Use of vwa8 gene in regulating resistance to vomitoxin

By constructing a VWA8 gene knockout cell line and using Cas9 gene editing technology to inhibit VWA8 gene expression, the problem of vomitoxin damage to the pig intestine was solved, achieving highly efficient resistance of cells and animals to vomitoxin and promoting the research and application of vomitoxin prevention and control products.

CN122168539APending Publication Date: 2026-06-09AGRO BIOLOGICAL GENE RES CENT GUANGDONG ACADEMY OF AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202610322597.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-17
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

In the existing technology, vomitoxin severely damages the intestinal epithelial cells of pigs, leading to decreased animal production performance and health problems, and there is a lack of effective molecular targets and methods to regulate resistance to vomitoxin.

Method used

By constructing a stable VWA8 gene knockout cell line, VWA8 gene expression was suppressed using Cas9 gene editing technology and sgRNA, thus establishing a cell model and pig breed with vomitoxin resistance.

Benefits of technology

VWA8 gene knockout cell lines exhibit excellent resistance to vomitoxin, improving cell survival rates and providing technical support for the development of targeted drugs or vaccines, thereby enhancing food and feed safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122168539A_ABST
    Figure CN122168539A_ABST
Patent Text Reader

Abstract

The application discloses application of a VWA8 gene in regulating resistance to vomitoxin and belongs to the technical field of biotechnology. The application constructs a stable and monoclonal VWA8 gene knockout cell line, and it is found through a vomitoxin toxicity experiment that the VWA8 gene knockout cell line has excellent resistance to vomitoxin. It is revealed that the VWA8 gene serves as a key target point for cells or animals to resist vomitoxin, has important research and application potential for targeted regulation and efficient antagonism of vomitoxin, and based on the gene target point, a specific drug or vaccine for treating vomitoxin can be developed, thereby providing technical support for food or feed safety.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to the application of the VWA8 gene in regulating resistance to vomitoxin. Background Technology

[0002] Deoxynivalenol (DON), also known as vomitoxin, is one of the most serious mycotoxins contaminating feed, causing significant economic losses to the livestock industry and severely harming the health of livestock and humans. Long-term consumption of low-concentration vomitoxin-contaminated feed by animals can lead to decreased appetite, reduced feed intake, and lower feed utilization. Ingestion of high-concentration vomitoxin-contaminated feed can disrupt the intestinal barrier, causing vomiting, diarrhea, and even death, severely impairing animal production performance and damaging health. Different animals have varying sensitivities to vomitoxin; pigs are among the most sensitive, making research into the toxic mechanisms of vomitoxin crucial for pig production.

[0003] The intestinal epithelial barrier is crucial for maintaining bodily health, and its dysfunction is closely related to various human diseases such as inflammatory bowel disease, metabolic syndrome, and infections. Due to ethical limitations and high costs associated with directly studying intestinal function and molecular mechanisms in humans or live animals, establishing in vitro cell models that highly mimic the characteristics of human or animal intestinal epithelium has significant scientific value and application prospects. The piglet intestinal epithelial cell line IPEC-J2, isolated from normal piglet jejunal tissue, not only possesses differentiation potential and proliferation characteristics similar to primary intestinal epithelial cells, but also exhibits periodic expression and activation of key functional molecules such as mucin-binding glycocalyx, cytokines, chemokines, and Toll-like receptors on its cell surface, thus functionally highly mimicking the in vivo intestinal microenvironment. Compared to tumor-derived intestinal cell lines (such as Caco-2 and HT-29), IPEC-J2, due to its normal genetic background and performance more closely resembling in vivo physiological states, is more suitable as an in vitro model for studying intestinal physiology, barrier function, host-pathogen interactions, nutrient metabolism, and toxicity testing. Therefore, the IPCE-J2 cell line, as an in vitro culture model of porcine intestinal epithelial cells, is an ideal model for simulating normal intestinal physiological functions, studying host-pathogen interactions, and assessing nutritional and toxicological effects, and has irreplaceable value, especially in the field of animal husbandry and veterinary medicine.

