplification, the two reagents still need to be mixed together to prevent the situation where mixing is difficult due to the septum being too high.

[0110] Furthermore, the lysis buffer comprises tris(hydroxymethyl)aminomethane (Tris), ethylenediaminetetraacetic acid, guanidine isothiocyanate, and Triton 100.

[0111] After the nucleic acid sample is lysed by the lysis buffer and adsorbed by the nucleic acid adsorption membrane, although excess sample enters the filter paper storage tank, some lysis buffer remains on the nucleic acid adsorption membrane. This residue is then washed into the reaction chamber along with the elution buffer for isothermal nucleic acid amplification. Therefore, the components of the lysis buffer must not affect the isothermal nucleic acid amplification reaction or the nucleic acid detection process; otherwise, the detection sensitivity will be affected, leading to missed or false detections.

[0112] The lysis buffer provided by this invention will not adversely affect the nucleic acid amplification reaction. Therefore, after the nucleic acid in the sample is adsorbed by the nucleic acid adsorption membrane, there is no need to add a cleaning agent to rinse it. The target nucleic acid can be eluted with the elution buffer and enter the isothermal amplification reaction. It is particularly suitable for the nucleic acid detection device provided by this invention.

[0113] Furthermore, the sample processing chamber includes a nucleic acid adsorption membrane, which is a silica GF / C membrane or a silica gel membrane.

[0114] Furthermore, the eluent comprises magnesium acetate, ethylenediaminetetraacetic acid, and tris(hydroxymethyl)aminomethane (Tris).

[0115] After the elution buffer is added through the sample loading port, it can elute the nucleic acid adsorbed by the nucleic acid adsorption membrane into the reaction chamber for isothermal amplification reaction.

[0116] Mg 2+ It serves as an initiator for isothermal amplification reactions and can be added to the elution buffer used to elute nucleic acids. It is added to the reaction chamber along with the elution buffer as nucleic acids are eluted from the nucleic acid adsorption membrane, without affecting the nucleic acid elution effect, and can successfully initiate the isothermal amplification reaction of nucleic acids.

[0117] The elution buffer provided by this invention can efficiently elute nucleic acids into the reaction chamber, initiate the isothermal amplification reaction of nucleic acids, and effectively improve the sensitivity of nucleic acid detection.

[0118] Furthermore, the sample processing chamber is provided with an inlet, which is not capped; the lysis buffer or elution buffer is placed in a reagent bottle, and the mouth of the reagent bottle and the inlet can be sealed together.

[0119] The nucleic acid detection device provided by this invention does not require a cover for the inlet, and even if dust enters, it can be intercepted by the nucleic acid adsorption membrane.

[0120] After isothermal amplification of nucleic acid, the content of the nucleic acid to be tested increases significantly, which poses a risk of biological contamination. Therefore, when adding elution buffer using reagent bottles, the bottle opening can be directly screwed onto the injection port to achieve a sealing and contamination prevention effect.

[0121] Furthermore, this invention provides a method for nucleic acid detection using a nucleic acid detection system, comprising the following steps:

[0122] (1) Add lysis buffer to the sample to complete sample lysis;

[0123] (2) Add the pyrolyzed sample through the sample addition port;

[0124] (3) Complete the first rotation;

[0125] (4) Add the elution buffer through the sample addition port;

[0126] (5) Start the constant temperature heating device to amplify nucleic acid;

[0127] (6) Complete the second rotation;

[0128] (5) Read the test results from the observation window on the top of the test strip.

[0129] The nucleic acid testing system provided by this invention is simple, convenient, and integrated, reducing the requirements of conventional nucleic acid testing on laboratories, equipment, and personnel skills, making it applicable to field sites, small clinics, and pet shops.

[0130] In some embodiments, the nucleic acid detection system provided by this invention can be used for the nucleic acid detection of pathogens.

[0131] In some embodiments, the nucleic acid detection system provided by this invention can be used for the nucleic acid detection of pet pathogens (such as feline herpesvirus), livestock pathogens, plant pathogens, or food pathogens.

[0132] The beneficial effects of this invention are as follows:

[0133] 1. Improve the structure of the nucleic acid detection device so that nucleic acid detection can be completed by two rotations, and ensure that each sample or reagent is added in a free fall to the target area. No additional drainage facilities are needed, which can improve efficiency and detection sensitivity.

[0134] 2. By setting a sample inlet channel of a certain height, the sample enters from the inlet and is accelerated through the sample inlet channel of a certain height, so that it can impact the nucleic acid adsorption membrane with greater force, thereby promoting the nucleic acid adsorption membrane to adsorb nucleic acid in the sample more fully and improving the sensitivity of nucleic acid detection.

[0135] 3. By setting up drainage channels in the reaction chamber and selecting appropriate drainage channel widths and numbers, the efficiency of nucleic acid amplification reaction can be improved;

[0136] 4. By designing the placement of the first and second reaction membranes, the drainage effect can be further improved, thereby increasing the efficiency of nucleic acid amplification reaction;

[0137] 5. Simple, compact, low cost, and easy to operate;

[0138] 6. High detection sensitivity;

[0139] 7. Fast testing time;

[0140] 8. It can be used on humans, animals, etc., and has a wide range of applications. Attached Figure Description

[0141] Figure 1 This is a schematic diagram of the nucleic acid detection device in Example 1;

[0142] Figure 2 This is a cross-sectional view of the nucleic acid detection device in Example 1;

[0143] Figure 3 This is a schematic diagram showing the disassembled structure of the nucleic acid detection device in Example 1;

[0144] Figure 4 This is a schematic diagram of the upper cover structure of the sample processing chamber in Example 1;

[0145] Figure 5 This is a schematic diagram of the lower cover structure of the sample processing chamber in Example 1;

[0146] Figure 6 This is a schematic diagram of the sample processing chamber in Example 1;

[0147] Figure 7 This is a cross-sectional view of the sample processing chamber in Example 1;

[0148] Figure 8 This is a schematic diagram of the sample reaction chamber in Example 1;

[0149] Figure 9 This is a structurally disassembled schematic diagram of the detection cavity in Example 1;

[0150] Figure 10 This is a schematic diagram of the transverse flow test strip structure in Example 1;

[0151] Figure 11 This is a schematic diagram of the reaction chamber structure of the sample reaction chamber in Example 1 (viewed from bottom to top);

[0152] Figure 12 This is a schematic diagram of the reaction chamber structure of the sample reaction chamber in Example 1 (viewed from bottom to top);

[0153] Figure 13 This is a schematic diagram of the reaction chamber structure of the sample reaction chamber in Example 1 (viewed from top to bottom). The first reaction membrane and the second reaction membrane are placed in the reaction chamber, with the second reaction membrane placed vertically above the first reaction membrane.

[0154] Figure 14 This is a schematic diagram of the reaction chamber structure of the sample reaction chamber in Example 1 (viewed from top to bottom), with a partition strip in the middle of the reaction chamber;

[0155] Figure 15 This is a schematic diagram of the rotation and state changes of the nucleic acid detection device in Example 2;

[0156] Figure 16 This is a schematic diagram of the structure of the nucleic acid detection device and reagent bottle after being combined and sealed in Example 3;

[0157] Figure 17 This is the standard colorimetric card for the test results of the transverse flow test strip in Example 4.

[0158] Detailed description

[0159] The structures involved in this invention or the technical terms used therein will be further described below. Unless otherwise specified, they shall be understood and interpreted in accordance with general terms commonly used in the art.

[0160] Detection

[0161] A test indicates the presence or absence of a substance or material, such as, but not limited to, chemical substances, organic compounds, inorganic compounds, metabolites, drugs or drug metabolites, organic tissues or their metabolites, nucleic acids, proteins, or polymers. Additionally, a test indicates the quantity of the substance or material being tested. Furthermore, tests also include immunoassays, chemical assays, enzyme assays, etc.

[0162] sample

[0163] The detection device of the present invention can detect samples or the collector can collect samples or specimens including biological fluids (e.g., case fluids or clinical samples). Liquid samples or fluid samples can be derived from solid or semi-solid samples, including excrement, biological tissues, and food samples. Solid or semi-solid samples can be converted into liquid samples using any suitable method, such as mixing, crushing, softening, incubating, dissolving, or digesting solid samples by enzymatic action in a suitable solution (e.g., water, phosphate solution, or other buffer solution). "Biological samples" include samples derived from animals, plants, and food, such as urine, saliva, blood and its components, cerebrospinal fluid, vaginal secretions, sperm, feces, sweat, secretions, tissues, organs, tumors, cultures of tissues and organs, cell cultures, and media derived from humans or animals. Preferred biological samples are urine; more preferably, biological samples are saliva, sputum, nasal secretions, etc. Food samples include food processing substances, final products, meat, cheese, wine, milk, and drinking water. Plant samples include those derived from any plant, plant tissues, plant cell cultures, and media. "Environmental samples" originate from the environment (e.g., liquid samples from lakes or other water bodies, sewage samples, soil samples, groundwater, seawater, and wastewater samples). Environmental samples may also include sewage or other wastewater.

[0164] Using suitable detection or testing elements of this invention, any analyte can be detected. Preferably, this invention is used to detect nucleic acids in blood, saliva, and urine. Using the sample processing chamber 2 of this invention, samples of any of the above forms can be collected, whether initially solid or liquid, as long as these liquid or fluid samples can be adsorbed by the nucleic acid adsorption element in the sample processing chamber 2. The nucleic acid adsorption element is located within the sample processing chamber 2 and can absorb nucleic acids from the liquid or fluid sample, keeping the nucleic acids in the fluid sample within the adsorption element. The nucleic acid adsorption element can be any material capable of absorbing nucleic acids in liquids, such as sponge, filter paper, polyester fiber, gel, non-woven fabric, cotton, polyester film, yarn, flocking, etc. This invention preferably uses a nucleic acid adsorption membrane 9 as the nucleic acid adsorption element.

