A dual-color aggregation-induced emission composite imaging probe for acrylamide detection and toxicity evaluation and use method thereof

Abstract

The application discloses a two-color aggregation-induced emission composite imaging probe for acrylamide detection and toxicity evaluation and a use method, and belongs to the field of food safety biotechnology. A two-color composite probe and a detection kit are constructed, and in-vitro high-sensitivity detection of AA and miR-21 and simultaneous imaging in cells are successfully realized. The application can realize synchronous imaging of AA and target biomolecules in cells, can reveal the response relationship of AA and target molecules, and can understand the pathogenic mechanism of AA. This is helpful for taking timely and effective measures to reduce the risk exposure. The LOD of the detection of AA is 0.042 nM, and the LOD of the detection of miR-21 is 6 fM.

Description

Technical Field

[0001] This invention relates to a dual-color aggregation-induced emission composite imaging probe for acrylamide detection and toxicity assessment, and its application method, belonging to the field of food safety biotechnology. Background Technology

[0002] Since the discovery and first report of acrylamide (AA) contamination in fried or oven-cooked carbohydrate-rich foods in 2002, foodborne AA contamination has attracted increasing public attention. Today, the presence of AA in heat-processed foods is becoming a global health problem, with the International Agency for Research on Cancer (IARC) classifying it as a possible human carcinogen. Due to its neurotoxicity, genotoxicity, reproductive toxicity, and carcinogenicity, countries have established limits for AA in food to ensure food safety and protect human health. This also places higher demands on the accurate and sensitive detection of AA in food. Although biosensors for rapid AA detection have been developed in recent years, these studies on AA detection have remained extracellular. However, given the high toxicity and widespread distribution of AA, in-depth research on the interaction between AA and cells and its toxicological mechanisms is necessary. For toxicity assessment of hazardous substances, detecting changes in the levels of their target biomarkers is a common method. Previous studies have shown that AA stimulation can alter the levels of intracellular biomarkers in cell signaling pathways, including microRNA (miR), caspase 3, GSH, and ROS. miRNAs, as important diagnostic and prognostic biobeacons, have been reported to participate in various biological processes and are closely related to the occurrence of diseases such as cancer. Studies have shown that adenosine monophosphate (AA) can induce HepG2 cell proliferation by upregulating miR-21 expression. However, traditional microRNA detection methods, including microarray methods, Northern blotting, and qRT-PCR, require the extraction of miRNAs from cells during the detection process, which is time-consuming, complex, and prone to target loss. Fluorescence imaging technology can solve this problem by introducing fluorescent probes for in-situ visualization of miRNAs. Furthermore, given the low expression of miRNAs, they are often combined with signal amplification strategies. Nucleic acid signal amplification is widely used in DNA-based biosensors due to its high amplification efficiency, good biocompatibility, high stability, and good programmability. These methods include rolling circle amplification (RCA), hybridization chain reaction (HCR), and catalytic hairpin assembly (CHA). HCR and CHA can be performed under mild conditions without the need for enzymes, making them applicable to complex biological environments.

[0003] Currently, the toxicology of amino acids (AA) has been studied using fluorescence imaging techniques, but these studies only involve single imaging of AA biomarkers. Due to the lack of studies simultaneously imaging intracellular AA and its inducible biomarkers, limited information about AA is provided, making it difficult to demonstrate the intracellular interaction between AA and miRNAs. Furthermore, the lack of corresponding recognition molecules to capture AA makes AA imaging in cells challenging. Therefore, this invention introduces an aptamer for AA to simultaneously image intracellular AA and its target biomolecules, revealing the response relationship between AA and its target molecules and elucidating the pathogenesis of AA.

