Decacovirus nucleic acid detection composition based on rt-rpa and crispr / cas13a technology and application thereof

Abstract

This invention relates to the field of biotechnology, specifically disclosing a Decacovirus nucleic acid detection composition based on RT-RPA and CRISPR / Cas13a technologies and its applications. This invention successfully obtains a novel method for Decacovirus nucleic acid detection based on RT-RPA and CRISPR / Cas13a technologies. The nucleic acid detection composition includes: an RT-RPA primer pair and crRNA; the RT-RPA primer pair consists of two RT-RPA primers, with sequences shown in SEQ ID NO.1 and SEQ ID NO.2; the crRNA sequence consists of an anchoring sequence for binding to the Cas13a protein and a guide sequence targeting the Decacovirus gene target sequence, with the guide sequence shown in positions 23-50 of SEQ ID NO.3. Using this composition for Decacovirus detection offers advantages such as high specificity, high sensitivity, rapid and convenient operation, solving the problem of inconvenience in current field monitoring of the virus's prevalence.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to a Decacovirus nucleic acid detection composition based on RT-RPA and CRISPR / Cas13a technologies and its application. Background Technology

[0002] Decacovirus is classified by the International Committee on Taxonomy of Viruses (ICTV) as belonging to the order Nematovirales, family Coronaviridae, subfamily Orthocoronaviruses, and genus Alphacoronavirus. It is a subgenus containing four known viral species: HKU10, CHB25, Hub2013, and WA3607, as well as some published but unidentified viral sequences. Decacovirus has a wide geographical distribution, with currently published sequences originating from Asia, Africa, the Americas, and Oceania. This broad geographical distribution provides potential for its evolution and cross-species transmission. Furthermore, Decacovirus exists in various bat species, including horseshoe bats and horseshoe bats. There have been reports of this subgenus of virus being detected in miniature horses, and some studies have even detected antibodies to this subgenus of virus in serological surveys of residents near bat caves, indicating a high risk of cross-species transmission. Therefore, there is an urgent need to establish detection methods for the coronavirus Decacovirus to provide tools for investigating the field prevalence of this subgenus of coronaviruses and assessing its risk of cross-species transmission.

[0003] Currently, the detection methods for the coronavirus Decacovirus are limited to serological testing. However, serological testing is typically used in epidemiological surveys or tracing of infection history in groups, and it has drawbacks such as high sampling requirements, low sensitivity, and high cost, which limits its application in field monitoring and early warning of the virus.

[0004] In recent years, nucleic acid detection based on CRISPR / Cas13a technology has demonstrated advantages such as rapid detection speed, high sensitivity, and strong specificity, making it suitable for large-scale, rapid, and direct detection of viruses. Utilizing the incidental cleavage activity of the Cas13a protein, combined with recombinase polymerase amplification (RPA) technology, it can specifically recognize target DNA or RNA sequences. Compared to traditional real-time quantitative PCR, this detection method offers higher accuracy and significantly reduces cost and time, making it ideal for use in resource-scarce environments and showing great promise for early detection of infectious diseases and pathogen surveillance.

[0005] There are already solutions for using this technology to detect the novel coronavirus and porcine epidemic diarrhea virus. However, the novel coronavirus and porcine epidemic diarrhea virus are still genetically distant from Decacovirus. Even if there is an incentive to apply this technology to the detection of the coronavirus Decacovirus subgenus, it is still necessary to explore from scratch in order to find a solution with ideal detection results. Summary of the Invention

[0006] One of the objectives of this invention is to provide a composition for rapid, simple, highly sensitive, and highly specific nucleic acid detection of Decacovirus.

[0007] This invention provides a Decacovirus nucleic acid detection composition comprising: an RT-RPA primer pair and crRNA; The RT-RPA primer pair consists of two RT-RPA primers, the sequences of which are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. The crRNA sequence consists of an anchoring sequence for binding to the Cas13a protein and a guide sequence for targeting the Decacovirus gene target sequence, as shown in positions 23-50 of SEQ ID No. 3.

[0008] This invention reveals that current detection methods for the coronavirus Decacovirus primarily rely on serological assays, which are demanding in terms of sample quality, have low sensitivity, and are costly, making them unsuitable for monitoring viral outbreaks in the field. While developing RT-qPCR-based nucleic acid detection technology for Decacovirus detection allows for real-time fluorescence quantification of nucleic acid samples using a pair of quantitative primers, achieving good sensitivity and accuracy, it is prone to false positives. Non-specific primer amplification or the presence of primer dimers can also lead to amplification signals, resulting in misinterpretations. Furthermore, it requires a fluorescence quantitative instrument, which is costly. Applying CRISPR / Cas13a technology to Decacovirus nucleic acid detection holds promise for achieving high-throughput, simple, rapid, sensitive, and specific detection of the virus, thus providing a better option for its detection and monitoring.