[0165] Downstream and upstream

[0166] Downstream or upstream is a classification based on the direction of liquid flow. Generally, liquids or fluids flow from upstream to downstream. A downstream region receives liquid from an upstream region, and liquid can also flow upstream to downstream. This classification is generally based on the direction of liquid flow. For example, in some materials where capillary force drives liquid flow, the liquid can overcome gravity and flow in the opposite direction. In this case, upstream and downstream are still classified according to the direction of liquid flow. For example... Figure 10As shown, the nucleic acid detection device 1 mentioned in this invention has a sample inlet 7 for applying samples, a sample processing chamber 2, a sample reaction chamber 3, and a detection chamber 4. After the sample is applied from the inlet 7, it enters the sample processing chamber 2. The sample processing chamber 2 first adsorbs the nucleic acid in the sample through a nucleic acid adsorption membrane 9. The first rotation transfers the nucleic acid adsorption membrane 9 with adsorbed nucleic acid to the amplification reaction chamber 15 of the sample reaction chamber 3. The nucleic acid on the nucleic acid adsorption membrane 9 is then washed into the reaction chamber 15 by the shortest distance using elution buffer in a free-fall manner for isothermal amplification. The sample processing chamber 2 is located upstream of the sample reaction chamber 3, and the sample reaction chamber 3 is located downstream. The second rotation transfers the reaction chamber 15 of the sample reaction chamber 3, along with the amplification product, to the transversely flowing test strip 25 of the detection chamber 4. The amplification product is dripped into the test strip 25 in a free-fall manner for detection. This method is more convenient, flexible, and error-free to use. The sample reaction chamber 3 is located upstream of the detection chamber 4, and the detection chamber 4 is located downstream. This invention, through a two-rotation design, ensures that each sample or reagent addition reaches the downstream target area via free fall. Its compact design eliminates the need for additional drainage facilities, thereby improving efficiency and detection sensitivity.

[0167] fluid connectivity

[0168] Fluid connectivity refers to the ability of a liquid to flow from one place to another, possibly guided by physical structures. Passing through physical structures generally means the liquid flows passively or actively through the surface or internal space of these structures. Passive flow is typically caused by external forces, such as capillary action or air pressure. This flow can also be due to the liquid's own forces (gravity or pressure) or be passive. Fluid flow under air pressure can be downstream or in the opposite direction, or it can be propelled by air pressure from one location to another. Connectivity does not necessarily require the presence of liquid; it merely indicates a connection or state between two objects where liquid can flow from one object to another. Conversely, if there is no fluid connectivity between two objects, and liquid cannot flow from one object to another, this state is called non-connectivity, or a non-fluid-connected state.

[0169] Test element

[0170] The term "test element" as used here refers to any element that can detect whether a sample contains the analyte of interest. This detection can be based on any technical principle, including immunology, chemistry, electricity, optics, molecular biology, nucleic acid science, physics, etc. A transversely flowing test strip can be used as the test element, capable of detecting multiple analytes. Of course, other suitable test elements can also be used in this invention.

[0171] Various testing elements can be combined and used in this invention. One form is a test strip or a transversely flowing test strip. Test strips used to analyze analytes (such as nucleic acids) in samples can be in various forms, such as immunoassays or chemical analyses. Test strips can employ non-competitive or competitive analytical methods. A test strip generally comprises an absorbent material with a sample loading area, a reagent area, and a test area. A fluid or liquid sample is added to the sample loading area and flows to the reagent area via capillary action. In the reagent area, if the analyte is present, the sample binds to the reagent. The sample then continues to flow to the test area. Other reagents, such as molecules that specifically bind to the analyte, are immobilized in the test area. These reagents react with the analyte in the sample (if present) and bind the analyte to that area, or bind to a reagent in the reagent area. A marker for displaying the detection signal is present in or separated from the reagent area.

[0172] In a typical non-competitive analysis model, a signal is generated if the analyte is present in the sample, and no signal is generated if the analyte is not present. In a competitive method, a signal is generated if the analyte is not present in the sample, and no signal is generated if the analyte is present.

[0173] The test element can be a test strip, made of absorbent or non-absorbent material. The test strip can include various materials for liquid sample transfer. One material of the test strip can be overlaid on another, such as filter paper over a nitrocellulose membrane. One area of ​​the test strip can be made of one or more materials, while another area can be made of a different material or one more. The test strip can be adhered to a support or rigid surface to improve its grip strength.

[0174] The analyte is detected by a signal generation system, such as using one or more enzymes that specifically react with the analyte, or by immobilizing a specific binding substance on a test strip as described above, to fix a composition of one or more signal generation systems onto the analyte detection area of ​​the test strip. The signal-generating substance may be in the sample application area, reagent area, detection area, or the entire test strip, and may fill one or more materials of the test strip. A solution containing the signal substance is added to the surface of the test strip or one or more materials of the test strip are immersed in a solution containing the signal substance. The test strip containing the signal substance solution is then dried.

[0175] The test strip's zones can be arranged as follows: sample application zone, reagent zone, detection zone, control zone, sample adulteration detection zone, and liquid sample absorption zone. The control zone follows the detection zone. All zones can be arranged on a single strip using only one material, or different zones can use different materials. Zones can be in direct contact with the liquid sample, or different zones can be arranged according to the direction of liquid sample flow, with the ends of each zone connected to the front of another zone and overlapping. The material used can be highly absorbent, such as filter paper, glass fiber, or nitrocellulose membrane. Other forms of test strips are also possible.

[0176] The most commonly used reagent strips are nitrocellulose membrane reagent strips, where the detection area includes a nitrocellulose membrane (NC). Specific binding molecules are immobilized on the nitrocellulose membrane to display the detection results. Other options include cellulose acetate membranes or nylon membranes, etc. For example, the following patents describe reagent strips or devices containing reagent strips: US 4857453; US 5073484; US5119831; US ​​5185127; US 5275785; US 5416000; US 5504013; US 5602040; US 5622871; US5654162; US 5656503; US 5686315; US 5766961; US ​​5770460; US 5916815; US 5976895; US6248598; US 6140136; US 6187269; US 6187598; US 6228660; US 6235241; US US 6306642; US 6352862; US 6372515; US 6379620; and US 6403383. The test strips disclosed in the above patent documents and similar devices with test strips can be used in the test elements or detection devices of the present invention to detect analytes, such as the detection of analytes in samples.

[0177] The test strips used in this invention can be what are commonly referred to as lateral flowtest strips. The specific structure and detection principle of these test strips are well-known to those skilled in the art. A typical test strip includes a sample collection area or sample application area 51, a labeling area 52, a detection area 53, and an absorbent area 54. The sample collection area includes a sample receiving pad, the labeling area includes a labeling pad, and the absorbent area may include an absorbent pad. The detection area includes the necessary chemical substances to detect the presence of the analyte, such as immunoassay reagents or enzyme reagents. Commonly used test strips are nitrocellulose membrane strips, where the detection area 52 includes a nitrocellulose membrane on which specific binding molecules are immobilized to display the detection result area. Other options include cellulose acetate membranes or nylon membranes, etc. Downstream of the detection area, there may also be a result control area, typically represented by a horizontal line, such as a detection line 55 or a control line 56. Such test strips are traditional strips; however, other types of test strips utilizing capillary action for detection are also possible. In addition, typical test strips contain dry chemical reagents, such as fixed antibodies or other reagents. When these reagents come into contact with liquid, the liquid flows along the strip via capillary action. As the strip flows, the dry reagents dissolve in the liquid, allowing them to proceed to the next area where they react and trigger the necessary detection. The liquid flow is primarily achieved through capillary action. These principles can be applied to the detection device of this invention, either by placing it in the detection chamber to contact the liquid sample or by detecting the presence or quantity of the analyte in the liquid sample entering the detection chamber.

[0178] Besides the aforementioned test strips or transverse flow test strips being used to contact liquid samples to test whether the liquid sample contains the analyte, the test element of this invention can itself serve as a detection device to detect the analyte in the sample. Therefore, the detection device itself is equivalent to the test element. For example, after the fluid sample is mixed with the processing liquid, it can be directly detected using the test element. A detailed description follows; when describing the receiving device for processing fluid samples, the test element can be used independently for detection.

[0179] Nucleic acid

[0180] The substance being analyzed and detected in this invention is nucleic acid.

[0181] The term "nucleic acid" includes any compound and / or substance that can be incorporated into an oligonucleotide chain. Exemplary nucleic acids used in this application include, but are not limited to, DNA, and RNA includes messenger RNA (mRNA), its hybrids, RNAi inducers, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, RNA that induces triple helix formation, aptamers, vectors, etc., which are described in detail in this application.

[0182] The terms "deoxyribonucleic acid," "DNA," or "DNA molecule" refer to a molecule composed of two strands (polynucleotides), each containing a monomeric nucleotide unit. Nucleotides are linked together in the chain by covalent bonds between the sugar group of one nucleotide and the phosphate group of the next, creating an alternating sugar-phosphate backbone. The nitrogenous bases of the two separate polynucleotide chains are bonded together by hydrogen bonds to form double-stranded DNA.