[0004] On the other hand, to achieve simultaneous imaging of intracellular amino acids (AAs) and microRNAs, multicolor fluorescent probes need to be constructed. Since Academician Tang Benzhong proposed aggregation-induced emission (AIE) in 2001, it has attracted considerable attention from researchers. It overcomes the aggregation-induced quenching (ACQ) phenomenon present at high concentrations of traditional fluorescent dyes, which greatly limits their practical applications. However, the hydrophobicity of AIE dyes restricts their application in the biological field. Therefore, assembling them with amphiphilic molecules into nanoparticles can improve their hydrophilicity, allowing for better internalization into cells. These biocompatible aggregation-induced emission nanoparticles offer the possibility of simultaneous imaging of AAs and their target biobeacons within cells. Summary of the Invention

[0005] The metabolism and toxicity of hazardous substances within cells are dynamic processes involving multiple molecules. However, existing fluorescence imaging studies only collect single indicators to display information and status of cellular biomarkers, lacking in-depth understanding of simultaneous identification and tracking of multiple targets and their continuous dynamic changes over time. Furthermore, the lack of literature elucidating the relationship between amino acids (AAs) and their biological beacons makes it difficult to comprehensively reveal the intracellular interactions between AAs and miRNAs, hindering a comprehensive and systematic assessment of AA toxicity and analysis of its toxicological mechanisms.

[0006] This invention develops a method for monitoring amino acids (AA) and AA-induced miR-21 in cells to assess the cytotoxic effects of AA. This method has advantages such as simple probe preparation, good selectivity, and high sensitivity. This technology can be used to track AA and AA-induced miR-21 in living cells in real time, explore the intrinsic response relationship between AA and miR-21, and assess the cytotoxicity of AA.

[0007] The first objective of this invention is to provide a method for preparing a two-color aggregation-induced composite probe, the method comprising the following steps:

[0008] (1) Mix equal amounts of AIE dye A and styrene-maleic anhydride copolymer (PSMA) solution, dilute with tetrahydrofuran (THF), and ultrasonically mix with deionized water to remove THF. Filter to obtain AIE nanoparticles R-AIENPs. Mix equal amounts of AIE dye B and PSMA solution and use the same method to obtain AIE nanoparticles G-AIENPs.

[0009] (2) The AIE nanoparticles and hairpin DNA prepared in step (1) were ligated by an amide reaction catalyzed by EDC / NHS to obtain mixed solutions 1a and 1b, resulting in a two-color aggregation-induced composite probe; the hairpin DNA includes H 1a and H 1b Among them, AIE nanoparticles R-AIENPs and H 1a Connection, AIE nanoparticles G-AIENPs with H 1b connect.

[0010] In one embodiment of the present invention, in step (1), the AIE dye A or AIE dye B is any two AIE dyes with different fluorescence.

[0011] In one embodiment of the present invention, in step (1), the mass ratio of PSMA to AIE dye is (0.5-1.5):1.

[0012] In one embodiment of the present invention, in step (1), the ultrasound time is 3-8 minutes.

[0013] In one embodiment of the present invention, in step (1), nitrogen is used to purify and remove THF.

[0014] In one embodiment of the present invention, in step (2), the H 1a The sequence is: NH2-TGG TGGATGAGTGTG TGG CCA CGT GGATTT CAT TCA GCT TTT TTT TTTAAATCC ACG TGG CCACACACT (SEQ ID NO. 1); the H 1b The sequence is NH2-TCAACA TCA GTC TGA TAA GCT ACC CAT GCG ATC TTT TTTTTT TGA TCG CAT GGG TAG CTTATCAGA (SEQ ID NO.2).

[0015] In one embodiment of the present invention, in step (2), EDC and NHS are dissolved in buffer solution, then mixed evenly with AIE nanoparticles to activate the nanoparticles, hairpin DNA is added, mixed and incubated, and then ultrafiltered to remove impurities.

[0016] In one embodiment of the present invention, the molar ratio of the EDC / NHS is (1-3):1.

[0017] In one embodiment of the present invention, the concentration of the hairpin DNA is 100 nM-2 μM.

[0018] In one embodiment of the present invention, the buffer solution is either PBS buffer solution (10mM, pH 7.4, 137mM NaCl) or SPSC buffer solution (0.75mM NaCl, 50mM Na2HPO4, pH 7.4).

[0019] In one embodiment of the present invention, activation is performed at 25-37°C for 0.5-2 hours.

[0020] In one embodiment of the present invention, the incubation is carried out at 25-37°C for 1-5 hours.

[0021] A second objective of this invention is to provide a two-color aggregation-induced composite probe prepared according to the above method.

[0022] A third objective of this invention is to provide a kit for the simultaneous detection of AA and miR-21, the kit containing the aforementioned dual-color aggregation-induced composite probe and H... 2a H 2b Apt and cDNA.

