A real-time fluorescent RT-qPCR method for detecting live bacteria of Fusarium wilt in maize

By screening the LexA gene as an mRNA target through genomic analysis, a real-time fluorescent RT-qPCR method was established, which solved the problem of distinguishing between live and dead bacteria of maize bacterial wilt fungus, and achieved rapid and accurate detection to meet quarantine and control needs.

CN120290696BActive Publication Date: 2026-06-30TECH CENT OF GUANGZHOU CUSTOMS
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510443205.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-10
Publication Date
2026-06-30
Estimated Expiration
2045-04-10

AI Technical Summary

Technical Problem

Current technology cannot effectively distinguish between live and dead bacteria of bacterial wilt pathogens in corn, leading to false positive results and affecting the accuracy and efficiency of testing.

Method used

Genomic analysis was used to screen out the LexA gene, which is unique to the bacterium wilt of maize, as an mRNA target. Primers and probes were designed, and a real-time fluorescent RT-qPCR detection method was established to evaluate its stability after inactivation and achieve specific detection of live bacteria.

Benefits of technology

It enables rapid and accurate differentiation between live and dead bacteria, improves the specificity and sensitivity of the test, and can complete the test within 2 hours, meeting the needs of quarantine and prevention and control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290696B_ABST
    Figure CN120290696B_ABST
Patent Text Reader

Abstract

This invention relates to the field of agricultural biotechnology and discloses a real-time fluorescent RT-qPCR detection method for live PSS (Fusarium wilt) bacteria, comprising the following steps: S1, screening key genes; S2, designing primers and probes for key genes; S3, evaluating the stability of key gene mRNA after inactivation and identifying the target gene; the target gene is the LexA gene with a nucleotide sequence as shown in SEQ ID NO: 1; S4, establishing a real-time fluorescent RT-qPCR detection method using the primers and probes corresponding to the target gene screened in step S3. This invention establishes a highly efficient and accurate real-time fluorescent RT-qPCR detection method with good specificity and sensitivity. The sensitivity for detecting PSS LexA gene mRNA is 1000 times that of conventional RT-PCR methods. It can quickly determine the presence of live PSS bacteria in actual samples, providing strong technical support for the quarantine and control of PSS outbreaks.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a real-time fluorescent RT-qPCR detection method for live bacteria of Fusarium wilt, the pathogen of maize bacterial wilt. Background Technology

[0002] Bacterial wilt of maize (Pantoea stewartii subsp. stewartii, PSS) is a vascular bundle-destroying pathogen, causing stunted growth or wilting in affected plants and resulting in significant yield losses, especially in sweet maize production. Therefore, establishing efficient and sensitive detection methods for PSS is crucial for the early diagnosis and scientific control of this disease.

[0003] Currently, domestic and international methods for detecting PSS (Polydioxanone Sediment) primarily rely on DNA-based molecular biology techniques, such as conventional PCR, nested PCR, multiplex PCR, real-time fluorescence qPCR, and RPA. However, these methods cannot distinguish between dead and live PSS in samples, easily leading to false positive results. Although existing technologies have established detection methods combining the DNA dye PMA with real-time fluorescence qPCR to differentiate between live and dead PSS cells, this method involves complex pretreatment steps, including suspension preparation, incubation, and photolysis. Furthermore, PMA may not completely inhibit DNA from dead cells, resulting in false positives and limiting its practical application.

[0004] In recent years, RT-PCR technology with RNA as the detection target has shown great application prospects in the field of viable bacterial detection of medical diseases and food microorganisms. At present, there are no reports on viable bacterial detection methods for plant pathogenic bacteria based on RNA as the target.

[0005] This invention, through comparative genomic analysis of PSS and its similar species, screens species-specific expression genes and predicts their functions, selects suitable mRNA target genes, evaluates the stability of their mRNA after inactivation, and establishes a real-time fluorescent RT-qPCR detection method for live PSS, aiming to solve the problem of not being able to distinguish between dead and live bacteria in molecular detection, and to provide technical support for quarantine and prevention and control. Summary of the Invention

[0006] The purpose of this invention is to provide a real-time fluorescent RT-qPCR detection method for live bacteria of maize bacterial wilt, in order to solve the problem of not being able to distinguish between dead and live bacteria in the detection of maize bacterial wilt.