[0183] The terms "ribonucleic acid," "RNA," or "RNA molecule" refer to a chain of at least two base-glycosyl-phosphate combinations. In one embodiment, the term includes compounds composed of nucleotides, wherein the sugar portion is ribose. In another embodiment, the ends include RNA and RNA derivatives in which the backbone is modified. In one embodiment, RNA may be present in the form of tRNA (transfer RNA), snRNA (small nuclear RNA), rRNA (ribosomal RNA), mRNA (messenger RNA), antisense RNA, small repressor RNA (siRNA), microRNA (miRNA), and ribozymes. The uses of siRNA and miRNA have been described (Caudy AA et al, Genes & Devel 16:2491-96 and references cited therein). Additionally, these forms of RNA can be single-stranded, double-stranded, triple-stranded, or quadruplexed. In another embodiment, the term also includes artificial nucleic acids with other types of backbones but having the same bases. In another embodiment, the artificial nucleic acid is PNA (peptide nucleic acid). PNA contains a peptide backbone and nucleotide bases and is capable of binding to DNA and RNA molecules in another embodiment. In another embodiment, the nucleotide is a modified oxobutane. In another embodiment, the nucleotide is modified by replacing one or more phosphodiester bonds with thiophosphate bonds. In another embodiment, the modified nucleic acid comprises any other variant of the phosphate backbone of a natural nucleic acid known in the art. Those skilled in the art are familiar with the use of thiophosphate nucleic acids and PNAs, as described, for example, in Nielsen PE, Curr Opin Struct Biol 9:353-57;

[0280] and Raz N Ket al Biochem Biophys Res Commun. 297:1075-84. The production and use of nucleic acids are well known to those skilled in the art, as described, in Molecular Cloning, (2001), Sambrook and Russell, eds. And Methods in Enzymology: Methods for molecular cloning ineukaryotic cells (2003) Purchio and GCFareed. Each nucleic acid derivative represents a separate embodiment of the invention.

[0184] As used herein, the term "nucleic acid" includes one or more of the following types: polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), and any other type of polynucleotide that is an N-glycoside of a purine or pyrimidine base or a modified purine or pyrimidine base (including a base-free site). The term "nucleic acid," as used herein, also includes covalently bonded polymers of ribonucleosides or deoxyribonucleosides, said covalent bonding typically via phosphodiester bonds between subunits, but in some cases via thiophosphates, methylphosphonates, etc. "Nucleic acid" includes single-stranded and double-stranded DNA and single-stranded and double-stranded RNA. Exemplary nucleic acids include, but are not limited to, gDNA; hnRNA; mRNA; rRNA; tRNA; microRNA (miRNA); small interfering RNA (siRNA); small nucleolar RNA (snoRNA); small nuclear RNA (snRNA); and hourly sequence RNA (stRNA), and any combination thereof.

[0185] Modified nucleotides

[0186] In some embodiments, the mRNA comprises modified nucleotides, wherein the modified nucleotides are selected from one or more of the following nucleotides: 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5-propynyl-cytidine, C-5-propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5 -Propyno-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deadenosine, 7-deadenosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, pseudouridine, N-1-methyl-pseudouridine, 2-thiouridine, and 2-thiocytidine; methylated bases; inserted bases; 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose; thiophosphate and 5'-N-phosphoramide bond. Modified nucleotides as described in PCT / CN2020 / 074825 and PCT / CN2020 / 106696.

[0187] Detection device

[0188] A detection device is a device used to detect whether a sample contains the analyte. The nucleic acid detection device provided by this invention includes, from top to bottom, a sample processing chamber 2, a sample reaction chamber 3, and a detection chamber 4. The sample processing chamber 2 receives the sample from the detection device for mixing or processing, such as adsorption and elution of the nucleic acid adsorption membrane 9, and processing of liquid or liquid samples. The sample processing chamber 2 is not specifically designed to receive the detection device; it can exist independently and function solely for processing fluid samples. The sample processing chamber 2 is used to extract nucleic acids from the sample. When the sample processing chamber 2 rotates relative to the sample reaction chamber 3, the nucleic acids can be transferred to the sample reaction chamber 3 for nucleic acid amplification. The sample reaction chamber 3 is used to complete the nucleic acid amplification reaction. When the sample reaction chamber 3 rotates relative to the detection chamber 4, the amplification products can be transferred to the detection chamber 4. The detection chamber 4 is used to detect the nucleic acids in the amplification products.

[0189] Two rotations

[0190] Because nucleic acid testing involves many steps, and the testing device needs to be as compact and simple as possible, it is necessary to ingeniously design the relative positions of the sample processing chamber 2, sample reaction chamber 3, and detection chamber 4 as the testing process progresses. This allows them to work together within a limited space to complete nucleic acid extraction, amplification, and detection. The device integrates sample addition, nucleic acid purification, isothermal amplification, and immunochromatographic result reading into a single device, resulting in a simple and compact nucleic acid testing device. Nucleic acid testing can be completed through two rotations, and it ensures that each sample or reagent addition reaches the target area in a free-fall manner, without the need for additional drainage facilities.

[0191] The sample processing chamber 2 in the detection device 1 provided by the present invention is used to extract nucleic acid material from the sample, and the sample reaction chamber 3 is used to amplify the nucleic acid material to generate amplification products. The detection chamber 4 is used to detect the quantity of amplification products or whether there are amplification products.

[0192] The sample processing chamber 2 has a first position 201, a second position 202, and a third position 203. Figure 15 Meanwhile, the nucleic acid adsorption membrane 9 inside the sample processing chamber 2 also has a first position 901, a second position 902 and a third position 903; the sample reaction chamber 3 has a first position 301 and a second position 302, and the reaction chamber 15 in the sample reaction chamber 3 also has a first position 1501 and a second position 1502.

[0193] When the sample processing chamber 2 and the sample reaction chamber 3 are in the first position 201, the sample processing chamber 2, the sample reaction chamber 3 and the detection chamber 4 are not in fluid communication with each other.

[0194] When the sample processing chamber 2 is in the second position 202, the sample processing chamber 2 is in fluid communication with the sample reaction chamber 3, while the sample reaction chamber 3 is not in fluid communication with the detection chamber 4.

[0195] When the sample processing chamber 2 is in the third position 203, the sample reaction chamber 3 and the detection chamber 4 are in fluid communication.

[0196] When the sample processing chamber 2 moves from the first position 201 to the second position 202, the sample reaction chamber 3 is in the first position 301; when the sample processing chamber 2 moves from the second position 202 to the third position 203, the sample reaction chamber 3 is in the second position 302, or the sample reaction chamber 3 moves from the first position 301 to the second position 302.

[0197] When the sample reaction chamber 3 is in the second position 302, the sample reaction chamber 3 and the detection chamber 4 are in fluid communication.

[0198] When the sample processing chamber 2 moves from the second position 202 to the third position 203, the sample reaction chamber 3 moves from the first position 301 to the second position 302. Alternatively, the sample processing chamber 2 and the sample reaction chamber 3 move simultaneously, thereby causing the sample processing chamber 2 to move from the second position 202 to the third position 203 and causing the sample reaction chamber 3 to move from the first position 301 to the second position 302.

[0199] The sample processing chamber 2, the sample reaction chamber 3, and the detection chamber 4 are arranged sequentially from top to bottom, with an overall cylindrical shape. The sample processing chamber 2 and the sample reaction chamber 3 are rotated to change positions. This rotation includes two rotations: the first rotation moves the sample processing chamber 2 from a first position 201 to a second position 202, while the sample reaction chamber 3 and the detection chamber 4 remain stationary; after the first rotation, the sample processing chamber 2 and the sample reaction chamber 3 are in fluid communication, while the sample reaction chamber 3 is not in fluid communication with the detection chamber 4. Therefore, the first rotation is a single rotation of the sample processing chamber 2, while the sample reaction chamber 3 and the detection chamber 4 remain stationary. The second rotation moves the sample processing chamber 2 from the second position 202 to a third position 203, while simultaneously, the sample reaction chamber 3 moves from a first position 301 to a second position 302; after the second rotation, the sample processing chamber 2, the sample reaction chamber 3, and the detection chamber 4 are in fluid communication. Therefore, the second rotation is a combined rotation of the sample processing chamber 2 and the sample reaction chamber 3, while the detection chamber 4 remains stationary. Detailed Implementation

[0200] The present invention will be further described in detail below with reference to embodiments. It should be noted that the embodiments described below are intended to facilitate understanding of the present invention and are not intended to limit it in any way. Reagents not specifically mentioned in this embodiment are all known products obtained by purchasing commercially available products.

[0201] Example 1: Nucleic acid detection device provided by the present invention

[0202] The nucleic acid detection device provided in this embodiment is as follows: Figure 1-14 As shown.

[0203] like Figures 1-3 The nucleic acid detection device 1 provided in this embodiment includes, from top to bottom, a sample processing chamber 2, a sample reaction chamber 3, and a detection chamber 4. The sample processing chamber 2 is used to extract nucleic acids from the sample. When the sample processing chamber 2 rotates relative to the sample reaction chamber 3, the nucleic acids can be transferred to the sample reaction chamber 3 for nucleic acid amplification. The sample reaction chamber 3 is used to complete the nucleic acid amplification reaction. When the sample reaction chamber 3 rotates relative to the detection chamber 4, the amplification products can be transferred to the detection chamber 4. The detection chamber 4 is used to detect the nucleic acids in the amplification products.

[0204] like Figure 4 and 5 The sample processing chamber 2 is used to extract nucleic acids from the sample. It includes an upper cover 5 and a lower cover 6. The upper cover 5 is provided with an inlet 7. The inlet 7 is connected to an inlet channel 8. A nucleic acid adsorption membrane 9 is fixed at the bottom of the inlet channel 8. The nucleic acid adsorption membrane 9 is used to adsorb nucleic acids in the sample. The lower cover 6 includes an outer wall 10 and a bottom surface 11. The bottom surface 11 is provided with a through-hole 12. The upper cover 5 and the lower cover 6 are fixed together. The through-hole 12 is always aligned with the inlet channel 8.