[0004] The VWA8 (Von Willebrand factor A domain containing 8) gene encodes an AAA-ATPase, a protein containing multiple von Willebrand factor A domains. This protein is located on the outer mitochondrial membrane and participates in processes such as mitophagy, mitochondrial dynamics, and apoptosis regulation, playing a crucial role in maintaining cellular energy homeostasis and responding to environmental stress. However, the specific functions of VWA8 in intestinal epithelial cells and its mechanisms of action in maintaining intestinal barrier integrity, regulating energy metabolism, and mediating stress responses remain unclear. Elucidating the biological functions of VWA8 is expected to provide new molecular targets for understanding intestinal energy metabolism-related diseases and is of great significance for elucidating the potential mechanisms of intestinal-related diseases (such as infectious enteritis, inflammatory bowel disease, and metabolic disorders). Since vomitoxin is mainly absorbed in the gastrointestinal tract, making the intestine a primary target organ, exploring the functional role of the VWA8 gene in vomitoxin induction will help reveal the molecular mechanism of action of vomitoxin and provide a basis for the prevention and protection against other mycotoxins, which has significant guiding significance for animal husbandry and human health. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the VWA8 gene in regulating vomitoxin resistance, thereby addressing the problems existing in the prior art. This invention constructs a stable, monoclonal VWA8 gene knockout cell line and, through vomitoxin toxicity testing, demonstrates that the VWA8 gene knockout cell line exhibits excellent vomitoxin resistance. This reveals that the VWA8 gene, as a key target for cellular or animal resistance to vomitoxin, possesses significant potential for targeted regulation and efficient antagonism of vomitoxin in research and application. Based on this gene target, targeted drugs or vaccines for treating vomitoxin can be developed, providing technical support for food or feed safety.

[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides the use of products that inhibit VWA8 gene expression in the preparation of drugs that improve resistance to vomitoxin.

[0007] This invention also provides the use of products that inhibit VWA8 gene expression in the preparation of cell models resistant to vomitoxin.

[0008] This invention also provides the application of products that inhibit VWA8 gene expression in the breeding of pig breeds resistant to vomitoxin.

[0009] Furthermore, the products that inhibit VWA8 gene expression include sgRNA that knocks out the VWA8 gene, recombinant plasmids that knock out the VWA8 gene, or lentiviruses that knock out the VWA8 gene.

[0010] Furthermore, the sequence of the sgRNA is shown in SEQ ID NO.4.

[0011] The present invention also provides a method for constructing a cell model with resistance to vomitoxin, including the step of knocking out the VWA8 gene in the cell to inhibit VWA8 gene expression, thereby obtaining the cell model.

[0012] Further, the method includes the following steps: after inserting the Cas9 gene into the cell genome, the sgRNA that knocks out the VWA8 gene is transferred into the cell to obtain the cell model.

[0013] Furthermore, the sequence of the sgRNA is shown in SEQ ID NO.4.

[0014] The present invention also provides a cell model constructed by the above-described construction method.

[0015] This invention also provides an application of the above-mentioned cell model in the research, screening and evaluation of products for the prevention and control of vomitoxin.