[0007] To achieve the above objectives, the technical solution of the present invention is as follows:

[0008] This invention provides a real-time fluorescent RT-qPCR detection method for live bacteria of Fusarium wilt, a bacterium that causes maize bacterial wilt, comprising the following steps:

[0009] S1. Screening for key genes;

[0010] S2. Design primers and probes for key genes;

[0011] S3. Assess the stability of key gene mRNA after inactivation and identify target genes;

[0012] The target gene is the LexA gene with a nucleotide sequence as shown in SEQ ID NO: 1;

[0013] S4. A real-time fluorescent RT-qPCR detection method is established using the primers and probes corresponding to the target genes screened in step S3.

[0014] Preferably, the primers corresponding to the target gene include:

[0015] The upstream primer LexA-1F with the nucleotide sequence shown in SEQ ID NO: 2 and the downstream primer LexA-1R with the nucleotide sequence shown in SEQ ID NO: 3.

[0016] Preferably, the probe used in conjunction with the above primers is the probe LexA-1P with a nucleotide sequence as shown in SEQ ID NO: 4.

[0017] Preferably, the reaction system of the real-time fluorescent RT-qPCR comprises: 12.5 μL of 2×One Step PrimeScript RT-qPCR Mix, 0.5 μL each of 10 μmol / L upstream and downstream primers and probes, 1.0 μL of RNA template, and RNase-free ddH2O to a final volume of 20 μL.

[0018] Preferably, the reaction program for the real-time fluorescent RT-qPCR is as follows: reverse transcription at 42℃ for 5 min; pre-denaturation at 94℃ for 10 s; denaturation at 94℃ for 5 s; annealing at 60℃ for 60 s; 40 cycles.

[0019] Preferably, the screening of key genes specifically involves: downloading the genome and encoded amino acid sequence data of the PSS strain and four similar species that have completed chromosome-level assembly from the GenBank database; performing whole-genome homologous gene clustering analysis based on the online software OrthoVenn2 to screen out PSS-specific gene clusters; and screening relevant key genes related to replication, transcription, or metabolism based on the gene function annotation results.

[0020] Preferably, the PSS strain is DC283, and the four similar species are P. stewartii subsp. indologenes strain LMG 2671, P. agglomerans strain FDAARGOS 1447, P. allii strain PNA, and P. ananatis strain PA13.

[0021] This invention also provides a real-time fluorescent RT-qPCR detection method for live bacteria of Fusarium wilt in maize, which is applied to the detection of live bacteria of Fusarium wilt in maize seeds.

[0022] The sequence involved in the present invention is as follows:

[0023] LexA gene SEQ ID NO.1:

[0024] GTGGAACAACTGACTGACACGCAGCAGCGCACGCTGGATTTCATCCGGGGCTATATCCGGGAAAACGGTCTGTCGCCAACCATTGCTGAGATTGCGGAAGGTATGGGGTGGAGGTCGCCTAACTCAGCGCAGATTCACGTCAACGCTTTGCAGCAAAAAGGAAGACTGAAGGTAAAGCGGGGAGC CAATCGGGGAATAGTGCTCACGACCACCAGCTTTGATTGTAACAATCTGGCACTGGAAACAGCCGTGCGTATTATGGGGATCATTGAGAAAGCAAAATGCGAGAAAGAGTTTGTGGCCTGACTTGCGTCTGCAAGCCGCCATTCATACTGAAGTGATTAATTTAATGATAAAGGGAGTAGTGTAA;

[0025] Upstream primer LexA-1F SEQ ID NO.2:

[0026] CTATATCCGGGAAAACGGTCTGTC;

[0027] Downstream primer LexA-1R SEQ ID NO.3:

[0028] GTTACAATCAAAGCTGGTGGTCG;

[0029] Probe LexA-1P SEQ ID NO.4:

[0030] FAM-ACCCCATACCTTCCGCAATCTCAGCAA-BHQ1.

[0031] In summary, compared with the prior art, the solution of the present invention has the following beneficial effects:

[0032] 1. This invention identifies the Lex gene as a candidate target gene for detecting the activity of *Fusarium wilt*, the pathogen of maize bacterial wilt. A suitable target gene is a primary condition for establishing a live bacteria detection method; it must be stably expressed in live bacteria and its expression must disappear rapidly after inactivation. rRNA has a longer half-life and can remain detectable for a considerable period after heat inactivation, while mRNA has a shorter half-life and degrades rapidly after inactivation. Therefore, mRNA is more suitable as a target for activity detection. This invention, through comparative genomic analysis, screened mRNA genes related to replication, transcription, and metabolic activities, and evaluated their stability after inactivation. It was found that 16S rRNA and 15 mRNAs could still be detected by real-time fluorescent RT-qPCR 72 h after inactivation, while only the Lex gene was completely degraded after 12 h.