[0205] Preferred, such as Figures 4-7 The upper cover 5 has a protrusion 13 on the outer periphery of its side wall, and the lower cover 6 has a groove 14 in its side wall that matches the protrusion 13. The upper cover 5 and the lower cover 6 are fixed together by the protrusion 13 and the groove 14 respectively. That is to say, the positions of the upper cover 5 and the lower cover 6 are fixed. The through-hole 12 on the bottom surface of the lower cover 6 is always aligned with the sample inlet channel 8. When they need to be rotated, they must be rotated together, and the upper cover 5 or the lower cover 6 cannot be rotated separately.

[0206] The diameter of the side wall of the upper cover 5 is slightly smaller than that of the side wall of the lower cover 6, so that the upper cover 5 can fit into the side wall of the lower cover 6. By setting a protruding ring 20 in the side wall of the lower cover 6, the upper surface 39 of the upper cover is exactly flush with the highest section 38 of the side wall of the lower cover after the upper cover 5 and the lower cover 6 are combined.

[0207] Preferably, the inlet 7 has a diameter of 8 mm, and the injection channel 8 is cylindrical with a bottom diameter consistent with that of the inlet 7 and a height of 19 mm, extending directly downwards from the inlet 7. The sample enters from the inlet 7 and passes through the injection channel 8 to reach the nucleic acid adsorption membrane 9. The nucleic acid adsorption membrane 9 is a circular thin film, which can be made of silica or polysiloxane (silica gel); its diameter is consistent with or slightly larger than that of the inlet 7. The nucleic acid adsorption membrane 9 is fixed at the bottom of the injection channel 8 and must completely cover the bottom outlet of the injection channel 8. The sample enters from the inlet 7 and, after being accelerated through the injection channel 8 at a certain height, can impact the nucleic acid adsorption membrane 9 with greater force, thereby promoting more complete adsorption of nucleic acids in the sample by the nucleic acid adsorption membrane 9 and improving the sensitivity of nucleic acid detection. Therefore, after the sample enters from the inlet 7, it completely passes through the nucleic acid adsorption membrane 9, and almost all the nucleic acids in the sample are adsorbed by the nucleic acid adsorption membrane 9.

[0208] like Figure 8 The bottom of the sample reaction chamber 3 is provided with a reaction chamber 15 and a filter paper storage tank 16; the filter paper storage tank 16 is filled with filter paper for adsorbing excess sample; the reaction chamber 15 is provided with a nucleic acid amplification reaction membrane or fixed with nucleic acid amplification reaction drying reagent. This is to make the detection process more convenient and flexible, avoid the need to add multiple reagents from the sample addition port 7 multiple times during the detection process, and prevent the reagents from being adsorbed by the nucleic acid adsorption membrane 9 of the sample addition port 7, affecting the isothermal amplification reaction and causing detection errors.

[0209] like Figure 9 The outer wall 10 of the lower cover 6 of the sample processing chamber 2 is provided with a first rotating buckle 17, and the upper part of the side wall of the sample reaction chamber 3 is provided with a first rotating groove 18. When the sample processing chamber 2 rotates relative to the sample reaction chamber 3, the first rotating buckle 17 moves from one end of the first rotating groove 18 to the other end. The number of the first rotating buckle 17 and the first rotating groove 18 is more than one.

[0210] like Figure 5 The sample processing chamber 2 has a reduced diameter at the lower end 19 of the side wall of the lower cover 6, allowing the side wall of the lower cover 6 to fit inside the side wall of the sample reaction chamber 3. Figure 8 This allows the sample processing chamber 2 and the sample reaction chamber 3 to be combined into a regular cylindrical shape, which is more aesthetically pleasing and easier to rotate.

[0211] Preferably, the lower end 19 of the side wall of the lower cover 6 is provided with two protruding first rotating buckles 17, which are symmetrically distributed on the lower end 19 of the side wall; the upper part of the outer wall of the sample reaction chamber 3 is provided with two first rotating slots 18, which are symmetrically distributed on the upper part of the outer wall; the first rotating slot 18 is a long strip-shaped horizontal hollowed-out slot provided on the outer wall. When the lower end 19 of the side wall of the lower cover is fitted into the side wall of the sample reaction chamber 3, the protruding first rotating buckles 17 are exactly located in the hollowed-out first rotating slots 18.

[0212] like Figure 8 The first rotating slot 18 has protruding limiting blocks at both its left and right ends. In the initial position, the first rotating latch 17 is located at the leftmost end of the first rotating slot 18 and is blocked and fixed by the limiting block 21. After nucleic acid extraction is completed (sample is added and the nucleic acid in the sample is adsorbed by the nucleic acid adsorption membrane), the first rotation begins. The first rotating latch 17 needs to overcome the obstruction of the left limiting block 21 and slide to the right along the first rotating slot 18 until the first rotating latch 17 overcomes the right limiting block 22 and enters the rightmost end, where it is blocked and fixed by the limiting block 22 and can no longer rotate to the right. At this time, the sample injection channel 8 and the nucleic acid adsorption membrane 9 are just transferred above the amplification reaction chamber 15, ready for nucleic acid washing and isothermal amplification reaction.

[0213] like Figure 9 The detection chamber 4 includes a test strip upper cover 23 and a test strip lower cover 24. A transversely flowing test strip 25 is placed in the upper cover 23 and the lower cover 24, its position fixed, for detecting nucleic acids in the amplification products. The test strip upper cover 24 has a sample application hole 32 and a result observation window 41. The sample application hole 32 is aligned with the sample application position on the test strip, and the result observation window 41 is aligned with the result reading window on the test strip for reading the result. The test strip upper cover 23 has a cylindrical groove 26, with the sample application hole 32 located on the bottom surface of the cylindrical groove 26. A second rotating slot 27 is provided on the groove wall. A second rotating latch 29 is provided on the lower part 28 of the outer wall of the sample reaction chamber 3. When the sample reaction chamber 3 rotates relative to the detection chamber 4, the second rotating latch 29 moves from one end of the second rotating slot 27 to the other end. There are at least two second rotating latches 29 and two rotating slots 27. Two second rotating buckles 29 are symmetrically distributed on the lower end 28 of the outer wall of the sample reaction chamber 3, and two second rotating slots 27 are symmetrically distributed on the wall of the cylindrical slot 26. The second rotating slot 27 is a long, horizontally hollowed-out slot on the wall. When the lower part 28 of the outer wall of the sample reaction chamber 3 is fitted into the cylindrical slot 26, the protruding second rotating buckles 29 are precisely positioned within the hollowed-out second rotating slot 27. Both the left and right ends of the second rotating slot 27 are provided with protruding limiting blocks. During the first rotation, the positions of the second rotating buckle 29 and the second rotating slot 27 remain unchanged. The second rotating buckle 29 is located at the leftmost end of the second rotating slot 27 and is blocked and fixed by the left-end limiting block 30. After the nucleic acid amplification reaction is completed, the second rotation begins. The second rotating buckle 29 needs to overcome the obstruction of the left-end limiting block 30 and slide to the right along the second rotating slot 27 until the second rotating buckle 29 overcomes the right-end limiting block 31 and enters the rightmost end, where it is blocked and fixed by the limiting block 31. At this time, the nucleic acid adsorption membrane 9 and the reaction chamber 15 are transferred together to the sample application hole 32 of the test reagent strip 25.

[0214] Preferred, such as Figure 9The test strip cover 24 has a heating hole 33 located below the reaction chamber 15, which provides a heat source for the nucleic acid amplification reaction. The heat source for the isothermal nucleic acid amplification reaction can be the heating hole 33, which is compatible with an isothermal heating device and can be placed on any circular metal protrusion of an isothermal heat source. The isothermal heating device provides heat to the reaction chamber 15 through the heating hole 33, initiating and maintaining the isothermal amplification reaction. Alternatively, the heat source for the isothermal nucleic acid amplification reaction can be directly located inside the nucleic acid detection device 1, eliminating the need for a separate isothermal heating device.

[0215] The structure of the transverse flow test strip 25 is shown below. Figure 10 The test strip includes a sample application area 51, a labeling area 52, a detection area 53, and an absorption area 54. The detection area 53 contains a detection line 55 or a control line 56. In this embodiment, the labeling area 52 is coated with colloidal gold labeled with anti-FAM antibody, the detection line 55 is coated with streptavidin, and the control line 56 is coated with goat anti-mouse antibody (antibody of goat anti-mouse IgG). The principle of its nucleic acid detection is as follows: the amplification primer contains biotin modification, and the 5' end of the probe is modified with a FAM fluorescent group. After amplification by the primer and probe, the 5' end of the amplification product carries the FAM fluorescent group, and the 3' end carries the biotin group. The target sequence can be successfully detected by the transverse flow test strip 25.

[0216] like Figure 11 The reaction chamber 15 is a cylindrical cavity, open from top to bottom, without a top or bottom surface. The absence of a top surface facilitates direct rinsing of the sample from the nucleic acid adsorption membrane 9 above into the reaction chamber 15; the absence of a bottom surface facilitates the transfer of the amplification reaction product from the reaction chamber 15 to the sample application well 32. At this point, the liquid in the reaction chamber 15, without bottom support, can smoothly drip onto the nucleic acid detection test strip 25. A gasket 152 is provided around the lower end 151 of the reaction chamber 15. When the reaction chamber 15 rotates and slides on the bottom surface of the cylindrical groove 26, the liquid in the reaction chamber 15 is protected by the gasket 152 and will not leak out of the reaction chamber 15. When the reaction chamber 15 rotates above the sample application well 32, the amplification product drips onto the test strip through the sample application well 32 for nucleic acid detection.