[0009] However, current technologies only offer detection schemes based on RT-RPA and CRISPR / Cas13a for other coronaviruses (such as the novel coronavirus and porcine epidemic diarrhea virus). These schemes have significant homology differences with Decacovirus subgenus viruses and do not provide sufficient guidance on how to design primer / probe combinations for new detection targets. Furthermore, developing detection compositions for new Decacovirus subgenus viruses presents the following technical challenges: 1) The composition of the present invention combines RT-RPA and CRISPR / Cas13a technologies. According to the design principle, the part of the target sequence that needs to be targeted, namely the RT-RPA primer and crRNA, is relatively long, both exceeding 28 bases. Although this can ensure extremely high specificity, it is still difficult to find a perfect conserved region that meets the length requirement in all four viral species at the Decacovirus subgenus level. 2) The Decacovirus subgenus contains sequences of 4 viral species and other undetermined species. The whole genome similarity of the entire subgenus is only 58.3%-73.2%, which is low. It is difficult to find a conserved region that meets the detection length. After sequence alignment and repeated analysis, only a conserved segment of about 130 bases was found in the Nsp16 region of the genome. This invention specifically adjusts this conserved segment and designs a detection composition to ensure that the crRNA has a maximum of 1 base mismatch and the RT-RPA primer has a maximum of 3 base mismatches while ensuring sequence recognition and amplification functions. The composition can have high sensitivity and specificity. 3) The reason for the unique conservation of the Nsp16 gene in Decacovirus remains to be studied. New Decacovirus sequences will continue to be discovered and updated in the future, which poses a challenge to the stability or persistence of detection methods. However, the detection composition of this invention targets the conserved Nsp16 gene. Even if new sequences are continuously added, it can maintain detection specificity and broad spectrum by making minor adjustments or introducing degenerate bases based on the original composition. In the embodiments of this invention, the composition of this invention detected three new Decacovirus sequences of undetermined species and still had detection signals. It can be seen that the Nsp16 gene segment targeted by the composition of this invention is highly conserved. At present, its detection effect will not be greatly reduced with the emergence of new sequences, which is non-obvious.

[0010] This invention ultimately designed a set of broad-spectrum nucleic acid detection compositions for Decacovirus based on RT-RPA and CRISPR / Cas13a technologies. These compositions can be used for nucleic acid detection of this subgenus and have the advantages of on-site detection, high speed, low cost, high specificity, and high sensitivity. They overcome the technical limitations of serological detection and allow the establishment of nucleic acid detection methods for Decacovirus using commercial reagents, which is conducive to widespread application.

[0011] The anchoring sequence in the crRNA sequence of this invention for binding to the Cas13a protein can be determined based on the type of Cas13a protein used in the detection and common knowledge in the art. Preferably, in the Decacovirus nucleic acid detection composition of this invention, the nucleotide sequence of the crRNA is as shown in SEQ ID No. 3.

[0012] The present invention also provides a kit for detecting Decacovirus, which includes the above-described Decacovirus nucleic acid detection composition.

[0013] The kit for detecting Decacovirus of the present invention further includes an RNA reporter probe labeled with a fluorescent group and a Cas13a protein, preferably an LwaCas13a protein; And / or, the kit further includes one or more of the following: buffer, RNA reverse transcriptase, RNase inhibitor, RNase-free water, magnesium salt, NTP, and T7 RNA polymerase; Preferably, the buffer solution is TwistAmp Rehydration Buffer (for RT-RPA reaction) and / or HEPES (for CRISPR / Cas13a detection). Preferably, the magnesium salt is magnesium acetate (for RT-RPA reaction) and / or MgCl2 (for CRISPR / Cas13a detection).

[0014] The RNA reporter probe of the present invention is an RNA molecule with signal reporting function. When the RNA molecule is degraded, it can report a positive signal and be detected.

[0015] Those skilled in the art can select RNA reporter probes based on common knowledge in the field.

[0016] For example, the RNA reporter probe used in various embodiments of the present invention is: / 5FAM / T A rArUG C / 3BHQ1 / (results are interpreted by reading fluorescence using a microplate reader) and / 5FAM / T A rArUG C / 3Biotin / (results are interpreted using lateral chromatography test strips), where... The nucleotides represent phosphate thioester bonds, rA and rU represent ribonucleotides (rNTPs), and the other four nucleotides are deoxyribonucleotides (dNTPs).