[0016] The present invention discloses the following technical effects: This invention constructs a stable, monoclonal VWA8 gene knockout cell line by inserting the Cas9 gene into the IPEC-J2 genome and then transfecting it with sgRNA that inhibits VWA8 gene expression. Vomitoxin toxicity tests revealed that, compared to wild-type cells, this VWA8 gene knockout cell line exhibited higher cell survival rate under vomitoxin treatment, indicating that VWA8 gene knockout cells possess excellent vomitoxin resistance. This invention reveals that the VWA8 gene, as a key target for cellular or animal resistance to vomitoxin, has significant potential for targeted regulation and efficient antagonism of vomitoxin in research and application. Based on this gene target, targeted drugs or vaccines for treating vomitoxin can be developed, providing technical support for food or feed safety. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 Image of lentivirus packaging system (A) and plasmid electrophoresis detection results (B); Figure 2Cell morphology diagrams during the process of obtaining single-cell lines from limited dilution cell clones; scale bar is 100 μm; where A is a single cell obtained after 2 days of culture; B is several cells obtained after 6 days of culture; C is a cell clone cluster obtained after 9 days of culture; Figure 3 The image shows the results of Cas9 gene insertion detection in the genome of the IPEC-J2-Cas9 cell line; where A represents the electrophoresis results of ~500bp fragment insertion in different cell lines; B represents the electrophoresis results of terminal fragment insertion at different vector insertion sites in different cell lines; and C represents the insertion site of the Cas9 gene on the chromosome in different cell lines. Figure 4 The image shows the results of Cas9 protein expression detection in the IPEC-J2-Cas9 cell line; Figure 5 Growth curves for PEC-J2 and IPEC-J2-Cas9 cell lines; Figure 6 Cell morphology diagrams of IPEC-J2 and IPEC-J2-Cas9 cell lines; scale bar is 50 μm; Figure 7 The image shows the construction results of the sgRNA lentiviral vector plasmid; where A is a schematic diagram of the local structure of the plasmid; B is the plasmid map; and C is the plasmid electrophoresis detection result. Figure 8 This image shows the PCR amplification results of sgRNA mixed oligonucleotides; lane 1 is the negative control (water); lane 2 is the PCR product of sgRNA mixed oligonucleotides. Figure 9 This is a sequencing peak diagram of IPEC-J2-VWA8 monoclonal cells; Figure 10 This is a sequence comparison diagram of the VWA8 gene between the IPEC-J2-VWA8 cell line and wild-type cells. Figure 11 Figure 1 shows the cell viability of different cell lines after treatment with 25 μg / mL vomitoxin. Detailed Implementation Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0019] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0020] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0021] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0022] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0023] Example 1 This embodiment first constructed a stable IPEC-J2 cell line with the VWA8 gene knocked out, and then verified the resistance of this cell line to vomitoxin, providing a theoretical basis for in-depth research on the therapeutic mechanism and key targets of vomitoxin. The specific research process is as follows: 1. Construction of a porcine IPEC-J2 cell line stably expressing Cas9 protein 1.1 Construction of a lentiviral expression vector containing the Cas9 gene The SpCas9 gene was amplified from pX330 (Addgene #42230), and a fusion fragment EFS:SpCas9:Flag:P2A:Blast containing the Cas9 gene and the blast fungicide resistance gene was constructed (the encoded amino acid sequence is shown in SEQ ID NO.1). This fragment was inserted into a lentiviral vector to obtain the transfer plasmid LentiCas9-Blast. Together with the purchased packaging plasmid psPAX2 (Addgene #12260) and envelope plasmid pMD2.G (Addgene #12259), this formed a lentiviral packaging system. (See...) Figure 1 。

[0024] >Cas9:Flag:P2A:Blast(SEQ ID NO.1): .

[0025] 1.2 Transformation of HEK293T cells 7×10 5 One HEK293T cell was seeded into a 6cm culture dish containing 5mL of culture medium and incubated overnight at 37°C with 5% CO2. When the cells reached 60-80% confluence, they were ready for packaging. Two 1.5mL centrifuge tubes were taken out, and 20 μL of OPTI-MEM was added to tube 1. ® Serum-free medium, 1 μg LentiCas9-Blast plasmid, 750 ng psPAX2 plasmid, and 250 ng pMD2.G plasmid were mixed and incubated at room temperature for 5 min; 74 μL OPTI-MEM was added to tube 2. ® Serum-free culture medium, 6 μL FuGENE ® HD transfection reagent. After mixing the two tubes, incubate at room temperature for 20 min, add HEK293T cell culture medium, mix well, and incubate at 37℃ in a 5% CO2 cell culture incubator. After 24 h, replace with DMEM / F12 complete medium and continue culturing for 24-48 h. Collect the culture medium in a 15 mL centrifuge tube, centrifuge at 10000 rpm for 30 min, and aliquot the supernatant into cell cryovials and store at -80℃.

[0026] 1.3 Antibiotic Sensitivity Assay for IPEC-J2 Cells IPEC-J2 cells cultured to the logarithmic growth phase were digested, and the cells were collected and counted. 1500 IPEC-J2 cells were seeded into each well of a 96-well plate and cultured overnight at 37°C with 5% CO2. Once the cell layer covered 80% of the well bottom area, the supernatant was removed using a pipette, and various concentrations of blast fungicide [(µg / mL): 0, 1, 3, 5, 7, 10, 12, 15, 17, 20, 23, 27, 55] were added. Four replicates were prepared for each concentration of blast fungicide, and cell viability in each well was observed daily. The number of cells that died in all four replicates at a specific blast fungicide concentration was recorded from day 7 to day 10. The lowest blast fungicide concentration was selected as the sensitive concentration for subsequent screening of IPEC-J2-Cas9 cell clones expressing the Cas9 protein.

[0027] 1.4 Transfection of IPEC-J2 cells IPEC-J2 cells cultured overnight to 70%-80% confluency were used for viral transfection. Viral particle titers were determined, and based on the measured lentiviral supernatant titer, lentiviral supernatant was added at a multiplicity of infection (MOI) of 0.2-0.3. After 12 hours of lentiviral transfection, the medium was replaced with fresh medium, and the cells were cultured for another 12 hours at 37°C in a 5% CO2 incubator. Subsequently, the medium was replaced with fresh medium containing 20 µg / mL blastomycin, and the transfected cells were cultured at 37°C in a 5% CO2 incubator for 5-7 days. Transfected cells were then collected for screening single-cell clones using a limiting dilution method.