[0217] The reaction chamber 15 does not have a bottom surface, but it is placed on the lower cover 24 of the test strip. The gasket 152 prevents the liquid in the reaction chamber 15 from leaking out from the gap between the lower end 151 of the side wall of the reaction chamber and the surface of the lower cover 24 of the test strip. When the amplification reaction is completed and the second rotation is performed, the reaction chamber 15 will slide on the surface of the lower cover 24 of the test strip. With the protection of the gasket 152, even if it slides, the reaction liquid will not leak out of the reaction chamber 15.

[0218] like Figure 12 The lower end 151 of the reaction chamber is provided with a gasket groove 153 for fixing the position of the gasket 152.

[0219] like Figure 11 The inner wall of the reaction chamber 15 is provided with a drainage groove 154; the drainage groove 154 is composed of multiple trapezoidal columns 155 arranged at equal intervals on the inner wall; a drainage channel 156 is formed between two adjacent trapezoidal columns 155. Since the sample used for nucleic acid amplification is very small, ensuring that all the sample is guided into the reaction chamber 15 is a crucial step in ensuring the sensitivity of nucleic acid detection. By setting drainage grooves 154 all around the inner wall of the reaction chamber 15, the sample to be tested can be guided into the reaction chamber 15 to the maximum extent, avoiding omission. Preferably, the trapezoidal columns 155 extend from the upper end to the lower end of the reaction chamber 15, allowing the sample to be guided from the upper end to the lower end of the reaction chamber 15. This is mainly because the immobilized reaction membrane or drying reagent for nucleic acid amplification is placed at the lower end of the reaction chamber 15. Only by guiding the sample from the upper end to the lower end of the reaction chamber 15 can the sample be fully contacted with the immobilized reaction membrane or drying reagent, thereby improving the amplification reaction efficiency.

[0220] Preferred, such as Figure 13 The upper end of the trapezoidal column 155 is provided with an upwardly narrowing stepped platform 157; the width of the drainage channel 156 is 0.1-0.5 mm. The upwardly narrowing stepped platform 157 at the upper end of the trapezoidal column 155 can contact the nucleic acid adsorption membrane 9 above, thereby helping to absorb the sample from above into the drainage channel 156, ensuring sufficient drainage. In this embodiment, the height of the upwardly narrowing stepped platform 157 is 0.2 mm. The drainage channels 156 formed between each trapezoidal column 155 have a uniform width. The narrower the drainage channel 156, the better the drainage effect. However, if the drainage channel 156 is too narrow, it will increase the difficulty of the manufacturing process. Therefore, it is necessary to select an appropriate drainage channel width.

[0221] Preferably, there are 13 trapezoidal columns 155 and 13 drainage channels 156, evenly distributed along the inner wall of the reaction chamber 15. The width of the drainage channel is 0.5 mm, the bottom width of the trapezoidal column 155 is 0.9 mm, the distance protruding outward from the inner wall of the reaction chamber 15 is 1.25 mm, and the height is 3.7 mm. The width and number of drainage channels 156 (the number of drainage channels determines the number and arrangement of trapezoidal columns, thus determining the bottom width of the trapezoidal columns) determine whether the drainage effect can be maximized. In this embodiment, the cylindrical cross-sectional diameter of the reaction chamber 15 is 6 mm. Extensive research has shown that when the width of the drainage channel 156 is 0.5 mm, the bottom width of the trapezoidal column 155 is 0.9 mm, and the distance protruding outward from the inner wall of the reaction chamber 15 is 1.25 mm, a better drainage effect can be achieved.

[0222] like Figure 13When the nucleic acid amplification reaction membrane is pre-placed in the reaction chamber 15, the nucleic acid amplification reaction membrane includes a first reaction membrane 35 and a second reaction membrane 36. Because the recombinase reagent and PEG buffer reagent in the amplification reaction reagent must be placed separately before the amplification reaction, otherwise the recombinase is easily encapsulated by PEG during the amplification reaction, thus affecting the amplification reaction efficiency, two immobilized reagent reaction membranes, the first reaction membrane 35 and the second reaction membrane 36, are required. There are three ways to place the first reaction membrane 35 and the second reaction membrane 36: 1. The first reaction membrane 35 is laid flat at the lower end of the reaction chamber 15, and the second reaction membrane 36 is placed horizontally with the first reaction membrane 35; 2. The second reaction membrane 36 is placed vertically above the first reaction membrane 35; 3. The second reaction membrane 36 is placed vertically with the first reaction membrane 35. In this embodiment, the second method is preferred, with the first reaction membrane 35 laid flat at the lower end of the reaction chamber 15, and the second reaction membrane 36 located at the center of the cylinder of the reaction chamber 15, placed vertically above the first reaction membrane 35. The second placement method is preferred because experiments have shown that the placement of the two reaction membranes also affects the sample drainage effect. When the second reaction membrane 36 is placed vertically above the first reaction membrane 35 and in the middle position, it can help improve the drainage effect, thereby improving the amplification reaction efficiency and the sensitivity of nucleic acid detection.

[0223] Alternatively, nucleic acid amplification reaction drying reagents can be used within reaction chamber 15, namely the first drying reagent and the second drying reagent; the first drying reagent and the second drying reagent need to be separated by the partition strip 37 provided on the bottom surface of the reaction chamber. Figure 14 The first drying reagent is the recombinase reagent required for the nucleic acid amplification reaction; the second drying reagent is the PEG buffer reagent required for the nucleic acid amplification reaction; they are first placed on both sides of the spacer 37 and dried or lyophilized to form dried reagents; during detection, the two reagents are reconstituted by adding an eluent and then mixed to start the nucleic acid amplification reaction. Therefore, the spacer 37 should not be too high, otherwise it will be difficult to mix after reconstitution. In this embodiment, the height of the spacer 37 is 2 mm.

[0224] Example 2: Rotation and State Change Process of the Nucleic Acid Detection Device Provided by the Present Invention

[0225] The nucleic acid detection device 1 provided in this embodiment can complete nucleic acid amplification and detection through two rotations. The rotation and state change process is as follows: Figure 15 As shown, where Figure 15 (1) is the initial state; Figure 15 (2) is the state after the first rotation; Figure 15 (3) The state after the second rotation.

[0226] Depend on Figure 15It can be seen that the sample processing chamber 2 has a first position 201, a second position 202 and a third position 203. At the same time, the nucleic acid adsorption membrane 9 inside the sample processing chamber 2 also has a first position 901, a second position 902 and a third position 903. The sample reaction chamber 3 has a first position 301 and a second position 302. At the same time, the reaction chamber 15 in the sample reaction chamber 3 also has a first position 1501 and a second position 1502.

[0227] Nucleic acid testing device 1 before use ( Figure 15 (1) is in the initial position, that is, before rotation. The sample processing chamber 2 is in the first position 201, and the nucleic acid adsorption membrane 9 is also in the first position 901; the sample reaction chamber 3 is in the first position 301, and the reaction chamber 15 is also in the first position 1501. At this time, the sample processing chamber 2, the sample reaction chamber 3, and the detection chamber 4 are not fluidly connected to each other. That is to say, the sample inlet channel 8 of the sample processing chamber 2, the reaction chamber 15 of the sample reaction chamber 3, and the sample addition port 32 of the detection chamber 4 are not fluidly connected. However, at this time, the sample inlet channel 8 is located above the filter paper storage tank 16. The sample inlet channel 8, the through port 12, and the filter paper storage tank 16 are vertically distributed in a straight line from top to bottom. Therefore, the initial position can start adding samples. The sample is vertically added from the sample inlet 7. After passing through the sample inlet channel 8, it comes into contact with the nucleic acid adsorption membrane 9. The nucleic acid in the sample is adsorbed by the nucleic acid adsorption membrane 9, while the remaining liquid passes through the nucleic acid adsorption membrane 9 and enters the filter paper storage tank 16, where it is adsorbed by the filter paper in the filter paper storage tank 16.

[0228] After the first rotation ( Figure 15 (2) The sample processing chamber 2 rotates from the first position 201 to the second position 202. The nucleic acid adsorption membrane 9 inside the sample processing chamber 2 also rotates from the first position 901 to the second position 902. Meanwhile, the sample reaction chamber 3 remains in the first position 301, and the reaction chamber 15 remains in the first position 1501. At this time, the sample processing chamber 2 and the sample reaction chamber 3 are in fluid communication, but the sample reaction chamber 3 is not in fluid communication with the detection chamber 4. That is to say, the sample inlet channel 8 of the sample processing chamber 2 rotates to the top of the reaction chamber 15 of the sample reaction chamber 3, so that the sample inlet channel 8 is in fluid communication with the reaction chamber 15. When the reaction chamber 15 has not moved, the reaction chamber 15 and the sample loading port 32 of the detection chamber 4 are not in fluid communication.

[0229] The first position 901 of the nucleic acid adsorption membrane 9 is above the filter paper storage tank 16, and the second position 902 is above the reaction chamber 15. When the first rotating latch 17 is at one end of the first rotating slot 18, the nucleic acid adsorption membrane 9 is at the first position 901. During the first rotation, the first rotating latch 17 moves to the other end of the first rotating slot 18, and the nucleic acid adsorption membrane 9 moves to the second position 902. After the first rotation, the nucleic acid adsorption membrane 9 is at the second position 902. At this time, the sample injection channel 8, the through port 12, and the reaction chamber 15 are arranged vertically in a straight line, and the elution buffer can be added and the isothermal nucleic acid amplification reaction can begin.