[0017] The various reagent components of the kit of the present invention may be present in separate containers, or may be pre-assembled into a reagent mixture in whole or in part.

[0018] The present invention also provides RT-RPA primer pairs for detecting Decacovirus, as described above.

[0019] The present invention also provides a crRNA for detecting Decacovirus, as described above.

[0020] The present invention also provides a method for detecting Decacovirus for purposes other than disease diagnosis or treatment, comprising the following steps: 1) Extract RNA from the sample to be tested; 2) RT-RPA reaction: Using the RNA as a template, reverse transcription and isothermal amplification were performed using RT-RPA primer pairs to obtain the RT-RPA product; The RT-RPA primer pair is as described above; 3) CRISPR / Cas13a detection: The RT-RPA products were detected using the CRISPR / Cas13a detection system; The CRISPR / Cas13a detection system includes crRNA, as described above.

[0021] In the method for detecting Decacovirus of the present invention, the reaction system of the RT-RPA reaction further includes buffer, RNA reverse transcriptase, RNase inhibitor, RNase-free water and magnesium salt; Preferably, the buffer solution is a TwistAmp Rehydration Buffer; Preferably, the magnesium salt is magnesium acetate.

[0022] In the method for detecting Decacovirus of the present invention, the CRISPR / Cas13a detection system further includes Cas13a protein, RNA reporter probe labeled with fluorescent group, NTP, T7 RNA polymerase, RNase inhibitor, magnesium salt and buffer. Preferably, the Cas13a protein is the LwaCas13a protein; Preferably, the magnesium salt is MgCl2; Preferably, the buffer solution is HEPES.

[0023] The components used in the reaction / detection system of this invention can be derived from commercially available reagent kits.

[0024] As a preferred embodiment, the RT-RPA reaction system comprises: SEQ ID NO.1 (10 µM) 2.4 μL, SEQ ID NO.2 (10 µM) 2.4 μL, TwistAmp Rehydration Buffer 29.5 μL, M-MLV RT (200 U / μL) 1 μL, RNase Inhibitor (40 U / μL) 1 μL, Nuclease-free water 3.7 μL, RNA template 4 μL, and TwistAmpmagnesium acetate (280 mM) 2.5 μL.

[0025] The CRISPR / Cas13a detection system includes: 68.85 μL of nuclease-free water, 2 μL of HEPES (pH 6.8, 1M), 0.9 μL of MgCl2 (1M), 4 μL of rNTP solution mix (25 mM), 0.5 μL of LwaCas13a (C2c2) Nuclease (10 μM), 5 μL of Murine RNase inhibitor (40 U / μL), 2.5 μL of T7 RNA polymerase (5 U / μL), 6.25 μL of RNA reporter probe (2 μM), and 5 μL of SEQ ID NO.3 (20 ng / μL).

[0026] In the method for detecting Decacovirus of the present invention, the reaction conditions for the RT-RPA reaction are: 37-42℃, 10-15 min; And / or, the CRISPR / Cas13a detection temperature is 37°C; if the detection result shows an increase in fluorescence value that is 5 times or more than the fluorescence value of the negative sample, then the sample to be tested is determined to contain the target amplification sequence, and the negative sample is RNase-free water.

[0027] Preferably, the fluorescence intensity value is read every 5 minutes, and the fluorescence signal is monitored for 1-1.5 hours.

[0028] This invention obtains the detection result by comparing the fluorescence intensity values ​​of the experimental group and the negative control within the same detection time. If the fluorescence intensity value of the experimental group is 5 times or more than that of the negative control, it is judged as a positive result (positive signal).

[0029] Furthermore, the presence or absence of a positive signal determines whether the sample to be tested contains the Decacovirus gene, and / or the strength of the positive signal determines the concentration of the Decacovirus gene in the sample to be tested. (1) If there is a positive signal, it is determined that the sample to be tested contains the Decacovirus gene; if there is no positive signal, it is determined that the sample to be tested does not contain the Decacovirus gene. (2) The stronger the positive signal, the higher the content of the Decacovirus gene in the sample to be tested; the weaker the positive signal, the lower the content of the Decacovirus gene in the sample to be tested.

[0030] The sample to be tested may be viral fluid, nasopharyngeal swab, oropharyngeal swab, sputum, feces, or environmental samples (such as object surfaces, air aerosols, sewage, etc.).