[0028] 1.5 IPEC-J2-Cas9 Monoclonal Cell Screening Dilute the transfected cells from the previous step to 7-8 cells / mL using culture medium. Add 200µL to each well of a 96-well plate, ensuring an average cell count of 1.4-1.6 cells per well. Observe cell growth under a microscope, identifying wells with single cells. Results are shown below. Figure 2 After the single cells grew into cell clusters, they were transferred to 12-well plates for expansion culture, and the cells were collected. Four IPEC-J2-Cas9 monoclonal cell lines were obtained through screening and named 40, 52, 11D5, and 11E7, respectively. The cells were aliquoted and stored in liquid nitrogen.

[0029] 1.6 Detection of Cas9 gene insertion site Genomic DNA was extracted from the IPEC-J2-Cas9 cell line. IPEC-J2 cell line genomic DNA was used as a negative control, and LentiCas9-Blast plasmid was used as a positive control. Primers Cas9F (5'-ATG GAC AAG AAG TAC AGC ATCGGC CTG-3' (SEQ ID NO.2) and Cas9R (5'-GTT CAG GTC GCC CTC GAT CAG GAA GTG-3' (SEQ ID NO.3) were used to detect the presence of a ~500bp fragment in the IPEC-J2-Cas9 genome. Then, nested PCR was used to determine the insertion site of the Cas9 expression cassette in the genome, followed by sequencing. Results are shown below. Figure 3 The results showed that the Cas9 gene was successfully inserted into the genome of the IPEC-J2-Cas9 cell line.

[0030] 1.7 Detection of Cas9 protein expression Total protein was extracted from the IPEC-J2-Cas9 cell line using RIPA Buffer (R0278, Sigma), and protein concentration was determined using a Qubit 2.0 spectrophotometer. A 10% SDS-PAGE gel was prepared, and approximately 100 µg of protein was added for electrophoresis. After electrophoresis, a semi-dry transfer method was used for membrane transfer. The membrane was blocked with clear milk barrier buffer (10×) (37587, Pierce) at room temperature with gentle shaking for 60 min. Primary anti-mouse monoclonal antibody-FLAG®M2 (F1804, Sigma) was added, and the membrane was incubated overnight at 4°C with gentle shaking. After washing with TBS containing 0.05% Tween-20, secondary antibody (anti-mouse IgG (full molecular weight)-peroxidase antibody) (A9044, Sigma) was added, and the membrane was incubated at room temperature with gentle shaking for 60 min. After washing away excess antibody, chemiluminescence staining was performed. Results are shown below. Figure 4 The results showed that all IPEC-J2-Cas9 cell lines could express Cas9 protein.

[0031] 1.8 Determination of growth curves of IPEC-J2-Cas9 cells stably expressing Cas9 IPEC-J2-Cas9 cells (11D5) and wild-type IPEC-J2 cells in good growth condition were collected. The cells were gently washed three times with PBS, digested with trypsin for 5 min, and then resuspended in fresh culture medium for cell counting. Based on the cell count results, cells were passaged at 10,000 cells / mL, 1 mL per well, and inoculated into 12-well plates, with 36 wells for each cell type. Cell counting began after 24 h, and was repeated every 24 h thereafter, using cells from 3 wells each time, and the mean count was calculated. Counting was performed continuously for 10 days. Based on the cell count results, a growth curve was plotted with total cell count on the ordinate and time on the abscissa. Results are shown below. Figure 5 The results showed that the insertion of the Cas9 gene did not affect normal cell growth.

[0032] 1.9 IPEC-J2-Cas9 cell morphology detection Cell morphology was detected using the hematoxylin-eosin staining method: 2×10 5IPEC-J2 cells and IPEC-J2-Cas9 cells (11D5) were cultured on sterile coverslips at 37°C and 5% CO2 overnight. The culture medium was aspirated from the coverslips, and the cells were washed three times with PBS. After fixing the cells with neutral formalin, 0.25% Triton-100 was added for 5 min. After washing three times with PBS, the cells were stained with MAYER hematoxylin staining solution for 10 min, and the coverslips were rinsed with water until the water was colorless. The cells were then treated sequentially with 75% ethanol, 85% ethanol for 2 min, eosin for 30 s, 0.95% ethanol for 2 min, and anhydrous ethanol for 4 min. Neutral resin was added to the slides for mounting, and cell morphology was observed and photographed under an upright microscope. Results are shown below. Figure 6 The results showed that the insertion of the Cas9 gene did not affect the normal morphology of IPEC-J2 cells.