[0023] In one embodiment of the present invention, the H 2a The sequence is: AGT GTG TGG CCACGTGGATTTAAAAAAAAA AGC TGAATGAAATCCACG TGG CCACAC ACT CAT CCACCA–BHQ1 (SEQ IDNO.3).

[0024] In one embodiment of the present invention, the H 2b The sequence is: TCT GATAAG CTACC CAT GCGATCAAAAAAA AAAGAT CGC ATG GGTAGC TTATCAGAC TGATGT TGA-BHQ3 (SEQ ID NO.4).

[0025] In one embodiment of the present invention, the Apt sequence is: CAG TCCAGGACAGAT TCG CGAGTGGTC GTG GTG AGG TGC GTG TAT GGG TGG TGG ATG AGT GTG TGG CCA CGT GGA TTT CATTCA GCG ATT (SEQ ID NO.5).

[0026] In one embodiment of the present invention, the cDNA sequence is: GC TGAATGAAATCC ACG TGGCCACACACT CAT CCACCA (SEQ ID NO. 6).

[0027] The fourth objective of this invention is to provide a method for simultaneously detecting AA and miR-21 in vitro, wherein the method utilizes the aforementioned kit to detect AA and miR-21.

[0028] In one embodiment of the present invention, the method steps are as follows:

[0029] (5) Add H to the mixed solution 1a in the dual-color aggregation-inducing composite probe. 2a Solution, add H to mixed solution 1b 2b The solutions were analyzed to obtain mixed solutions 1a-2a and 1b-2b.

[0030] (6) Mix equal volumes of Apt aqueous solution and cDNA aqueous solution, and incubate at 25℃–40℃ for 0.1–1 h to obtain Apt / cDNA hybridization strand solution;

[0031] (7) Add the Apt / cDNA hybridization chain solution prepared in step (2) to the mixed solutions 1a-2a and 1b-2b in step (1) respectively to obtain mixed solutions 1a-2a-Apt / cDNA and 1b-2b-Apt / cDNA;

[0032] (8) Add the test sample to the mixed solutions 1a-2a-Apt / cDNA and 1b-2b-Apt / cDNA prepared in step (3), wherein the mixed solution 1a-2a-Apt / cDNA and the test sample are incubated for 55-65 min to detect AA, and the mixed solution 1b-2b-Apt / cDNA and the test sample are incubated for 35-45 min to detect miR-21.

[0033] In one embodiment of the present invention, in step (1), the mixed solution 1a and solution H 2a The volume ratio of the solution is (8:1)-(1:1).

[0034] In one embodiment of the present invention, in step (1), the mixed solution 1b and H 2b The volume ratio of the solution is (8:1)-(1:1).

[0035] In one embodiment of the present invention, in step (1), the H 2a The concentration is 200nM-800nM.

[0036] In one embodiment of the present invention, in step (1), the H 2b The concentration is 100nM-400nM.

[0037] In one embodiment of the present invention, in step (2), the concentration of Apt is 0.5 μM-1.5 μM and the concentration of cDNA is 0.5 μM-1.5 μM.

[0038] In one embodiment of the present invention, in step (3), the volume ratio of the mixed solution 1a-2a or 1b-2b to the Apt / cDNA hybridization chain solution is (9:1)-(2:1), and the concentration is 20-100nM.

[0039] The fifth object of the present invention is to provide a method for detecting AA cytotoxicity, the method not intended for disease diagnosis, comprising the following steps:

[0040] (1) Seed the cells to be tested in a laser confocal culture dish and incubate them to allow the cells to adhere and grow.

[0041] (2) Add basic culture medium containing the dual-color aggregation-inducing composite probe to the adherent cells obtained in step (1) for incubation;

[0042] (3) H 2a H 2b Mix with Apt / cDNA and transfect into the cells from step (2), incubate for a certain period of time, and discard the supernatant.

[0043] (4) Fix the cells from step (3) with fixative and perform fluorescence imaging.

[0044] In one embodiment of the present invention, in step (2), the dual-color aggregation-inducing composite probe is diluted to 1 to 5 times and then added to the basic culture medium.

[0045] In one embodiment of the present invention, in step (2), the incubation time is 2-8 hours.

[0046] In one embodiment of the present invention, in step (3), the incubation time is 4-10 hours.