[0031] This invention also provides any one of the following applications of the above-described Decacovirus nucleic acid detection composition or kit, or RT-RPA primer pair or crRNA: 1) Application in detecting Decacovirus for purposes other than disease diagnosis or treatment; 2) Application in the preparation of products for detecting Decacovirus.

[0032] In this invention, the product used for detecting Decacovirus may be a Decacovirus detection kit, or the product used for detecting Decacovirus may include one or more of the following: Decacovirus detection kit, sample collection component, operating instructions, sample processing and reaction equipment (e.g., constant temperature incubator, fluorescence reader, etc.), and general consumables (e.g., sterile, nuclease-free micropipette tips, pipettes, reaction tubes, 96-well plates, etc.).

[0033] The purpose of the above-described applications and methods of the present invention may be for disease diagnosis, disease prognosis and / or disease treatment, and their purpose may also be non-disease diagnosis, non-disease prognosis and non-disease treatment.

[0034] The detection method of the present invention, which is not for disease diagnosis or treatment purposes, can be used to detect Decacovirus genes in the environment (public health surveillance), or to be used in the efficacy evaluation of products for treating Decacovirus (such as drug screening or treatment effect evaluation), and can also be used for the epidemiological investigation of Decacovirus.

[0035] The beneficial effects of this invention are at least as follows: This invention successfully developed a novel nucleic acid detection method for Decacovirus based on RT-RPA and CRISPR / Cas13a detection technologies. This method can fully utilize the incidental cleavage function of the Cas13a protein, giving Decacovirus nucleic acid detection advantages such as high specificity, high sensitivity, speed and simplicity. It solves the problem of inconvenience in monitoring the prevalence of Decacovirus in the field and fills the gap in efficient, simple and low-cost detection of Decacovirus.

[0036] Specifically, the Decacovirus detection method of the present invention has the following advantages: (1) Fast speed: The isothermal amplification stage can be completed in 10-15 minutes, and CRIPSR / Cas13a detection can be performed immediately afterwards. Fluorescent signals can generally be seen after 15-20 minutes of reaction. Compared with traditional detection methods, the total detection time of this method is greatly shortened, and it can be completed in less than 1 hour.

[0037] (2) High specificity: crRNA (SEQ ID NO.3) is 28 bases in length. During the design, only one base is allowed to be mismatched with the target sequence, otherwise it cannot be recognized. The strict design requirements ensure that it can recognize the target sequence with high specificity.

[0038] (3) Low cost: The amplification stage is isothermal amplification at 37-42℃, which does not require a high-performance PCR instrument. It can be designed as a side-flow chromatography test strip, etc. The requirements for the interpretation instrument are low, making it suitable for on-site screening.

[0039] (4) High sensitivity: The detection limit of the composition of this invention is 1×10 3 aM concentration RNA, with sensitivity comparable to traditional RT-qPCR.

[0040] (5) Easy to operate: The sample addition operation is simple and easy to learn. The amplification results are judged based on the fluorescence signal. No other analysis steps such as electrophoresis are required, and it does not require the precision and professionalism of RT-qPCR. Attached Figure Description

[0041] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0042] Figure 1 This is a schematic diagram of the development process of the Decacovirus nucleic acid detection composition of the present invention.

[0043] Figure 2 The result is the fluorescence intensity detection result in Example 2 of this invention.

[0044] Figure 3 This is the fluorescence intensity change curve detected by sensitivity in Example 2 of the present invention.

[0045] Figure 4 This is the result of specific detection of fluorescence intensity in Example 3 of the present invention.

[0046] Figure 5 This is the fluorescence intensity change curve specifically detected in Example 3 of the present invention.

[0047] Figure 6 This is the detection and comparison result of the comparative experiment of the present invention.

[0048] Figure 7 The results of this invention are obtained using lateral chromatography test strips. Numbers 1-16 in the figure represent nucleic acid samples 4996, 7345, 7546, B327, 160935, 180365, 180367, 180396, CHB0025, 4259, 4125, OC43, H1N1, MRV, HKU8, and H2O, respectively. Detailed Implementation

[0049] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0050] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available or prepared according to conventional methods in the art.

[0051] Example 1 This embodiment provides a Decacovirus nucleic acid detection composition. Specifically, a set of detection compositions was designed and developed targeting the conserved region (Nsp16 gene region) of the Decacovirus genome (including four known viral species: HKU10, CHB25, HuB2013, and WA3607). A schematic diagram of the development process is shown below. Figure 1 .