[0033] 2. Construction of a hybrid cell library of pig whole-genome protein-coding gene knockout from IPEC-J2-Cas9 cell line 2.1 Construction of sgRNA plasmid and lentiviral libraries containing porcine whole-genome protein-coding genes (~18000) 2.1.1 sgRNA design and synthesis 2.1.1.1 sgRNA Design The team designed sgRNAs using the method in their previous patent, "A Guide Sequence for Recognition Sites of Highly Efficient and Specific sgRNAs for Pig Gene Editing and Its Screening Method (Patent No.: ZL 201610248143.3)". The specific method is as follows: (1) SOAP was used to align the resequencing data of the target sample to the reference genome, and SOAPsnp was used to obtain the corrected SNPs in the target sample to obtain the genome data for analysis; (2) the exon sequences in the protein-coding genes annotated in the whole pig genome sequence were screened, and the overlap status of exons between different splicing modes of alternative splicing genes was marked for the search in (6); (3) the script was used to select sites with 5'-GN20GG-3' sequence characteristics from all exon sequences obtained from all protein-coding genes in step (2), remove sequences that cross exon regions, and use the remaining sequences as the basis for subsequent screening of specific sgRNAs. A. Data basis for recognition site guide sequences; (4) Align all the selected candidate sgRNA recognition site guide sequences to the whole pig genome sequence. Through sequence homology analysis, first remove candidate sgRNA recognition site guide sequences that have complete matching with other genomic positions outside the original site, find all off-target sites with less than 5 mismatched bases, and determine that these off-target sites are located in the exons, introns, or intergenic regions of functional genes; (5) Construct a scoring matrix and score all candidate sgRNA recognition site guide sequences; (6) Calculate the scores of sgRNA recognition site guide sequences, and select the 3 sgRNA recognition site guide sequences with the highest scores in each protein-coding gene; when the maximum total score is met... When there are fewer than 3 sgRNA recognition site guide sequences with a score limit, the X value in the 5'-GNXGG-3' structure is changed from 20 to 16, and steps (3)-(5) are repeated until sgRNA recognition site guide sequences that meet the conditions are obtained. For genes with alternative splicing, in order to completely knock out transcripts generated by all different splicing modes of the target gene with the fewest sgRNAs, the overlapping regions in different transcripts are used as the preferred regions for screening sgRNA recognition sites. If a sufficient number of sgRNA recognition sites cannot be found in this region, the non-overlapping regions are then screened to ensure that there are a sufficient number of sgRNA recognition site guide sequences for each type of alternative splicing in the final screening results. Using this method, a total of 73,485 sgRNA sequences for 18,000 protein-coding genes in pigs were designed. Among them, the sgRNA sequence for the VWA8 gene (Gene ID: 100511470) is shown in SEQ ID NO.4.

[0034] SEQ ID NO. 4: GAGAAGTTTGTCGTAACGCT.

[0035] 2.1.1.2 sgRNA sequence chip synthesis Using the CustomArray 92K chip, sgRNA oligonucleotide sequences were synthesized, yielding 80 µL of mixed oligonucleotides with a concentration of 44.5 ng / µL.

[0036] 2.1.2 Construction and quality testing of sgRNA plasmid libraries 2.1.2.1 Construction of sgRNA lentiviral vector plasmid Using LentiGuide-Puro as the backbone, the human u6 promoter was replaced with a porcine u6 promoter, employing an sgRNA backbone sequence with potential termination sequences removed and higher activity: GTTTAAGAGCTATGCTGGAAACAGCATAG CAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO.5). Finally, the lentiviral vector LentiGuide-Puro3, suitable for porcine gene editing, was obtained. Figure 7 .