[0033] 2. Unlike directly selecting common mRNA genes as detection targets, this invention uses genomic comparative analysis to screen for genes specific to PSS, solving the problem of identifying the high genetic similarity between PSS and its closely related species. Specificity analysis also demonstrates that the real-time fluorescent RT-qPCR method established using LexA as the target can effectively amplify PSS, while showing no amplification reaction against its closely related species and 18 other plant pathogenic bacteria, exhibiting good specificity.

[0034] 3. Since PSS mainly spreads over long distances through infected seeds, the most effective way to control its spread is to use healthy seeds. This invention detected live and dead PSS bacteria in artificially infected maize seeds. The results showed that the DNA-based real-time fluorescent qPCR method was positive for inactivated infected seeds. The real-time fluorescent RT-qPCR method established in this invention yielded consistent results with traditional isolation and culture methods: live PSS bacteria could be isolated from positive infected seeds, but not from inactivated infected seeds that tested negative. However, traditional isolation and culture methods require more than 4 days, while the real-time fluorescent RT-qPCR method is simpler and faster, requiring only 2 hours. Therefore, the real-time fluorescent RT-qPCR method established in this study has significant advantages in detecting live PSS bacteria carried in maize seeds.

[0035] 4. The present invention establishes a highly efficient and accurate real-time fluorescent RT-qPCR detection method with good specificity and sensitivity. It can quickly determine the presence of live PSS bacteria in actual samples and provide strong technical support for the quarantine and prevention of PSS outbreaks. Attached Figure Description

[0036] Figure 1 This is the result of orthologous cluster analysis of the bacterial wilt pathogen of maize and its four similar species.

[0037] Figure 2 These are the results of conventional RT-PCR detection of the stability of 17 target genes in this invention (in the PCR amplification results, 1-4 are live bacterial DNA, dead bacterial RNA, live bacterial RNA and dead bacterial RNA, respectively, and 5 is the blank control; in the RT-PCR amplification results, 6 is live bacterial RNA, 7-14 are dead bacterial RNA after heat treatment inactivation at 0 h, 6 h, 12 h, 24 h, 48 h and 72 h, respectively; 15 is the blank control).

[0038] Figure 3 These are the results of real-time fluorescence RT-qPCR detection of the stability of four candidate target genes in this invention (a, b, c, and d are the real-time fluorescence RT-qPCR amplification curves of LexA, Portal, DnaJ, and Ami genes, respectively; Live represents live bacterial RNA, Killed, 0h, Killed, 6h, Killed, 12h, Killed, 24h, Killed, 48h, and Killed, 72h represent the inactivated bacterial RNA at 0h, 6h, 12h, 24h, 48h, and 72h, respectively, and CK is the blank control).

[0039] Figure 4 These are the specific detection results of the real-time fluorescent RT-qPCR detection method in this invention (1-4 are Pantoea stewartii subsp. stewartii strains ATCC 29227, ATCC 29228, ATCC 29229 and ATCC8199, respectively; 5-38 are P. s. subsp. indologenes and 31 other tested strains, healthy maize leaves, healthy maize seeds and blank control, respectively).

[0040] Figure 5 These are the results of the sensitivity analysis of real-time fluorescent RT-qPCR and conventional RT-PCR in this invention (a is the real-time fluorescent RT-qPCR amplification image, b is the conventional RT-PCR electrophoresis image; 1-9 are 2×10⁻⁶ respectively). 8 fg / µL, 2×10 7 fg / µL, 2×10 6fg / µL, 2×10 5 fg / µL, 2×10 4 fg / µL, 2×10 3 fg / µL, 2×10 2 PSS live bacterial RNA at fg / µL, 20 fg / µL, and 2 fg / µL (CK was the blank control). Detailed Implementation

[0041] To enable those skilled in the art to better understand the present invention, the technical solution of the present invention will be described in further detail below with reference to the embodiments and accompanying drawings. Obviously, the described embodiments are merely some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort should fall within the scope of protection of the present invention.