[0047] In one embodiment of the present invention, in step (3), H 2a The concentration is 10-200 nM.

[0048] In one embodiment of the present invention, in step (3), H 2b The concentration is 10-200 nM.

[0049] In one embodiment of the present invention, in step (3), the concentration of Apt / cDNA is 10-200 nM.

[0050] Optionally, different concentrations of AA are added to the cells in step (3) and incubated for 0–12 h, followed by fixation with fixative and fluorescence imaging.

[0051] In one embodiment of the present invention, in step (4), the fixative is selected from any one of 4% paraformaldehyde, acetone, 95% ethanol, and formaldehyde.

[0052] In one embodiment of the present invention, in step (4), fluorescence imaging is performed using a high-resolution laser confocal microscope.

[0053] The principle behind this invention, which utilizes the dual-color aggregation-inducing composite probe to simultaneously monitor intracellular AA and AA-induced miR-21 in live cells for visual assessment of AA cytotoxicity, is as follows:

[0054] The working principle of AA and miR-21 based on dual-color AIENPs detection and imaging is described in [link to documentation]. Figure 1 Two-color nanoparticles (AIENPs) were synthesized using AIE dye and the amphiphilic polymer PSMA. The prepared AIENPs contained a large number of carboxyl groups, exhibiting good water solubility. They could be combined with amino-labeled DNA strands via an amide reaction to obtain AIENPs-Hn complexes. Considering that free DNA strands have difficulty crossing cell membranes to enter cells, Hn was transported via liposomes. 2a H 2b Apt / cDNA is transfected into cells to complete the intracellular CHA cycle, amplifying the signal. Furthermore, the AIENPs-Hn complex can enter cells via endocytosis. Since CHA can occur under mild conditions and does not require enzymes, it can also proceed smoothly in biological environments. For cellular imaging of AA, the AA aptamer is first hybridized to its complementary strand to form an Apt / cDNA hybrid. Upon addition of AA, the aptamer tends to bind to AA, leading to cDNA dissociation, which then interacts with Hn attached to R-AIENPs. 1a Hybridization. Subsequently, BHQ3-labeled H 2a With H 1aHybridization leads to cDNA translocation and entry into the next cycle, while simultaneously bringing BHQ3 closer to R-AIENPs. Fluorescence resonance energy transfer (FRET) occurs, resulting in fluorescence quenching of R-AIENPs. For cellular imaging of miR-21, incubation with AA and HepG2 within the appropriate concentration range induces miR-21 overexpression, and miR-21 can directly bind to H+ on G-AIENPs. 1b Hybridization, then BHQ1-labeled H 2b The fluorescence of G-AIENPs can be quenched. Therefore, the fluorescence of the dual-color nanoparticles gradually weakens, indicating a change in the concentrations of AA and miR-21 in the cells. This further clarifies the relationship between AA and the miR-21 response.

[0055] Beneficial effects:

[0056] (1) This invention synthesizes and constructs a red / green dual-color composite probe, enabling highly sensitive in vitro detection of AA and miR-21 as well as simultaneous intracellular imaging. Compared to traditional fluorescence imaging studies that only collect a single indicator to display information and status of cellular biomarkers, this invention simultaneously images intracellular AA and its target biomolecules, revealing the response relationship between AA and its target molecules and understanding the pathogenic mechanism of AA. This helps to take timely and effective measures to reduce one's own risk exposure.

[0057] (2) To address the problem of low expression levels of miRNA in cells, the method of this invention combines the CHA reaction with cell imaging technology to amplify the miR-21 signal and improve sensitivity. It has advantages such as simple reaction principle and mild reaction conditions.

[0058] (3) In the detection of AA and miR-21, the sensitivity reached the pM level and fM level respectively, which are lower detection limits or wider linear ranges compared with the currently reported methods; the LOD for detecting AA is 0.042 nM and the LOD for detecting miR-21 is 6 fM.

[0059] (4) The present invention uses PSMA as an amphiphilic polymer to encapsulate AIE material, which has advantages such as low cost and availability, strong hydrophilicity, high biocompatibility and low cytotoxicity compared with reported materials such as polystyrene and chitosan.

[0060] (5) The present invention optimizes the ratio of AIE nanoparticles to corresponding hairpin DNA, so that hairpin DNA can be loaded onto AIE nanoparticles as much as possible, thereby improving the detection sensitivity.