[0230] The first rotation transfers the nucleic acid adsorption membrane 9, which adsorbs nucleic acid, to the top of the amplification reaction chamber 15. At this time, elution buffer can be added through the injection port 7. The elution buffer falls freely through the injection channel 8 and elutes the nucleic acid on the nucleic acid adsorption membrane 9 into the reaction chamber 15 through the shortest distance. Then, isothermal amplification can be performed in the reaction chamber 15.

[0231] After the second rotation ( Figure 15 (3) The sample processing chamber 2 moves from the second position 202 to the third position 203. The nucleic acid adsorption membrane 9 inside the sample processing chamber 2 also rotates from the second position 902 to the third position 903. Meanwhile, the sample reaction chamber 3 moves from the first position 301 to the second position 302, and the reaction chamber 15 also moves from the first position 1501 to the second position 1502. At this time, the sample reaction chamber 3 and the detection chamber 4 are in fluid communication. That is to say, the reaction chamber 15 of the sample reaction chamber 3 is located above the sample loading port 32 of the detection chamber 4. At the same time, the sample processing chamber 2 is also in fluid communication with the sample reaction chamber 3 and the detection chamber 4. That is to say, the sample inlet channel 8 of the sample processing chamber 2 is located above the reaction chamber 15. The sample inlet channel 8, the through port 12, the reaction chamber 15, and the heating port 32 are arranged vertically in a straight line.

[0232] Understandably, the second rotation involves the simultaneous rotation of the sample processing chamber 2 and the sample reaction chamber 3. As the sample reaction chamber 3 rotates from the first position 301 to the second position 302, it simultaneously drives the sample processing chamber 2 to rotate from the second position 202 to the third position 203. The first position 901 and the second position 902 of the nucleic acid adsorption membrane 9 are relative to the sample reaction chamber 3. During the second rotation, the nucleic acid adsorption membrane 9 and the sample reaction chamber 3 move together, therefore the position of the nucleic acid adsorption membrane 9 relative to the sample reaction chamber 3 remains unchanged. In other words, when the sample reaction chamber 3 rotates relative to the detection chamber 4, the sample processing chamber 2 rotates along with the sample reaction chamber 3, and the nucleic acid adsorption membrane 9 remains above the reaction chamber 15. However, relative to the detection chamber 4, the nucleic acid adsorption membrane 9 also has a third position 903 because after the second rotation, the nucleic acid adsorption membrane 9 and the reaction chamber 15 move together to above the sample application port 32 of the detection chamber 4.

[0233] The second rotation gives the reaction chamber 15 a first position 1501 and a second position 1502. The first position is when the reaction chamber 15 is above the heating hole 33, and the second position is when the reaction chamber 15 is above the sample feeding hole 32. When the second rotating latch 29 is at one end of the second rotating slot 27, the reaction chamber 15 is at the first position 1501. When the second rotating latch 29 moves to the other end of the second rotating slot 27, the reaction chamber 15 is at the second position 1502.

[0234] From the initial position of the nucleic acid detection device 1 until the completion of the first rotation, the reaction chamber 15 remains in the first position 1501 without change, because the first rotation only involves the rotation of the sample processing chamber 2, while the sample reaction chamber 3 remains stationary. During the second rotation, the sample processing chamber 2 and the sample reaction chamber 3 rotate together, causing the reaction chamber 15 to move from above the heating port 33 to above the sample application port 32, thus enabling sample application and detection.

[0235] The second rotation causes the reaction chamber 15, along with the amplification product, to be dripped into the test strip 25 through the sample application hole 32. The amplification product is then dripped into the test strip 25 in a free-fall manner for detection, making it more convenient, flexible, and error-free to use. Therefore, by designing a two-rotation method, it is ensured that each sample or reagent addition reaches the target area in a free-fall manner. Furthermore, the compact and small structural design eliminates the need for additional drainage facilities, thereby improving efficiency and detection sensitivity.

[0236] The nucleic acid detection device 1 provided in this embodiment can complete the detection of nucleic acid samples through two simple selection operations. The first rotation involves holding the nucleic acid detection device 1 with one hand and rotating it by grasping the upper part of the nucleic acid detection device 1 (such as the outer wall of the sample processing chamber 2) with the other hand. This is a rotation of the sample processing chamber 2 relative to the sample reaction chamber 3, where the sample processing chamber 2 rotates alone, while the sample reaction chamber 3 and the detection chamber 4 remain stationary. The second rotation involves holding the nucleic acid detection device 1 with one hand and rotating it by grasping the middle part (such as the outer wall of the sample reaction chamber 3) or the upper part of the nucleic acid detection device 1 with the other hand. This is a rotation of the sample reaction chamber 3 relative to the detection chamber 4, where the sample processing chamber 2 and the sample reaction chamber 3 rotate together, while the detection chamber 4 remains stationary. Since it is impossible to continue rotating after the first rotation, the order of the two rotations will not be confused, and there will be no operational errors.

[0237] Example 3: Nucleic acid detection system provided by the present invention

[0238] The nucleic acid detection system provided in this embodiment includes the nucleic acid detection device as provided in Example 1 and the nucleic acid detection reagents used in conjunction with it. The nucleic acid detection reagents include lysis buffer, elution buffer, and nucleic acid amplification reaction reagents; the nucleic acid adsorption membrane in the nucleic acid detection device is a polysiloxane silica membrane (Shenzhen DouDian Biotechnology Co., Ltd., Y-SM-BC-1).

[0239] 1. Preparation of lysis buffer

[0240] The lysis buffer formulation is: 0.1M tris(hydroxymethyl)aminomethane, 0.2M ethylenediaminetetraacetic acid, 3M guanidine isothiocyanate, and 5% Triton 100.

[0241] Triton-100 5% Tris-HCl 50mmol NaOH 50mmol

[0242] Take 2 ml of lysis buffer and pre-fill it into a reagent bottle. The size of the reagent bottle opening should match the size of the sample inlet of the nucleic acid detection device (the sample inlet does not have a cap) so that it can be sealed.

[0243] 2. Preparation of nucleic acid amplification reaction reagents

[0244] In this embodiment, fixed and dried nucleic acid amplification reaction reagents are pre-placed in the nucleic acid detection device. There are two main types: (1) immobilized reaction membrane or (2) dried reagent.

[0245] (1) Immobilized reaction membrane: glass fiber membrane (model 8860), including a first reaction membrane and a second reaction membrane, with a diameter of 6 mm and a thickness of 1 mm.

[0246] Preparation of the first reaction membrane:

[0247] Preparation of the first reaction solution: 30mM tris(hydroxymethyl)aminomethane-acetic acid buffer pH 8.0, 50mM potassium acetate, 3mM dithiothreitol, 2mM ATP, 20mM creatine phosphate, 100ng / μl creatine kinase, 600ng / μl E. coli SSB protein, 150ng / μl bacteriophage uvsX protein, 25ng / μl bacteriophage uvsY protein, 80ng / μl Klenow polymerase large fragment (exo-), 50ng / μl exonuclease III, 200U reverse transcriptase, 450μM dNTP, 420nM per upstream primer, 420nM per downstream primer, 120nM per fluorescent probe.

[0248] Take 0.02 ml of the first reaction solution, fix it onto the first reaction membrane, and dry it at 50°C.

[0249] Preparation of the second reaction membrane:

[0250] Prepare the second reaction solution: 5% polyethylene glycol (molecular weight 20000), 0.28M magnesium acetate.

[0251] Take 0.02 ml of the second reaction solution, fix it onto the second reaction membrane, and dry it at 50°C.

[0252] (2) Drying reagents: including first drying reagent and second drying reagent

[0253] The first drying reagent contains the following components; the second drying reagent contains the following components.

[0254] A method for pre-preparing the first and second drying reagents in a reaction chamber: A reagent containing [reagent name] and a reagent containing [reagent name] are respectively placed on both sides of the partition at the bottom of the reaction chamber. After drying or lyophilization, a nucleic acid detection device pre-loaded with the first drying reagent (first reaction solution) and the second drying reagent (second reaction solution) is obtained.

[0255] 3. Preparation of eluent

[0256] Elution buffer formulation: 0.01M tris(hydroxymethyl)aminomethane, 0.001M ethylenediaminetetraacetic acid, 0.28M magnesium acetate.

[0257] Take 0.06 ml of eluent and pre-fill it into a reagent bottle. The sample inlet of the nucleic acid detection device does not have a cap; the reagent bottle opening and the sample inlet can be sealed together. When adding eluent using the reagent bottle, the bottle opening can be directly screwed onto the sample inlet and not removed again. Figure 16 It plays a sealing and anti-contamination role during nucleic acid amplification and detection, and is also disposed of as biological waste after testing to prevent biological contamination.

[0258] This embodiment uses a nucleic acid detection system for nucleic acid detection. The fixed and dried nucleic acid amplification reaction reagents are prepared using a first reaction membrane and a second reaction membrane. The first reaction membrane is laid flat at the bottom of the reaction chamber, and the second reaction membrane is located in the center of the reaction chamber, vertically placed above the first reaction membrane. The detection process includes the following steps:

[0259] (1) Add 2 ml of lysis buffer to 0.2 ml of sample to complete sample lysis;

[0260] (2) Add 0.5 ml of the lysed sample through the sample dispensing port;

[0261] (3) Complete the first rotation of the nucleic acid detection device;

[0262] (4) Add 0.06 ml of elution buffer through the sample addition port;

[0263] (5) Start the constant temperature heating device to perform nucleic acid isothermal amplification at the specified temperature and time.