[0042] Example

[0043] 1. Materials and Methods

[0044] 1.1 Materials

[0045] Test strains: 30 strains were collected, including 4 PSS strains and 26 other strains. The strain information is shown in Table 1.

[0046] Test plant material: Maize seed samples were collected in our laboratory from July to October 2024, originating from the United States, and prepared using PSS strain ATCC 29228 to form 10... 5 A bacterial suspension of CFU / mL was prepared by spraying 2 mL of the suspension onto 200 g of corn seed sample, mixing thoroughly, and then air-drying to obtain the bacterial-infected corn seed sample. An inactivated bacterial suspension was then used instead of the fresh bacterial suspension to prepare an inactivated bacterial-infected corn seed sample using the same method. Healthy corn seeds and healthy corn leaves were collected in the field in Guangzhou, Guangdong Province in September 2024.

[0047] Reagents: RNA extraction kit was purchased from Qiagen GmbH, Germany; bacterial genomic DNA extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.; Premix Ex Taq, Probe qPCR Mix, One Step PrimeScript RT-qPCR Mix, DNA endonuclease I and DL2000 DNA marker were purchased from TaKaRa Corporation, Japan; NA medium and LB liquid medium were purchased from Guangdong Huankai Microbial Technology Co., Ltd.; other reagents were of analytical grade.

[0048] Instruments: Real-time fluorescence PCR instrument purchased from ABI Corporation, USA; PCR instrument, electrophoresis instrument and gel imaging system purchased from Bio-rad Corporation, USA.

[0049] Table 1 Information on tested strains

[0050]

[0051]

[0052] Note: ZZ indicates that the sample was isolated and preserved by our research group.

[0053] 1.2 Discovery and Screening of Key Genes for Metabolic Activity

[0054] Downloaded the genome and encoded amino acid sequence data of the chromosome-level assembled PSS strain DC283 (GCA_002082215.1) and its four closely related species, P. stewartii subsp. indologenes strain LMG 2671 (GCF_030370575.1), P. agglomerans strain FDARGOS 1447 (GCF_019048385.1), P. allii strain PNA 200-10 (GCF_003148935.1), and P. ananatis strain PA13 (GCA_000233595.1), from the GenBank database. Genome-wide homologous gene clustering analysis was performed using the online software OrthoVenn2 (https: / / orthovenn2.bioinfotoolkits.net / home) (parameter: e-value ≤ 1 × 10⁻⁶). -5 (Inflation value ≤ 1.5) to screen out PSS-specific gene clusters, and based on the gene function annotation results, to screen key genes related to replication, transcription or metabolism as candidate target genes.

[0055] 1.3 Primers and Probes

[0056] Primers and probes were designed using Oligo 7.0 software for the candidate target gene sequences. All primers and probes were synthesized by Shanghai Sangon Biotech Co., Ltd., and the primer and probe information is shown in Table 2.

[0057] Table 2 Primer and probe information

[0058]

[0059]

[0060] 1.4 Inactivation treatment

[0061] Take and culture in LB liquid medium for 10 hours. 5 1 mL of PSS bacterial suspension with CFU / mL was treated at 80℃ for 30 min, streaked on NA plates, and incubated at 28℃ for 3-5 days to assess bacterial survival.

[0062] 1.5 DNA and RNA extraction

[0063] Centrifuge fresh or inactivated bacterial suspension at 10,000 rpm for 5 minutes. Wash the precipitate twice with sterile water and extract DNA or RNA according to the kit instructions. Remove residual genomic DNA from the obtained RNA with DNA endonuclease I and store at -20℃ for later use.

[0064] 1.6 Stability assessment of target genes after inactivation

[0065] To confirm the accuracy of the 17 primer pairs in amplifying the target genes and to exclude interference from residual genomic DNA in the RNA, DNA and RNA from fresh and inactivated bacterial suspensions were used as templates for PCR reactions. The inactivated bacterial suspensions remained in the culture medium at room temperature, and RNA was extracted at 0 h, 0.5 h, 1 h, 6 h, 12 h, 24 h, 48 h, and 72 h after inactivation. This RNA was used as templates for RT-PCR detection to assess the stability of the inactivated mRNA of the 17 target genes.