[0061] (6) The cell imaging method based on the dual-color composite probe of the present invention has high sensitivity, low cost and low radioactivity. It can monitor AA-induced cytotoxicity in situ, conveniently, in real time and with visualization, enriching the means of assessing AA toxicity and providing early warning means for food safety. Attached Figure Description

[0062] Figure 1 Working principle of dual-color aggregation-induced imaging probe;

[0063] Figure 2 Characterization of dual-color aggregation-induced nanoparticles: A, Transmission electron microscopy image of R-AIENPs; B, Transmission electron microscopy image of G-AIENPs; C, Fluorescence intensity of R-AIENPs; D, Fluorescence intensity of G-AIENPs.

[0064] Figure 3 Zeta potential characterization of DNA successfully coupled to two-color gold nanoclusters, A, R-AIENPs-H 1a Zeta potential characterization, B, G-AIENPs-H 1b Zeta potential characterization;

[0065] Figure 4 The detection performance of dual-color aggregation-induced nanoprobes: A, Effect of AA concentration on the fluorescence intensity of R-AIENPs; B, Effect of miR-21 concentration on the fluorescence intensity of G-AIENPs; C, Effect of AA concentration on the fluorescence intensity of R-AIENPs; D, Effect of miR-21 concentration on the fluorescence intensity of G-AIENPs; E, Linear relationship between F / F0 and AA concentration; F, Linear relationship between F / F0 and miR-21 concentration; G, Specific detection of R-AIENPs; H, Specific detection of G-AIENPs.

[0066] Figure 5 Dual-color aggregation induces cytotoxicity of nanoprobes;

[0067] Figure 6 AA's cytotoxicity;

[0068] Figure 7 Imaging of dual-color aggregation-induced nanoprobes: A, fluorescence imaging at different AA incubation times; B, fluorescence imaging at different AA incubation concentrations. Detailed Implementation

[0069] Example 1: Preparation of a dual-color aggregation-induced composite probe

[0070] (1) Preparation of dual-color AIE nanoparticles:

[0071] AIENPs were synthesized using AIE dyes (TPETPAFN, TCBPE) and PSMA as raw materials.

[0072] Red / green bicolor nanoparticles TPETPAFN-PSMA and TCBPE-PSMA were prepared using a nanoprecipitation method. The specific preparation method for TPETPAFN-PSMA AIENPs (R-AIENPs) is as follows: 200 μL of TPETPAFN solution (1 mg / ml, THF) and 200 μL of PPSMA solution (1 mg / ml, THF) were mixed, then diluted to 1 ml with THF and mixed with 5 ml of deionized water under strong sonication for 5 min. The liquid was then purified with nitrogen for 1 h to remove THF. Aggregates formed during the preparation process were removed using a 0.22 μm filter to obtain AIE nanoparticles R-AIENPs, which were stored at 4 °C for later use. AIE nanoparticles TCBPE-PSMA (G-AIENPs) were prepared by mixing TCBPE and PPSMA solutions using the same method.

[0073] AIENPs (R-AIENPs, G-AIENPs) were characterized by transmission electron microscopy, such as... Figure 2 A and Figure 2 As shown in Figure B, the prepared AIENPs were highly dispersed spheres, with R-AIENPs having an average particle size of 38.4 ± 4.1 nm and G-AIENPs having an average particle size of 42.3 ± 5.2 nm. The AIE dyes TPETPAFN and TCBPE exhibited weak luminescence in THF, with the fluorescence intensity significantly increasing with increasing water content. This is mainly due to the hydrophobicity of AIE dyes, which allow them to dissolve well in THF and exhibit high dispersibility, resulting in weak fluorescence. As water was continuously added to the system, the proportion of THF decreased, leading to the accumulation of AIE dyes and a significant increase in fluorescence intensity. This result also verifies the aggregation-induced luminescence characteristics of the two dyes. The fluorescence was subsequently observed under 365 nm UV light. Figure 2 C and Figure 2 As shown in Figure D, the fluorescence intensity of AIENPs prepared with PSMA assistance is much stronger than that of AIE dyes (AIEgen). The photophysical information of the prepared nanoparticles is presented through absorption and fluorescence spectra. The main absorption range of R-AIENPs is 450–550 nm, and that of G-AIENPs is 250–360 nm, which is basically consistent with the excitation spectrum.