[0052] The research and development process is mainly divided into two parts: the design of the detection composition and experimental evaluation. In the composition design part, following the established procedure, all Decacovirus whole genome sequences were collected and compared to identify conserved regions that met the design principles of the compositions (crRNA and RT-RPA primers). Among all designed compositions, the optimal composition was selected, synthesized, and experimentally evaluated. In the experimental evaluation part, three aspects were mainly evaluated: sensitivity, specificity, and amplification effect on experimental nucleic acid samples. Compositions failing to meet any of these requirements were discarded, and the final retained composition became the Decacovirus nucleic acid detection composition of this invention.

[0053] The Decacovirus nucleic acid detection composition of the present invention comprises a pair of RT-RPA primers (reverse transcription recombinase polymerase amplification primers): SEQ ID NO.1 and SEQ ID NO.2 and a crRNA sequence: SEQ ID NO.3, the sequences of which are shown in Table 1.

[0054] Table 1. Composition Sequence Information

[0055] The usage of the Decacovirus nucleic acid detection composition of the present invention is as follows: (1) Composition synthesis: SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 were all synthesized by Sangon Biotech (Shanghai) Co., Ltd., of which the nucleotide sequence of the target product amplified by the primer pair of SEQ ID NO.1 and SEQ ID NO.2 is SEQ ID NO.4, with a full length of 136bp.

[0056] The target RNA standard sequences of the composition are shown in SEQ ID NO.5 and SEQ ID NO.6 (conserved segments of various Decacovirus species), both 392nt in length, and were also synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0057] SEQ ID NO. 4: 5'-CAGTAATACGACTCACTATAGGGATGTGTGTACCATACAACATGAGGGTTTTGCACCTTGGTGCAGGTCGGATAAGGGAGTTGCACCTGGTACCGCAGTCTTACGAAGATGGCTGCCAAGTGATGCTATTATTGT-3'.

[0058] SEQ ID NO.5'-CAAAGGAUGUGCCUUGAGCCUUGUAACCCUACAAUUAUGGUGCCAGUAUCAAAUUACCUGAUGGCAUCAUGUUCAAUGUCGUGAAAUACACUCAAUUAUGUCAAUAUUAAAUAGCACUACUAUGUGUGUACCAUACAACAUGAGGGUUUUGCACCUUGGUGCAGGGUCGGAUAAGGGAGUUGCACCUGGUAC CGCAGUCUUACGAAGAUGGCUGCCAAGUGAUGCUAUUAUUGUUGACAAUGAUGUUGAAGACUAUGUUAGUGAUGCUGACUACAGCAUUACAGGUGAUUGUUCUACAGUUUACUUAGAAGAUAAGUUUGACCUAGUCAUAUCUGAUAUGUACGAUGGUAAAACAAAACACUGUGAUGGUGAGAAUGUUUCAAAGGAAGG-3'.

[0059] SEQ ID NO.6: 5'-CCUUCCUUUGAAACAUUCUCACCAUCACAGUGUUUUGUUUUACCAUCGUACAUAUCAGAUAUGACUAGGUCAAACUUAUCUUCUAAGUAAACUGUAGAACAAUCACCUGUAAUGCUGUAGUCAGCAUCACUAACAUAGUCUUCAACAUCAUUGUCAACAAUAAUAGCAUCACUUGGCAGCCAUCUUCGUAAGAC UGCGGUACCAGGUGCAACUCCCUUAUCCGACCCUGCACCAAGGUGCAAAACCCUCAUGUUGUAUGGUACACACAUAGUAGUGCUAUUUAAAUAUUGACAUAAUUGAGUGUAUUUCACGACAUUGAACAUGAUGCCAUCAGGUAAUUUGAUACUGGCACCAUAAUUGUAGAGGUUACAAGGCUCAAGGCACAUCCUUUG-3'.

[0060] (2) Isothermal amplification of target samples (RT-RPA reaction): The TwistAmp® Basic kit (catalog number: TABAS03KIT) manufactured by TwistDx was used. The system preparation is shown in Table 2.

[0061] Table 2. Components and preparation of the RT-RPA reaction system

[0062] Add the premixed solution from the table above to a lyophilized enzyme tube (containing recombinase, single-stranded DNA binding protein, DNA polymerase, and reverse transcriptase) provided with the kit. Add the target sample, add TwistAmp magnesium acetate to the tube cap, cap the tube, and centrifuge to mix. The reaction conditions are: 37-42℃, 10-15 min.