[0066] The total volume of the PCR (RT-PCR) reaction was 25 μL, containing: 12.5 μL of 2×Premix Taq mix (2×One Step Buffer), 1.0 μL of Enzyme Mix, 0.5 μL each of 10 μmol / L forward and reverse primers, 1 μL of DNA or RNA template, and RNase-free ddH2O to a final volume of 25 μL. The reaction program was as follows: (50℃ reverse transcription for 30 min); 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 45 s, 35 cycles; 72℃ extension for 10 min. The amplified products were analyzed by 1.2% agarose gel electrophoresis.

[0067] The stability of the target genes with rapid mRNA degradation selected above was further evaluated using a one-step TaqMan real-time fluorescent RT-qPCR method. The total reaction volume was 20 μL, containing: 12.5 μL of 2×One Step PrimeScript RT-qPCR Mix, 0.5 μL each of 10 μmol / L forward and reverse primers and probes, 1.0 μL of RNA template, and RNase-free ddH2O to a final volume of 20 μL. The reaction program was: reverse transcription at 42℃ for 5 min; pre-denaturation at 94℃ for 10 s; denaturation at 94℃ for 5 s; annealing at 60℃ for 60 s (collecting fluorescence signal), for 40 cycles.

[0068] 1.6 Specificity Analysis

[0069] Total RNA from PSS strains, PSS-like species, and other important plant pathogenic bacteria was used as experimental materials, with total RNA from healthy maize seed samples as a negative control and RNase-free ddH2O as a blank control. The selected primers and probes were used for TaqMan real-time fluorescent RT-qPC detection and analysis to evaluate their specificity.

[0070] 1.7 Sensitivity Analysis

[0071] The total RNA concentration of the PSS strain was diluted to 200 ng / μL, and then serially diluted 10-fold to nine different concentrations using EASY Dilution buffer (TaKaRa), with each concentration being 2×10⁻⁶. 8 fg / μL, 2×10 7 fg / μL, 2×10 6 fg / μL, 2×10 5 fg / μL, 2×10 4 fg / μL, 2×10 3 fg / μL, 2×10 3 Using fg / μL, 20 fg / μL, and 2 fg / μL as templates, conventional RT-PCR and real-time fluorescent RT-qPCR were performed for detection and analysis, and the sensitivity of the two methods was compared.

[0072] 1.8 Actual Sample Testing and Analysis

[0073] Five samples of PSS-infected maize seeds, five samples of inactivated PSS-infected maize seeds, five samples of healthy maize seeds, and five samples of healthy maize leaves, totaling 20 samples, were used as experimental materials. PSS-positive strains were used as positive controls, PSM strains as negative controls, and RNase-free ddH2O as blank controls. The samples were detected by traditional plate separation method, real-time fluorescent qPCR targeting DNA, and real-time fluorescent RT-qPCR targeting mRNA. The detection results were determined based on the plate separation results, amplification curves, and Ct values.

[0074] 2 Results and Analysis

[0075] 2.1 Discovery of key genes for metabolic activity

[0076] Ortho-homologous clustering analysis was performed on the whole genome amino acid sequences of strain PSS and four closely related strains using OrthoVenn 2 software. The results showed a total of 4510 gene clusters, including 1742 ortho-homologous gene clusters (containing at least two strains) and 2768 single-copy gene clusters. Figure 1 It can be seen that strain PSS has 120 unique gene clusters, totaling 673 genes in its genome. Among them, 103 are known gene families, namely 94 genes related to biological processes, 8 genes related to molecular functions, and 1 gene related to cellular components. Based on its COG functional annotation results, 16 genes related to replication, transcription, or metabolism were further screened as candidate target genes, mainly including IS66-like element accessory protein TnpA (TnpA), LexA family transcription regulators (LexA), and recombinase family proteins (rec), etc. (see Table 3).

[0077] Table 3. Genes related to replication, transcription, or metabolism obtained through screening.

[0078]

[0079] 2.2 Stability assessment of target genes after heat treatment lethality

[0080] 10 5After dry heat treatment at 80℃ for 30 min, the CFU / mL bacterial suspension was streaked onto NA plates and incubated at 28℃ for 3–5 days. No colony growth was observed, indicating that the pathogens were killed and inactive after heat treatment. To confirm the accuracy of the 17 primer pairs in amplifying the target gene, DNA and RNA were extracted from both live and dead bacteria for PCR detection. The results showed that all 17 primer pairs could amplify both live and dead bacterial DNA to obtain the target fragment, while the PCR results for both live and dead bacterial RNA were negative. This indicates that all 17 primer pairs could effectively amplify the target gene, and no DNA residue in either live or dead bacterial RNA affected the detection results.