[0074] (2) Coupling of AIE nanoparticles with hairpin DNA

[0075] AIE nanoparticles reacted with hairpin DNA (H) via EDC / NHS catalysis 1a or H 1bThe specific experimental procedure for the combination of [unspecified ingredients] was as follows: 25 μL of EDC (10 mg / mL) and 25 μL of NHS (5 mg / mL) were dissolved in PBS (pH 7.4, 10 mM), then mixed thoroughly with 200 μL of L-AIENPs, and incubated at 37°C with shaking for 1 h to fully activate the nanoparticles. Then, 50 μL of H [unspecified ingredient] was added. 1a Mix (1 μM) thoroughly and incubate at 37°C for 3 h. Then transfer the reaction solution to a 30 kDa ultrafiltration tube and centrifuge at 8000 r / min for 5 min to remove unbound H+. 1a The prepared R-AIENPs-H 1a Store at 4℃ for later use. Prepare G-AIENPs-H using the same method. 1b .

[0076] During the preparation process, the maleic anhydride exposed in the PSMA of the AIE nanoparticles was further hydrolyzed, resulting in a large number of carboxyl groups on the surface of the prepared nanoparticles. This allows AIENPs to link amino-modified DNA strands via a simple amide reaction. The binding of hairpin DNA to the two-color AIENPs was characterized using zeta potentials. Figure 3 A and Figure 3 B). AIE dyes and PSMA have different degrees of positive and negative charges. After being synthesized into electrically neutral nanoparticles, with the attachment of corresponding DNA hairpins, the hairpin DNA carries a negative charge, R-AIENPs-H 1a and G-AIENPs-H 1b The zeta potentials decreased to -15.95±0.78 mV and -15.00±0.57 mV, respectively. These zeta potential results indicate that the hairpin DNA successfully ligated to AIENPs via a chemical reaction between amino and carboxyl groups.

[0077] Example 2: A dual-color aggregation-induced composite probe for detecting in vitro AA and miR-21

[0078] (1) Optimization of the dual-color AIE composite probe in vitro detection system

[0079] Apt / cDNA hybridization solution: Mix 100 μL (1 μM) of Apt aqueous solution with 100 μL (1 μM) of cDNA aqueous solution in a centrifuge tube and incubate at 37°C for 0.5 h to obtain Apt / cDNA hybridization solution.

[0080] To further improve the sensitivity of the probe, H 2a and H 2b The reaction concentration was optimized.

[0081] For H 2aConcentration optimization was performed by taking 200 μL of R-AIENPs-H 1a Add 50 μL of cDNA (10 nM), followed by 50 μL of H at different concentrations. 2a The mixture was incubated at 37°C for 1 hour, and the fluorescence intensity of the mixture was measured after the reaction was complete.

[0082] For H 2b Concentration optimization was performed by taking 200 μL of G-AIENPs-H 1b Add 50 μL miR-21 (10 nM), followed by 50 μL of H2 at different concentrations. 2b The mixture was incubated at 37°C for 1 hour, and the fluorescence intensity of the mixture was measured after the reaction was complete.

[0083] For the R-AIENPs system, when H 2a When the concentration is in the range of 0-400 nM, the fluorescence of R-AIENPs increases with H. 2a The concentration gradually decreases with increasing H₂O. When the concentration reaches 400 nM, the decrease is further reduced with increasing H₂O. 2a With increasing concentration, the fluorescence in the system no longer changes significantly, therefore H... 2a The operating frequency is set to 400 nm. For the G-AIENPs system, when H... 2b When the concentration reaches 200 nM, the fluorescence of the G-AIENPs system no longer varies with H. 2b The concentration changed significantly, therefore H 2b The working concentration was set to 200 nM.

[0084] The optimized system is as follows: 200 μL of R-AIENPs-H 1a Add the solution to the centrifuge tube, then add H2O. 2a The solution (final concentration 400 nM, 25 μL) was mixed, and then Apt / cDNA hybridization strand solution (final concentration 100 nM, 25 μL) was added to obtain the R-AIENPs mixed solution system; similarly, 200 μL of G-AIENPs-H was pipetted. 1b Add the solution to the centrifuge tube, then add H2O. 2b The solution (final concentration 200 nM, 50 μL) was used to obtain a G-AIENPs mixed solution system.