[0037] 2.1.2.2 Construction and quality assessment of sgRNA lentiviral plasmid library (1) Construction of sgRNA lentiviral plasmid library The sgRNA mixed oligonucleotides synthesized using primers LentiLib-F: TAATCAAAAAAGTTTTTATGTTCTTGGCTTTATATACCCTCTGAGAAGACCCAGCCGTCG (SEQ ID NO.6) and LentiLib-R: GTTGATAACGGACTAGC CTTATTTAAACTTGCTATGCTGTTTCCAGCATAGCTCTTAAAC (SEQ ID NO.7) were amplified from the microarray. Figure 8 The LentiGuide-Puro vector was digested with Esp3I, and the digested LentiGuide-Puro vector was recovered and purified by gel electrophoresis. Using the Gibson assembly method, the PCR product was ligated to the vector via recombination to obtain the sgRNA lentiviral vector plasmid ligation product. This product was then transformed into Endura electrode competent cells, and the plasmid was extracted to obtain the sgRNA lentiviral plasmid library.

[0038] (2) Document quality assessment: The extracted mixed plasmid was amplified using primers Slib-F1: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGA CGCTCTTCCGATCTTAAGTAGAGCTTTATATACCCTCTGAGAAGACCCAGCCGTC (SEQ ID NO. 8) and primers Slib-R1: CAAGCAGAAGACGGCATACGAGATTCGCCTTGGTGACTGGA GTTCAGACGTGTGCTCTTCCGATCTCCGACTCGGTGCCACTTTTTCAAG (SEQ ID NO. 9). Sequencing was performed on an Illumina NextSeq 500 using the NextSeq 500 / 550 High Output Kit (75 Cycles) to obtain sgRNA plasmid library quality data, ensuring the sgRNA plasmid library quality met the requirements for subsequent experiments.

[0039] 2.1.2.3 Construction of sgRNA Lentiviral Library 7×10 5 One HEK293T cell was seeded into a 6cm culture dish containing 5mL of culture medium and incubated overnight at 37°C with 5% CO2. When the cells reached 60-80% confluence, they were ready for packaging. Two 1.5mL centrifuge tubes were taken out, and 20 μL of OPTI-MEM was added to tube 1. ® Add serum-free medium, 1 μg LentiGuide-Puro plasmid, 750 ng psPAX2 plasmid, and 250 ng pMD2.G plasmid, mix well, and incubate at room temperature for 5 min; add 74 μL OPTI-MEM to tube 2. ® Serum-free culture medium, 6 μL FuGENE ® HD transfection reagent. After mixing the two tubes, incubate at room temperature for 20 min, add HEK293T cell culture medium, mix well, and incubate at 37℃ in a 5% CO2 cell culture incubator. After 24 h, replace with DMEM / F12 complete medium and continue culturing for 24-48 h. Collect the culture medium in a 15 mL centrifuge tube, centrifuge at 10000 rpm for 30 min, and aliquot the supernatant into cell cryovials and store at -80℃. After concentrating the supernatant, obtain 200 µL of a titer of 2.33 × 10⁻⁶. 8 IFU / mL sgRNA lentiviral library.

[0040] 2.2 Construction of a hybrid cell library for knocking out protein-coding genes from the entire porcine genome 2.2.1 Determination of the recompensation index (MOI) of IPEC-J2-Cas9 cells (11D5) infected with sgRNA lentiviral library. The method is as follows: (1) One day before the experiment, 3×10⁶ cells were inoculated into wells A1, A2, B1, B2, C1, and C2. 6 (1) Add 2 mL of complete culture medium to each well of IPEC-J2-Cas9 cells. (2) Add 400 µL, 200 µL, 100 µL, 50 µL, 25 µL, and 0 µL of sgRNA virus solution (10-fold diluted) to each well, and add polybrene (maintaining a final concentration of 8 µg / mL) to each well. Mix the liquid in each well thoroughly. (3) Centrifuge the cell plate at 1000g and 33℃ for 2 hours in a horizontal centrifuge. (4) Gently wash each well with PBS, then discard the PBS solution and add trypsin to digest the cells. The digestion time depends on the cell type. (5) If 0 µL of sgRNA virus solution is added to the well, all cells will die after the treatment with puromycin. When the cells without puromycin still have 80-90% confluence, use CellTiter-Glo ® The cell viability assay kit was used to determine the cell viability. (6) The volume of virus required for 30% cell death was determined according to the MOI formula.