[0063] (3) CRISPR / Cas13a detection: The vendor codes for the reagents used (Table 3) and the preparation of the detection system (Table 4) are as follows: Table 3. Suppliers and product numbers of reagents used in CRISPR / Cas13a detection

[0064] Table 4. Preparation of CRISPR / Cas13a detection reagent system

[0065] When interpreting the results by reading the fluorescence using a microplate reader, the sequence of the RNA reporter probe is / 5FAM / T. A rArUG C / 3BHQ1 / , where, The nucleotides represent phosphate thioester bonds, rA and rU represent ribonucleotides (rNTPs), and the other four nucleotides are deoxyribonucleotides (dNTPs).

[0066] When using lateral chromatography test strips to display test results, the RNA probe used is / 5FAM / T. A rArUG C / 3Biotin / , its usage and dosage are the same as / 5FAM / T A rArUG C / 3BHQ1 / is the same.

[0067] Prepare the above premixed solution in an EP tube, add SEQ ID NO.3, vortex and centrifuge, take out 87.4 μL and put it into another clean EP tube, then add 4.6 μL of amplification product, vortex and centrifuge, and aliquot the final mixture into white 96-well plates, 20 μL / well, briefly centrifuge the 96-well plates, and then place them in a plate reader that has been preheated to 37°C, and monitor the fluorescence signal (FAM) for 1-1.5 h (generally 15-20 min is sufficient to determine the result), collecting fluorescence data every 5 minutes.

[0068] (4) Data judgment: Using Nuclease-free water as a negative control, if the fluorescence value increases significantly and is 5 times or more than the negative control value, it can be judged that the target sequence of the amplified product is present.

[0069] When using a lateral chromatography test strip to display the test results, in step (3), the final mixture is incubated at 37 °C in the dark for 10 min, then 20 μL of water is added to dilute it, and the test strip is then inserted into the mixture. After 5 min, the results can be read based on the colored bands on the test strip, without the need for a plate reading instrument.

[0070] In short, the sample to be detected is amplified isothermally at 37-42℃ using primer pairs SEQ ID NO.1 and SEQ ID NO.2 for 10-15 minutes; this step amplifies the signal. Then, the amplified product is detected using CRISPR / Cas13a. If the target sample sequence is present in the product, SEQ ID NO.3 (crRNA) will specifically recognize it. At this point, the Cas13a protein is activated with cleavage activity, cutting the single-stranded RNA reporter probe and releasing a fluorescent signal. Monitoring the fluorescence or detecting the signal using a lateral chromatography test strip can determine whether the product contains the target sequence. This process generally only takes 15-20 minutes.

[0071] In summary, a broad spectrum of nucleic acid detection for Decacovirus can be achieved using the combination of SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, along with a single-stranded RNA reporter probe, and commercially available reagents.

[0072] Example 2 Sensitivity evaluation of the Decacovirus nucleic acid detection composition In this embodiment, the synthesized target RNA standard SEQ ID NO.5 was prepared from 1×10⁻⁶. 7 aM was serially diluted to 1×10 in increments of 10. 2 aM, the only variable being the concentration of RNA standards, was used to test different concentrations of standards using the Decacovirus nucleic acid detection composition and method described in Example 1 (RT-RPA reaction conditions: 42℃, 15min), with H2O as a negative control. Results are shown in […]. Figure 2 and Figure 3 The results show that the lowest detection limit is 1×10⁻⁶. 3 aM.

[0073] Example 3: Specificity evaluation of the Decacovirus nucleic acid detection composition This embodiment evaluates the specificity of the Decacovirus nucleic acid detection composition described in Example 1, specifically demonstrating that it should not produce a detection signal for non-target samples but should produce a strong detection signal for target samples. Eleven non-Decacovirus nucleic acid samples were selected (sample information is shown in Table 5). H2O was used as a negative control, and a positive control was a nucleic acid sample from the HKU10 virus species under the Decacovirus subgenus (sourced from the Hu Ben research group at the Wuhan Institute of Virology, Chinese Academy of Sciences, sample number 7560). The detection method is described in Example 1. Detection results are shown in… Figure 4 and Figure 5 As can be seen from this, the Decacovirus nucleic acid detection composition of the present invention showed no detection signal for 11 non-Decacovirus nucleic acid samples and H2O, and only the positive group HKU10 showed a fluorescent signal, indicating that the composition has strong specificity.