[0081] To assess the stability of target genes, RT-PCR was performed on live bacterial RNA and RNA from dead bacteria at 0 h, 0.5 h, 1 h, 6 h, 12 h, 24 h, 48 h, and 72 h after inactivation. The results showed that all 17 primer pairs could effectively amplify the untreated live bacterial target gene RNA. For the inactivated dead bacterial target gene RNA, only four mRNA genes were completely degraded 72 h after death. Specifically, the LexA and Portal genes were detectable within 6 h after heat treatment and disappeared after 12 h; the DnaJ gene was detectable within 12 h and disappeared after 24 h; and the Ami gene was detectable within 48 h and disappeared after 72 h. The remaining 13 target genes (12 mRNA genes and 16S rRNA gene) were still detectable within 72 h after heat treatment, indicating that these 13 target gene RNAs were relatively stable and difficult to completely degrade after pathogen death (see [link to relevant documentation]). Figure 2 ).

[0082] The stability of the four screened mRNA genes (LexA, Portal, DnaJ, and Ami) was further evaluated using real-time fluorescence RT-qPCR. The results showed that the LexA gene detection results were consistent with those of conventional RT-PCR; it was detectable within 6 hours after inactivation and disappeared after 12 hours. Its Ct values ​​at 0 min and 6 h were approximately 24.2 and 28.4, respectively, indicating that the LexA gene mRNA gradually degraded after heat treatment and was completely degraded after 12 hours (see [link to relevant documentation]). Figure 3 a); The Ct values ​​for Portal, DnaJ, and Ami genes gradually increased from 0 h to 12 h after heat treatment lethality, and amplification signals were still present from 24 h to 72 h, but the Ct values ​​changed little, indicating that mRNA degradation occurred from 0 h to 12 h, and the degradation rate slowed down or residual mRNA affected the detection results from 24 h to 72 h (see [link to relevant documentation]). Figure 3 b d). Therefore, the LexA gene degrades the fastest after heat treatment and is completely degraded after 12 h, making it a potential target gene for activity detection.

[0083] 2.4 Specificity Analysis

[0084] The specificity of the selected primers and probes for the LexA gene was evaluated. A TaqMan real-time fluorescent RT-qPCR method established using primers LexA-1F and LexA-1R and probe LexA-1P showed specific amplification of four Pantoea stewartii subsp. stewartii strains (ATCC 29227, ATCC 29228, ATCC 29229, and ATCC 8199), with Ct values ​​ranging from 18 to 23. No amplification was observed in 13 strains of its close relatives, including P. stewartii subsp. indologenes, P. agglomerans, P. ananatis, and P. stewartii. No amplification was observed for Clavibactermichiganensis subsp. nebraskensis (maize blight), Pseudomonas syringae pv. pisi (pea blight), and P. savastanoi pv. (bean blight). Eighteen major plant pathogenic bacteria, including phaseolicola, showed no amplification response, and no amplification response was observed in healthy maize leaves, seeds, and the blank control (see [link to relevant documentation]). Figure 4 This indicates that the TaqMan real-time fluorescent RT-qPCR method established using primers LexA-1F, LexA-1R, and probe LexA-1P has good specificity.

[0085] 2.5 Sensitivity Analysis

[0086] Sensitivity tests were performed using sequentially diluted 10-fold PSS ATCC 29228 strain RNA as templates. The results showed that the Ct value for detecting RNA at a concentration of 20 fg / µL using TaqMan real-time fluorescent RT-qPCR was 35.22, while no fluorescence signal was detected for RNA at a concentration of 2 fg / µL (see...). Figure 5 a) The minimum detection concentration for PSS is 20 fg / µL. Results from conventional RT-PCR methods show that conventional RT-PCR methods are effective for PSS concentrations of 2×10⁻⁶ fg / µL. 4 RNA amplification at fg / µL yielded a clear target band of approximately 178 bp (see [link to relevant documentation]). Figure 5(b) No amplification band was observed for lower concentrations of RNA, meaning that the lowest concentration that can be detected by conventional RT-PCR is 2×10⁴ fg / µL. This indicates that the sensitivity of the TaqMan real-time fluorescent RT-qPCR method for detecting PSS LexA gene mRNA is 1000 times that of the conventional RT-PCR method.