[0264] (6) Complete the second rotation of the nucleic acid detection device;

[0265] (7) Read the test results from the observation window on the top of the test strip.

[0266] Example 4: The Influence of Curing or Air-Drying Process on Test Results

[0267] This embodiment uses the nucleic acid detection system provided in Example 3 for detection. The target nucleic acid to be tested is feline herpesvirus FHV-R, and the sample to be tested is a pharyngeal swab sample of 2 copies / uL. The amplification conditions are 42℃ for 12 min. The standard colorimetric card is used to interpret the test results (see [link]). Figure 17 Compare them.

[0268] The primers used in this embodiment are:

[0269] Upstream primer FHV-F: CTATGTTTCTTATGGATATGAGACTTTGTGAT

[0270] Downstream primer FHV-R: BIO-ATAGTTTTAACATTTCGACACCATTCATGTAG

[0271] Probe FHV-P2:

[0272] FAM-CGGTCGCCTTCATATTGGTTGGAACCTTTAAC(THF)AAGTATATGTTCCTAACAG-C3spacer

[0273] 1. Curing process and effect verification

[0274] To facilitate storage and production operations, liquid reagents (such as the first and second reaction solutions described in Example 3, 0.02 ml each) were added to 6 mm diameter glass fiber discs using a pipette and dried at 37°C and 10% humidity for 2 hours to obtain cured reagents. The results of simultaneous comparative testing of the liquid and cured reagents are shown in Table 1.

[0275] Table 1. Verification of Curing Process Effect

[0276]

[0277] As can be seen from Table 1, the detection results are similar when using solidified reagents and liquid reagents, with no significant difference. In fact, the average detection sensitivity of solidified reagents is slightly higher than that of ordinary liquid reagents.

[0278] 2. Air-drying process and effect verification

[0279] The preparation method of the air-dried reagent is as follows: the liquid reagent is added to a specific container without any other carrier, and dried at 37°C and 10% humidity for 4 hours. After that, it is removed from the container and is in sheet form. The test results of the liquid reagent, the curing reagent and the air-dried reagent are compared simultaneously. The test results are shown in Table 2.

[0280] Table 2. Verification of the effect of air drying process

[0281] liquid reagents Curing reagent Air-dried reagents <![CDATA[FPV plasmid 10 -5 ng / uL]]> G7 G7.5 G7.5 <![CDATA[FPV plasmid 10 -5 ng / uL]]> G6.5 G7.5 G7.5 Negative 0 0 0

[0282] As shown in Table 2, there was no significant difference in the detection results when using air-dried reagent, curing reagent, and liquid reagent. In fact, the average detection sensitivity of curing reagent and air-dried reagent was slightly higher than that of ordinary liquid reagent.

[0283] In summary, the nucleic acid testing system can completely replace the method of adding liquid reagents on the spot by pre-placing solidified reagents or air-dried reagents, making the testing process more convenient.

[0284] Example 5: The effect of the curing method of PEG and other reagents in the nucleic acid amplification reaction reagent on the detection results.

[0285] To achieve good amplification results, PEG needs to be added to the reaction reagent. The preferred molecular weight of PEG is 20,000-40,000. In this embodiment, the molecular weight of PEG used is 20,000 (Order NO. A601790 CAS: [25322-68-3], Sangon Biotech (Shanghai) Co., Ltd.). The curing process is as follows: 0.02 ml of liquid reagent is added to a glass fiber disc with a diameter of 6 mm and a thickness of 1 mm using a pipette, and dried at 37°C and 10% humidity for 2 hours to obtain the cured reagent. In this embodiment, the following four curing methods are used in the process of curing nucleic acid amplification reaction reagent: 1. Fully mixed curing (only one reaction membrane); 2. Curing primers, probes and enzymes together (first reaction membrane), curing PEG alone (second reaction membrane); 3. Curing primers, probes and PEG together (first reaction membrane), curing enzyme alone (second reaction membrane); 4. Curing enzymes and PEG together (first reaction membrane), curing primers, probes alone (second reaction membrane). The nucleic acid detection system provided in Example 3 was used for detection. The target nucleic acid to be tested was feline herpesvirus FHV-R. The sample to be tested was a pharyngeal swab sample of 2 copies / µL. The amplification conditions were 42℃ for 12 min. The standard colorimetric card was used to interpret the test results (see Example 3). Figure 17 The effects of four curing methods on the test results were compared. The results are shown in Table 3.

[0286] Table 3. The Influence of Curing Methods of PEG and Other Reagents on Test Results

[0287]

[0288] As shown in Table 3, PEG needs to be separated from other reaction reagents during the curing or drying process. This is likely because PEG shrinks and encapsulates enzymes or primers / probes during curing, and its activity is difficult to restore after reconstitution, thus preventing the nucleic acid isothermal amplification reaction from proceeding normally. Therefore, PEG needs to be cured separately.

[0289] Example 6: Selection of Nucleic Acid Adsorption Membrane

[0290] This embodiment uses the nucleic acid detection system provided in Example 3 for detection. The nucleic acid adsorption membrane in the nucleic acid detection device is made of different membrane materials as shown in Table 4. The target nucleic acid to be tested is feline herpesvirus FHV-R, and the sample to be tested is a pharyngeal swab sample of 2 copies / uL. The amplification conditions are 42℃ for 12 min. The standard colorimetric card is used to interpret the test results (see Table 4). Figure 17 The permeation time, water content, and adsorption capacity of different nucleic acid adsorption membranes were compared. The methods for detecting permeation time, water content, and adsorption capacity were as follows: [method not specified], [method not specified], and [method not specified]. The results are shown in Table 4.

[0291] Table 4. Selection of Nucleic Acid Adsorption Membranes

[0292]

[0293] As shown in Table 4, there are significant differences in permeation time among different membrane materials. Since the sample passes directly through the nucleic acid adsorption membrane from above when using the nucleic acid detection device provided by this invention, the shorter the permeation time of the membrane material, the faster it can absorb the nucleic acid in the sample. Therefore, GF / C silica membrane or silica gel membrane is preferred because these two types of membranes have small pore size, fast flow rate, low water content, and good adsorption effect, making them particularly suitable as nucleic acid adsorption membranes. Among them, the GF / C silica membrane has a shorter permeation time, while the silica gel membrane has better adsorption capacity (the lower the adsorption capacity value, the better the adsorption capacity).

[0294] Example 7: Verification of Nucleic Acid Adsorption Membrane Enrichment Efficiency

[0295] In this embodiment, a silica gel membrane was selected as the nucleic acid adsorption membrane. The nucleic acid detection results after adsorption by the membrane were examined as the sample volume increased, thereby determining the enrichment efficiency of the nucleic acid adsorption membrane. The target nucleic acid to be tested was feline herpesvirus FHV-R, and the sample to be tested was a pharyngeal swab sample of 2 copies / uL. The amplification conditions were 42℃ for 12 min. The detection methods were PCR fluorescence detection or product test strip detection, and the results are shown in Table 5.

[0296] Table 5. Verification of nucleic acid adsorption membrane enrichment efficiency

[0297]

[0298] As shown in Table 5, with the increase of sample volume, both the fluorescence Ct value and the band depth of the colloidal gold test strip are significantly improved, indicating that the silica membrane has a good nucleic acid enrichment effect.

[0299] Example 8: Effect of different lysis buffers on detection results

[0300] This embodiment uses the nucleic acid detection system provided in Example 3. Different lysis buffers were used to investigate the effect of different lysis buffers on the nucleic acid detection results. The target nucleic acid to be tested was feline herpesvirus FHV-R, and the sample to be tested was a pharyngeal swab sample of 2 copies / uL. The amplification conditions were 42℃ for 12 min. The detection results are shown in Table 6.

[0301] Table 6. Effects of different lysis buffers on detection results

[0302] Serial Number lysis buffer formulation Test results 1 Tris + ethylenediaminetetraacetic acid + guanidine isothiocyanate G3 2 Tris + Guanidine isothiocyanate + Tween 20 + NaCl G4 3 Tris + Guanidine isothiocyanate + Tween 20 G5 4 Tris + EDTA + Guanidine isothiocyanate + Tween 20 G6 5 Tris + EDTA + guanidine isothiocyanate + Triton 100 G8

[0303] As shown in Table 6, different lysis buffers have a significant impact on the detection results. This is because some lysis buffers can adversely affect the isothermal amplification reaction after entering the nucleic acid amplification reaction chamber. However, the lysis buffer provided by this invention will not adversely affect the nucleic acid amplification reaction. Therefore, after the nucleic acid in the sample is adsorbed by the nucleic acid adsorption membrane, there is no need to add a cleaning agent to rinse it. The target nucleic acid can be eluted with the elution buffer and enter the isothermal amplification reaction. This is particularly suitable for the nucleic acid detection device provided by this invention.

[0304] Example 9: Effect of different eluents on detection results

[0305] This embodiment uses the nucleic acid detection system provided in Example 3. Different elution buffers were used to investigate the effect of different elution buffers on the nucleic acid detection results. The target nucleic acid to be tested was feline herpesvirus FHV-R, and the sample to be tested was a pharyngeal swab sample with 2 copies / uL. The amplification conditions were 42℃ for 12 min. The detection results are shown in Table 7.