[0074] Table 5. Information on 11 non-Decacovirus nucleic acid samples

[0075] Example 4: Stability evaluation of the nucleic acid detection method established using the Decacovirus nucleic acid detection composition. In this embodiment, the Decacovirus nucleic acid detection composition and method described in Example 1 were used to perform three independent replicate tests on 18 Decacovirus nucleic acid samples (sample information is shown in Table 6; each nucleic acid sample was obtained by extraction using a conventional kit after sampling from fecal swabs). Two parallel wells were set up for each independent replicate test of each sample. Within-group and between-group coefficients of variation were examined. The results are shown in Table 7. The within-group coefficient of variation measures the degree of variation between replicate measurements of the same sample within the same batch (or the same experimental run). It assesses the immediate precision of technical operations (such as sample addition and instrument reading). A CV < 5% is generally considered to indicate excellent precision, indicating very high consistency between parallel wells. The between-group coefficient of variation measures the degree of variation in measurement results of the same sample between different batches, at different times, or by different operators (i.e., different independent replicate tests). It assesses the stability and reproducibility of the detection method under different operating conditions. A CV < 10% is generally considered to indicate very stable method with excellent reproducibility, and 10% ≤ CV < 15% indicates acceptable stability.

[0076] Table 6. Information on 18 Decacovirus Nucleic Acid Samples

[0077] In Table 6, the three undetermined Decacovirus species were all obtained through high-throughput sequencing to obtain their full-length sequences. According to the classification criteria of the International Committee on Taxonomy of Viruses, they were placed in the subgenus Decacovirus, but not among the four known virus species. Furthermore, all samples with Genebank numbers have been accurately identified and their sequences published (searching for Genebank numbers on NCBI will yield results). Samples B327 and 1123 have also had their virus species confirmed through sequence identification.

[0078] Table 7. Repeatability analysis of three independent repeat detection experiments using the CRISPR / Cas13a detection method of this invention on 18 Decacovirus nucleic acid samples.

[0079] Repeatability analysis of the data showed that the coefficient of variation within each group for each experiment of each sample was less than 5%, indicating excellent technical repeatability between parallel wells. In the three replicates of each sample, the coefficient of variation between groups of 94.4% of the samples was less than 15%, indicating relatively stable experimental repeatability. Only one sample showed poor experimental repeatability, which may be related to the repeated freeze-thaw cycles and easy degradation characteristics of nucleic acid RNA.

[0080] Comparative experiment In this experiment, the target RNA standard was 1×10⁻⁶. 4 The detection effect of the two target directions (forward and reverse) compositions was tested at a concentration of aM. The two directions of the compositions have the same target. One group is forward (consistent with the direction of Decacovirus single-stranded RNA, i.e., genome). The primer pairs and crRNA sequences used are described in Table 1 of this invention. The target RNA standard used is the synthesized SEQ ID NO.5. The other group is reverse. The primer pairs and crRNA sequences used are described in Table 9. The target RNA standard used is the synthesized SEQ ID NO.6.

[0081] The compositions for both detection directions were tested using the detection method described in Example 1 (RT-RPA reaction conditions: 42°C, 15 min), with H2O as a negative control. Results are shown in [Figure 1]. Figure 6 The results show that the composition with forward detection (the embodiment of the present invention) performs better, exhibiting higher fluorescence intensity against the standard, indicating stronger recognition ability.

[0082] Table 9

[0083] In Table 9, the underlined portion in SEQ ID NO.7 is the T7 RNA polymerase promoter sequence, and the underlined portion in SEQ ID NO.9 is the DR sequence of crRNA.

[0084] Example 5: Application of Lateral Chromatography Test Strips This embodiment further utilizes a commercial lateral chromatography test strip (product number: LD04101, purchased from Nanjing Liding Medical Technology Co., Ltd.) to test the Decacovirus nucleic acid detection composition and method described in Example 1, exploring whether the composition detection method can be applied to portable devices for detection outside the laboratory.

[0085] Specifically, 15 nucleic acid samples (4996, 7345, 7546, B327, 160935, 180365, 180367, 180396, CHB0025, 4259, 4125, OC43, H1N1, MRV, HKU8, detailed information can be found in Tables 5 and 6) and H2O (negative control) were selected and tested according to the method described in Example 1. The test results were presented using lateral chromatography test strips.