[0087] 2.5 Practical Sample Testing Applications

[0088] Actual sample testing results showed that, when RNA was extracted from the samples, the TaqMan real-time fluorescent RT-qPCR method targeting LexA gene mRNA established in this study yielded results consistent with traditional isolation and culture methods for 20 samples. Five samples of infected maize seeds tested positive, while the remaining 15 samples were negative. However, when DNA was extracted from the samples, real-time fluorescent PCR targeting LexA gene DNA detected 10 positive samples, including five inactivated infected maize seeds (see Table 4). These results indicate that the TaqMan real-time fluorescent RT-qPCR method targeting LexA gene mRNA established in this study can rapidly distinguish between live and dead PSS strains in samples.

[0089] Table 4. Detection results of samples by real-time fluorescence RT-qPCR and PCR methods.

[0090]

[0091]

[0092] Note: Ct±SD: Cycle threshold Ct (mean of 3 replicates) ± standard deviation; N / A: No Ct value after 40 cycles of amplification; NC: Negative control; PC: Positive control; CK: Blank control.

[0093] In summary, this invention, through comparative genomic analysis, screened mRNA genes related to replication, transcription, and metabolic activities, evaluated their stability after inactivation, and established a real-time fluorescent RT-qPCR system for detecting live PSS bacteria of maize, which can specifically and effectively amplify live PSS bacteria carried in samples.

[0094] The embodiments described above are merely preferred embodiments of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the appended claims.

Claims

1. A real-time fluorescent RT-qPCR detection method for live bacteria of *Fusarium wilt*, the causal agent of maize bacterial wilt, characterized in that, Includes the following steps: S1. Screening for key genes; S2. Design primers and probes for key genes; S3. Assess the stability of key gene mRNA after inactivation and identify target genes; The target gene is the LexA gene with a nucleotide sequence as shown in SEQ ID NO: 1; S4. A real-time fluorescent RT-qPCR detection method was established using the primers and probes corresponding to the target genes screened in step S3. The primers corresponding to the target gene include: the upstream primer LexA-1F with a nucleotide sequence as shown in SEQ ID NO: 2 and the downstream primer LexA-1R with a nucleotide sequence as shown in SEQ ID NO: 3; The probe used in conjunction with the primer is the probe LexA-1P with the nucleotide sequence shown in SEQ ID NO:

4.

2. The real-time fluorescence RT-qPCR detection method according to claim 1, characterized in that, The real-time fluorescence RT-qPCR reaction system comprises: 12.5 μL of 2×One Step PrimeScript RT-qPCR Mix, 0.5 μL each of 10 μmol / L upstream and downstream primers and probes, 1.0 μL of RNA template, and RNase-free ddH2O to a final volume of 20 μL.

3. The real-time fluorescence RT-qPCR detection method according to claim 1, characterized in that, The reaction program for the real-time fluorescent RT-qPCR was as follows: reverse transcription at 42℃ for 5 min; pre-denaturation at 94℃ for 10 s; denaturation at 94℃ for 5 s; annealing at 60℃ for 60 s; 40 cycles.

4. The real-time fluorescence RT-qPCR detection method according to claim 1, characterized in that, The screening of key genes specifically involves: downloading the genome and encoded amino acid sequence data of the PSS strain and four similar species that have completed chromosome-level assembly from the GenBank database; performing whole-genome homologous gene clustering analysis using the online software OrthoVenn2 to screen out PSS-specific gene clusters; and screening for relevant key genes related to replication, transcription, or metabolism based on the gene function annotation results.

5. The real-time fluorescence RT-qPCR detection method according to claim 4, characterized in that, The PSS strain is DC283, and the four similar species are P. stewartii subsp. indologenes strain LMG 2671, P. agglomerans strain FDARGOS 1447, P. allii strain PNA, and P. ananatis strain PA13.

6. The application of the real-time fluorescence RT-qPCR detection method according to any one of claims 1-5, characterized in that, The method is applied to the detection of live bacteria of Fusarium wilt in maize seeds.

Citation Information

Patent Citations

  • Primer and probe for recombinase-mediated isothermal amplification detection, kit and application

    CN112280876A

  • Specific primer, probe and real-time fluorescent quantitative PCR detection kit for detecting erwinia stewartii

    CN113337623A