[0085] (2) Optimization of reaction time

[0086] Add 50 μL of LAA (1 mM) standard solution to the R-AIENPs mixed solution system prepared in step (1); add 50 μL of miR-21 (10 nM) standard solution to the G-AIENPs mixed solution system prepared in step (1); and then measure the fluorescence intensity of the two mixed systems at different times.

[0087] The fluorescence of both R-AIENPs and G-AIENPs gradually decreased over time. The fluorescence of the R-AIENPs mixed solution reached its lowest point after 60 min, and thereafter, the fluorescence showed no significant change with further reaction time, indicating the completion of the CHA cycle. The fluorescence of the G-AIENPs mixed solution reached its lowest level at 40 min, and then remained essentially constant over time. Therefore, the incubation times for AA and miR-21 were determined to be 60 min and 40 min, respectively. The longer incubation time for AA is because AA needs to bind to the Apt / cDNA complex first, causing the cDNA to detach from the Apt / cDNA complex, thus initiating the CHA cycle. In contrast, miR-21 incubation only requires adding miR-21 to the system. The CHA cycle can be directly triggered, the reaction is more direct, and the reaction time is correspondingly shorter.

[0088] (3) In vitro detection performance

[0089] In the R-AIENPs mixed solution system prepared in step (1), 50 μL of AA standard solution of different concentrations was added, mixed evenly, and incubated at 37℃ for 1 h. After the reaction was completed, the fluorescence intensity of R-AIENPs in the mixed solution was directly measured using an F-7000 fluorescence spectrophotometer. The detection of miR-21 was basically the same as that of AA. In the G-AIENPs mixed solution system prepared in step (1), 50 μL of miR-21 standard solution of different concentrations was added, mixed evenly, and incubated at 37℃ for 40 min. After the reaction was completed, the fluorescence intensity of G-AIENPs in the mixed solution was measured.

[0090] Test results as follows Figure 4 As shown, different concentrations of AA were first tested. Figure 4 A and Figure 4 As shown in Figure C, when the AA concentration is low, the fluorescence intensity of R-AIENPs does not change significantly, but as the AA concentration increases, the fluorescence intensity of R-AIENPs gradually decreases. Figure 4E showed a good linear relationship between F / F0 (F0: initial fluorescence intensity of the dual-color composite probe R-AIENPs; F: fluorescence intensity of the dual-color composite probe R-AIENPs after reaction) and the logarithm of AA concentration in the range of 1–1000 nM. The fitted equation was y = -0.1557lgCAA + 0.9598 (R² = 0.9931), with a LOD of 0.042 nM (3σ / k). Meanwhile, the fluorescence of G-AIENPs gradually decreased with increasing miR-21 concentration. Figure 4 B and Figure 4 D). Figure 4 F shows that in the range of 0.01 pM to 10 nM, F / F0 (F0: initial fluorescence intensity of the dual-color composite probe G-AIENPs; F: fluorescence intensity of the dual-color composite probe G-AIENPs after reaction) has a linear relationship with the logarithm of miR-21 concentration, and the fitted equation is y = -0.1106lgCmiR-21 + 0.2593 (R2 = 0.9942), with a LOD of 6 fM (3σ / k).

[0091] (4) Specificity

[0092] Next, the specificity of the two-color nanoparticles in detecting AA and miR-21 was investigated.

[0093] Specificity experiment of AA: In the R-AIENPs mixed solution system prepared in step (1), 50 μL of 1000 nM acrylic acid, methacrylic acid, methacrylamide, propionic acid, carboxymethyl lysine and carboxyethyl lysine standard solutions were added respectively, mixed evenly, and incubated at 37℃ for 1 h. After the reaction was completed, the fluorescence intensity of R-AIENPs in different mixed solutions was directly measured using an F-7000 fluorescence spectrophotometer.

[0094] Specificity experiment of miR-21: In the G-AIENPs mixed solution system prepared in step (1), 50 μL of 10 nM miR-21 single mismatched base, double mismatched base, miR-26a, miR-141, miR-155 and miR-203 standard solutions were added respectively, mixed evenly, and incubated at 37℃ for 40 min. After the reaction was completed, the fluorescence intensity of G-AIENPs in the mixed solution was measured.