[0086] When using lateral chromatography test strips to present results, one end of the RNA reporter probe is labeled with FAM, while the other end is labeled with biotin instead of a quencher group. The sample pad of the test strip is coated with an anti-FAM antibody labeled with gold nanoparticles. Downstream of the sample pad is the control line (C line), coated with streptavidin. Downstream of the C line is the antibody capture line (T line). If the target sequence is present in the sample, the CRISPR / Cas13a complex, after cleaving the probe, will generate a large number of RNA probes carrying only FAM or biotin. These probes will be captured sequentially by the C line (by biotin-streptavidin binding and color development) and the T line (by the gold nanoparticle-labeled anti-FAM antibody-FAM color development) during sample chromatography, so both lines will show color. If the sample does not contain the target sequence, the CRISPR / Cas13a complex will not produce collateral cleavage activity, and the probe remains intact (i.e., there are no probes carrying only FAM). The intact probes are captured and retained at the C line, and only the C line shows color. Results are shown below. Figure 7 The C line is the control line, and the T line is the antibody capture line. Both the C and T lines show color, indicating a positive result; only the C line shows color, indicating a negative result. It is evident that the target nucleic acid sample (Decacovirus nucleic acid sample) is positive on the test strip, while the non-target nucleic acid sample (non-Decacovirus nucleic acid sample) and the negative control group are negative. This demonstrates that the detection method based on the detection composition of this invention does not rely on an ELISA reader to read the fluorescence signal, and can be applied to portable test strips for detection in off-site laboratory scenarios, with a wide range of applications.

[0087] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A Decacovirus nucleic acid detection composition, characterized in that, include: RT-RPA primer pairs and crRNA; The RT-RPA primer pair consists of two RT-RPA primers, the sequences of which are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. The crRNA sequence consists of an anchoring sequence for binding to the Cas13a protein and a guide sequence for targeting the Decacovirus gene target sequence, as shown in positions 23-50 of SEQ ID No.

3.

2. The Decacovirus nucleic acid detection composition according to claim 1, characterized in that, The nucleotide sequence of the crRNA is shown in SEQ ID No.

3.

3. A kit for detecting Decacovirus, characterized in that, Includes the Decacovirus nucleic acid detection composition as described in claim 1 or 2.

4. The kit for detecting Decacovirus according to claim 3, characterized in that, The kit also includes an RNA reporter probe labeled with a fluorescent group and a Cas13a protein, preferably an LwaCas13a protein; And / or, the kit further includes one or more of the following: buffer, RNA reverse transcriptase, RNase inhibitor, RNase-free water, magnesium salt, NTP, and T7 RNA polymerase; Preferably, the buffer solution is TwistAmp Rehydration Buffer and / or HEPES; Preferably, the magnesium salt is magnesium acetate and / or MgCl2.

5. An RT-RPA primer pair for detecting Decacovirus, characterized in that, The RT-RPA primer pair is as described in claim 1.

6. A method for detecting the crRNA of Decacovirus, characterized in that, The crRNA is as described in claim 1 or 2.

7. A method for detecting Decacovirus for purposes other than disease diagnosis or treatment, characterized in that, The method includes the following steps: 1) Extract RNA from the sample to be tested; 2) RT-RPA reaction: Using the RNA as a template, reverse transcription and isothermal amplification were performed using RT-RPA primer pairs to obtain the RT-RPA product; The RT-RPA primer pair is as described in claim 1; 3) CRISPR / Cas13a detection: The RT-RPA products were detected using the CRISPR / Cas13a detection system; The CRISPR / Cas13a detection system includes crRNA, as described in claim 1 or 2.

8. The method for detecting Decacovirus according to claim 7, characterized in that, The reaction system of the RT-RPA reaction also includes buffer, RNA reverse transcriptase, RNase inhibitor, RNase-free water and magnesium salt; Preferably, the buffer solution is a TwistAmp Rehydration Buffer; Preferably, the magnesium salt is magnesium acetate; And / or, the CRISPR / Cas13a detection system further includes Cas13a protein, RNA reporter probe labeled with fluorescent group, NTP, T7 RNA polymerase, RNase inhibitor, magnesium salt and buffer; Preferably, the Cas13a protein is the LwaCas13a protein; Preferably, the magnesium salt is MgCl2; Preferably, the buffer solution is HEPES.

9. The method for detecting Decacovirus according to claim 8, characterized in that, The reaction conditions for the RT-RPA reaction are: 37-42℃, 10-15min; And / or, the CRISPR / Cas13a detection temperature is 37°C; if the detection result shows an increase in fluorescence value that is 5 times or more than the fluorescence value of the negative sample, then the sample to be tested is determined to contain the target amplification sequence, and the negative sample is RNase-free water.

10. Any of the following applications of the Decacovirus nucleic acid detection composition of claim 1 or 2, the kit of claim 3 or 4, the RT-RPA primer pair of claim 5, or the crRNA of claim 6: 1) Application in detecting Decacovirus for purposes other than disease diagnosis or treatment; 2) Application in the preparation of products for detecting Decacovirus.

Images