[0306] Table 7. Effects of different eluents on detection results

[0307] Serial Number Elution solution formulation Test results 1 Tris Not detected 2 EDTA-1,5-diaminetetraacetic acid Not detected 3 Magnesium acetate Not detected 4 Tris + ethylenediaminetetraacetic acid G5 5 Tris + ethylenediaminetetraacetic acid + magnesium acetate G8

[0308] As can be seen from Table 7, different elution solutions have a significant impact on the detection results. This is because after the nucleic acid in the nucleic acid adsorption membrane is eluted by the elution solution, it needs to enter the reaction chamber and be mixed with the nucleic acid amplification reaction immobilization reagent for isothermal amplification reaction. It is necessary to select an elution solution that will not have an adverse effect on the isothermal amplification reaction of nucleic acid, or even effectively promote the isothermal amplification reaction of nucleic acid, for use in the nucleic acid detection device provided by the present invention. Therefore, the elution solution in group 5 is preferred.

[0309] Example 10: Effect of different drainage channel widths and numbers on nucleic acid detection sensitivity

[0310] This embodiment uses the nucleic acid detection device provided in Example 1 and combines it with nucleic acid detection reagents for nucleic acid detection. The width and number of the drainage channels constituting the drainage groove are shown in Table 8. The nucleic acid detection sensitivity under different settings was tested. The target nucleic acid to be tested was feline herpesvirus FHV-R, and the sample to be tested was a pharyngeal swab sample of 2 copies / uL. The amplification conditions were 42℃ for 12 min. The detection results are shown in Table 8.

[0311] Table 8. Effects of different drainage channel widths and numbers on nucleic acid detection sensitivity.

[0312]

[0313] As shown in Table 8, the sensitivity of nucleic acid detection increases significantly with the reduction of the drainage channel width. However, the increase in sensitivity slows down significantly after the drainage channel width is reduced to 0.3 mm. This indicates that the effect of further reducing the drainage channel width to improve sensitivity is very limited. At the same time, the smaller the drainage channel width, the more difficult the manufacturing process becomes and the higher the cost. Therefore, the preferred drainage channel width is 0.3-0.7 mm, and the most preferred is 0.5 mm.

[0314] Meanwhile, the number of drainage channels also has a certain impact on the sensitivity of nucleic acid detection. When the width of the drainage channel is not less than 0.5 mm, increasing the number of drainage channels can further improve the sensitivity of nucleic acid detection. However, when the width of the drainage channel is less than 0.5 mm, increasing the number of drainage channels does not have a significant effect on improving the sensitivity of nucleic acid detection. Therefore, considering the ease of manufacturing and cost, it is preferable to use a drainage channel width of 0.5 mm and a number of 13 drainage channels.

[0315] Example 11: The Influence of Sample Injection Channel Height on Detection Results

[0316] This embodiment uses the nucleic acid detection system provided in Example 3. The height of the sample injection channel in the nucleic acid detection device was selected to investigate the effect of different sample injection channel heights on the detection results. The target nucleic acid to be tested was feline herpesvirus FHV-R, and the sample to be tested was a pharyngeal swab sample of 2 copies / µL. The amplification conditions were 42℃ for 12 min. The detection results are shown in Table 9.

[0317] Table 9. Influence of Sample Injection Channel Height on Detection Results

[0318] Serial Number Sample inlet channel height (mm) Number of detections / Number of tests 1 11 17 / 20 2 15 19 / 20 3 19 20 / 20 4 23 20 / 20 5 27 20 / 20

[0319] As shown in Table 9, different injection channel heights directly affect the nucleic acid detection results in the sample. This may be because different injection channel heights affect the adsorption effect of the sample by the nucleic acid adsorption membrane. When the sample enters from the injection port, it is accelerated by the injection channel at a certain height and can impact the nucleic acid adsorption membrane with greater force, thereby promoting the nucleic acid adsorption membrane to adsorb the nucleic acid in the sample more fully and improving the nucleic acid detection sensitivity. Therefore, an injection channel with a height of 19 mm is preferred.

[0320] Example 12: The Influence of the Placement of the First and Second Reaction Membranes on the Detection Results

[0321] This embodiment uses the nucleic acid detection system provided in Example 3. The nucleic acid amplification reaction reagents are prepared by pre-positioning a first reaction membrane and a second reaction membrane. There are three possible placement methods for the first and second reaction membranes: 1. The second reaction membrane is placed horizontally above the first reaction membrane; 2. The second reaction membrane is placed vertically above the first reaction membrane; 3. The first and second reaction membranes are placed vertically. The nucleic acid detection sensitivity under different membrane placement methods was tested. The target nucleic acid was feline herpesvirus FHV-R, and the sample was a pharyngeal swab sample of 2 copies / µL. The amplification conditions were 42℃ for 12 min. The detection results are shown in Table 10.

[0322] Table 10. Effects of different membrane placement methods on nucleic acid detection sensitivity

[0323] Serial Number Placement Number of detections / Number of tests 1 The first and second reaction membranes are placed horizontally. 17 / 20 2 The first reaction membrane is placed horizontally, and the second reaction membrane is placed vertically above the first reaction membrane. 20 / 20 3 The first and second reaction membranes are placed vertically. 16 / 20

[0324] As can be seen from Table 10, the second placement method, in which the first reaction membrane is placed horizontally and the second reaction membrane is placed vertically above the first reaction membrane, can significantly improve the sensitivity of nucleic acid detection. This may be because the second reaction membrane can also play a certain role in drainage and improve the mixing effect of reagents in the first and second reaction membranes. Therefore, the placement method in which the second reaction membrane is placed vertically above the first reaction membrane is preferred.

[0325] The nucleic acid detection system provided in this embodiment can be used for on-site testing, testing in places such as small clinics and pet stores, and can be used for nucleic acid detection of pathogens; it can be used for nucleic acid detection of pet pathogens, livestock pathogens, plant pathogens or food pathogens.

[0326] Matters not covered in this invention are common knowledge. While this invention has been disclosed above, it is not limited thereto. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of this invention; therefore, the scope of protection of this invention should be determined by the scope defined in the claims.

Claims

1. A detection device, characterized in that, include: A cavity used for processing samples; A chamber used for sample reaction, in which the reaction products of the sample are obtained; and Detection chamber used to detect reaction products; The cavity for processing the sample has a first position, a second position, and a third position; The chamber for sample reaction has a first position and a second position; When the sample processing chamber and the sample reaction chamber are in the first position, the sample processing chamber, the sample reaction chamber, and the detection chamber are not fluidly connected to each other. The sample processing chamber, the sample reaction chamber, and the detection chamber are arranged sequentially from top to bottom; the sample processing chamber and the sample reaction chamber can be rotated to change their positions. It includes two rotations; the first rotation moves the sample processing chamber from a first position to a second position, while the sample reaction chamber and the detection chamber remain stationary; after the first rotation, the sample processing chamber and the sample reaction chamber are in fluid communication, while the sample reaction chamber is not in fluid communication with the detection chamber. The second rotation moves the sample processing chamber from the second position to the third position, while the sample reaction chamber moves from the first position to the second position. After the second rotation is completed, the sample processing chamber, the sample reaction chamber, and the detection chamber are in fluid communication. The cavity for processing samples is provided with an inlet, and an inlet channel is connected below the inlet. A nucleic acid adsorption membrane is fixed at the bottom of the inlet channel. The nucleic acid adsorption membrane is used to adsorb nucleic acids in the sample. The sample reaction chamber is equipped with a reaction chamber and a filter paper storage tank; the filter paper storage tank is filled with filter paper for adsorbing excess sample; the reaction chamber is equipped with a nucleic acid amplification reaction membrane or a fixed nucleic acid amplification reaction drying reagent; the detection chamber is equipped with a sample application hole, and the reaction product enters the transverse flow test strip through the sample application hole to start the detection. When the sample processing chamber, the sample reaction chamber, and the detection chamber are not connected, the sample inlet of the sample processing chamber is vertically connected to the filter paper storage tank; when the sample processing chamber and the sample reaction chamber are connected, the sample inlet of the sample processing chamber is vertically connected to the reaction chamber of the sample reaction chamber; when the sample processing chamber, the sample reaction chamber, and the detection chamber are all connected, the sample inlet of the sample processing chamber, the reaction chamber of the sample reaction chamber, and the sample dispensing port of the detection chamber are all vertically connected.

2. The detection device as described in claim 1, characterized in that, The sample processing chamber is used to extract nucleic acid substances from the sample.

3. The detection device as described in claim 2, characterized in that, The chamber for sample reaction is used for the amplification of nucleic acid substances to generate amplification products.

4. The detection device as described in claim 3, characterized in that, The detection chamber is used to detect the quantity of amplification products or the presence of amplification products.

5. The detection device as described in claim 4, characterized in that, The chamber for the sample reaction includes reagents for nucleic acid amplification, wherein the reagents are present in a dry state.

6. The detection device as described in claim 5, characterized in that, The detection chamber includes a transverse flow test strip, which is used to detect the quantity of amplification products or the presence of amplification products.

7. The detection device as described in claim 6, characterized in that, The outer wall of the sample processing chamber is provided with a first rotating buckle, and the side wall of the sample reaction chamber is provided with a hollowed-out first rotating slot. When rotated for the first time, the first rotating buckle moves from one end of the first rotating slot to the other end. The number of the first rotating buckle and the first rotating slot is more than one.

8. The detection device as described in claim 7, characterized in that, The detection chamber sidewall is provided with a hollowed-out second rotating slot; the outer wall of the sample reaction chamber is provided with a second rotating buckle. When rotated for the second time, the second rotating buckle moves from one end of the second rotating slot to the other end. The number of the second rotating buckle and the second rotating slot is more than one.

9. The detection device as described in claim 8, characterized in that, The bottom of the detection chamber is provided with a heating hole, which is used to provide a heat source for the nucleic acid amplification reaction in the sample reaction chamber.

Images