[0041] 2.2.2 Hybrid cell library of sgRNA knockout porcine whole-genome protein-coding genes The method is as follows: (1) There are a total of 73,485 sgRNAs in the whole pig genome. Each sgRNA corresponds to 500 cells. When infecting Lenti-sgRNA virus solution, MOI=0.3. The number of cells required to construct one cell library is calculated to be: 500×73,485÷0.3=1.22475×10 8 (2) Calculate how many holes are needed: 1.22475 × 10 8 1 / 5 × 10 6 = 24.495 holes, requiring 4 six-hole plates (5×10 holes in each six-hole plate). 6 (3) 24 h after cell inoculation, calculate how many milliliters of Lenti-sgRNA virus solution to add to each well according to the calculated MOI (so that the MOI per well is 0.3): at this time, the cell wells contain complete culture medium with a final concentration of 8 µg / mL polybrene; centrifuge at 1200g for 45 min. (4) 24 h after infection, gently wash each well with PBS, digest with trypsin, mix the cells collected from 24 wells in the same centrifuge tube, count the cells, and measure at 9 × 10⁻⁶ cells / well. 6T225flasks were inoculated, and a blank control cell group (IPEC-J2-Cas9 cells) was set up at the same time: at this time, the cell wells contained a complete culture medium with a final concentration of 8 µg / mL polybrene and a corresponding concentration of puromycin; (5) the culture medium was changed every 3 days: at this time, the cell wells contained a complete culture medium with a final concentration of 8 µg / mL polybrene and a corresponding concentration of puromycin; (6) 24 hours after changing the medium, the cells selected by puromycin were washed with PBS and then digested with trypsin to collect the cells (at this time, the cell population was an sgRNA cell bank), and the cells were counted at 9×10 6 One T225 flask was inoculated and expanded into culture, then cultured according to the formula: 500 × 73485 = 3.67425 × 10⁻⁶. 7 Each cell bank / tube is used to freeze cells for future use.

[0042] 3. Screening of VWA8 gene-edited IPEC-J2 cell lines as monoclonal cells 3.1 Construction of IPEC-J2-Cas9 whole-gene knockout cell anti-DON screening library 3.1.1 Twenty-four hours after inoculation of the previously established cell library, Lenti-sgRNA virus solution was added according to the calculated MOI (ultimately achieving an MOI of 0.3 per well); 24 hours post-infection, each well was gently washed with PBS, digested with trypsin, and the cells were counted at a concentration of 9 × 10⁻⁶ cells / well. 6 T225 Flasks were inoculated into cells, and a blank control group (IPEC-J2-Cas9 cells) was set up. Cells were selected using 4 μg / mL puromycin complete medium. The medium was changed every 3 days. Cells selected with puromycin were washed with PBS, then trypsin-digested and collected (at this point, the cell population was an sgRNA cell bank). Cells were counted at 9 × 10⁻⁶ cells / mL. 6 One T225 flask was inoculated and expanded into culture, then cultured according to the formula: 500 × 73485 = 3.67425 × 10⁻⁶. 7 Each cell bank / tube is used to freeze cells for future use.

[0043] 3.1.2 Determination of lethal dose of vomitoxin concentration: IPEC-J2-Cas9 cells were inoculated. When the cell confluence reached 80%-90%, each well was gently washed with PBS, and the PBS solution was discarded. Complete medium containing appropriate concentration gradients of DON was added, with three replicates for each concentration. The medium was changed every two days. Under a microscope, the lowest lethal concentration within 7 days was 25 μg / mL.

[0044] 3.1.3 Cell library screening: One cell library (3.67425×10⁻⁶) was selected. 7Resuscitate cells in T225 flasks. 24 hours after inoculation, treat cells with 25 μg / mL vomitoxin. When approximately 15% of cells remain (2 days), replace with normal culture medium. When cells reach approximately 80% confluence (2 days), treat again with 25 μg / mL vomitoxin. When approximately 15% of cells remain (2 days), replace with normal culture medium. When cells reach approximately 80% confluence (2 days), treat a third time with 25 μg / mL vomitoxin. When approximately 15% of cells remain (2 days), replace with normal culture medium. When cells reach 3.67425 × 10⁻⁶ cells / year... 7 (Approximately 3 days later) the cells were washed with PBS, digested with trypsin, and genomic DNA was extracted from the experimental group library cells for sequencing analysis. The remaining cells were cryopreserved.

[0045] 3.2 Selection of Monoclonal Cells One cell library (approximately 3.67425 × 10⁻⁶) 7 Cells were revived in T225 flasks. 24 hours after inoculation, cells were treated with 25 μg / mL vomitoxin. When approximately 15% of the cells remained (about 2 days), the medium was replaced with normal medium. Cells were treated a third time with 25 μg / mL vomitoxin. After approximately 15% of the cells remained (about 2 days), the medium was replaced with normal medium. Cells were treated a third time with 25 μg / mL vomitoxin. After approximately 15% of the cells remained (about 2 days), the medium was replaced with normal medium. Once the cells reached confluence, they were washed with PBS, digested with trypsin, and the remaining cells were collected for single-clone selection and cryopreservation. The cells were diluted to 0.75 cells / 100 μL and seeded into 100 μL / well of a 96-well plate. Cell growth was observed daily. Cell clones that reached 80%-100% confluence were digested and seeded into 24-well plates to obtain single-clone cell lines.

[0046] 3.3 Single-clonal cell sequencing identification After the cells in the 24-well plates reached confluence, they were transferred to 6-well plates and cultured in normal culture medium for 3-5 days. Once the cells in the 6-well plates reached confluence, they were collected and sequenced. The sequenced sequences were searched in an sgRNA library for alignment to confirm cell clones. Sequencing confirmed that the monoclonal cell line containing the sequence shown in SEQ ID NO. 10 was the IPEC-J2-VWA8 cell line with VWA8 gene editing knockout. Figure 9 Further sequencing revealed that, compared to the wild-type cell line, the IPEC-J2-VWA8 cell line had a 29-base deletion in both alleles of the VWA8 gene, resulting in a frameshift mutation and achieving homozygous knockout of the gene. Figure 10 ).

[0047] SEQ ID NO.10: TAGTCCGAGGATATCTTATTTAACTTGCTATGCTGTTTCCAGCATAGCTCTTAAACAGCGTTACGACAAACTTCCCGACGGCTGGGTCTTCTCAGAGGGTATATAAAGCTCTACTTAAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATA.

[0048] 4. Resistance of the VWA8 gene-edited IPEC-J2 cell line to vomitoxin toxicity. Using wild-type IPEC-J2 cells and IPEC-J2-Cas9 cells (11D5) as controls, we examined whether the IPEC-J2-VWA8 cell line had resistance to vomitoxin toxicity.

[0049] Three cell lines were seeded in equal numbers into cell culture plates and cultured for 24 hours under normal conditions. After 24 hours, the cells were treated with 25 μg / mL (minimum lethal concentration) of vomitoxin. The number of viable cells was measured at 0, 24, 48, 72, 96, and 120 hours after vomitoxin treatment, and cell viability was calculated. The results showed that IPEC-J2-VWA8 cells had a higher survival rate than wild-type cells and IPEC-J2-Cas9 cells, especially after 48 hours of treatment, demonstrating that the VWA8 gene knockout IPEC-J2-VWA8 cell line is resistant to vomitoxin toxicity (see...). Figure 11 ).

[0050] The above results indicate that editing the VWA8 gene to render it nonfunctional can enhance cellular resistance to vomitoxin. This suggests that the VWA8 gene is a key target for cellular or animal resistance to vomitoxin and has significant potential for targeted regulation and efficient antagonism of vomitoxin. Based on this gene target, targeted drugs or vaccines for the treatment of vomitoxin can be developed.

[0051] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. Application of products that inhibit VWA8 gene expression in the preparation of drugs that enhance resistance to vomitoxin.

2. Application of products that inhibit VWA8 gene expression in the preparation of cell models with vomitoxin resistance.

3. Application of products that inhibit VWA8 gene expression in the breeding of pig breeds resistant to vomitoxin.

4. The application according to any one of claims 1-3, characterized in that, The products that inhibit VWA8 gene expression include sgRNA that knocks out the VWA8 gene, recombinant plasmids that knock out the VWA8 gene, or lentiviruses that knock out the VWA8 gene.

5. The application according to claim 4, characterized in that, The sequence of the sgRNA is shown in SEQ ID NO.

4.

6. A method for constructing a cell model resistant to vomitoxin, characterized in that, The process includes the step of knocking out the VWA8 gene in cells to suppress VWA8 gene expression, thereby obtaining the cell model.

7. The construction method according to claim 6, characterized in that, The process includes the following steps: after inserting the Cas9 gene into the cell genome, the sgRNA that knocks out the VWA8 gene is transferred into the cell to obtain the cell model.

8. The construction method according to claim 7, characterized in that, The sequence of the sgRNA is shown in SEQ ID NO.

4.

9. A cell model constructed by the construction method according to any one of claims 6-8.

10. The application of the cell model as described in claim 9 in the research, screening and evaluation of products for the prevention and control of vomitoxin.

Citation Information

Patent Citations

  • Efficient specific sgRNA recognition site guide sequence for pig gene editing and screening method thereof

    CN105886616A