[0095] like Figure 4As shown in G, the fluorescence intensity of R-AIENPs only decreased significantly in the presence of AA, while no significant changes were observed in AA structural analogs and other products that may occur during food thermal processing, indicating that the dual-color composite probe has good selectivity for AA. The specificity of miR-21 was verified by selecting DNA with a base sequence mismatch with miR-21 and microRNAs that may coexist with miR-21 in cells. The selectivity results of dual-color AIENPs for miR-21 are shown in Figure G. Figure 4 As shown in Figure H, the fluorescence intensity of G-AIENPs was significantly reduced only in the presence of miR-21, which also demonstrates the specificity of this method in detecting miR-21.

[0096] Example 3: Dosage optimization of dual-color aggregation-inducing composite probe and AA

[0097] (1) Dosage optimization of dual-color aggregation-induced composite probe

[0098] Since the synthesized material is in liquid form and difficult to separate directly, the cytotoxicity of AIENPs was studied by directly diluting the AIENPs prepared in Example 1 to different multiples using DMEM medium.

[0099] HepG2 cells were seeded into 96-well plates and cultured in DMEM medium containing 10% fetal bovine serum (FBS) and 5% penicillin-streptomycin antibiotics. 100 μL was seeded per well, and the culture time was 8 × 10⁶ cells / well. 4 Cells / mL. Cells were cultured at 37℃ and 5% CO2 for 24 h. After complete cell adhesion, the culture medium was discarded, and the cells were washed three times with PBS. Then, DMEM medium containing different concentrations of AIENPs was added, and the cells were cultured for another 24 h at 37℃ and 5% CO2. After incubation, 10 μL of CCK-8 reagent was added to each well, and the cells were incubated for 3 h under the same conditions. The absorbance at 450 nm was then measured in each well using a microplate reader. Five replicates were set up for each group. Cell viability was calculated using the formula: Cell viability (%) = (Absorbance of experimental wells - Absorbance of blank wells) / (Absorbance of control wells - Absorbance of blank wells) × 100%.

[0100] The results are as follows Figure 5 As shown, after co-incubating HepG2 cells with AIENPs at different dilutions, cell viability remained at approximately 100%, indicating that the cytotoxicity of AIENPs was negligible. Therefore, to allow more AIENPs to enter the cells while maintaining good HepG2 cell morphology, AIENPs were diluted 4-fold in DMEM medium as the concentration for subsequent experiments.

[0101] (2) Dosage optimization of AA

[0102] HepG2 cells were seeded into 96-well plates and cultured in DMEM medium containing 10% fetal bovine serum (FBS) and 5% penicillin-streptomycin antibiotics. 100 μL was seeded per well, and the culture time was 8 × 10⁶ cells / well. 4 Cells / mL. Cells were cultured at 37℃ and 5% CO2 for 24 h. After complete cell adhesion, the culture medium was discarded, and the cells were washed three times with PBS. Then, DMEM medium containing different concentrations of AA was added, and the cells were cultured for another 24 h at 37℃ and 5% CO2. After incubation, 10 μL of CCK-8 reagent was added to each well, and the cells were incubated for 3 h under the same conditions. Then, the absorbance of each well at 450 nm was measured using a microplate reader. Five replicates were set up for each group. Cell viability was calculated using the formula: Cell viability (%) = (Absorbance of experimental wells - Absorbance of blank wells) / (Absorbance of control wells - Absorbance of blank wells) × 100%.

[0103] like Figure 6 As shown, when the AA concentration is less than 500 μM, it has virtually no toxic effect on HepG2 cells and even promotes their proliferation to some extent. This is mainly related to the mechanism of action of AA on HepG2 cells. The results also show that when the AA concentration is higher than 1 mM, the viability of HepG2 cells is significantly reduced, and miR-21 overexpression is no longer induced. Therefore, AA concentrations within the range of 0-500 μM were selected to observe the fluorescence of intracellular dual-color AIENPs.

[0104] Example 4 uses a dual-color gold nanocluster composite probe to monitor AA and AA-induced miR-21 in cells in real time, thereby assessing the toxicity of AA.

[0105] According to 5×10 4 500 μL of HepG2 single-cell suspension was seeded into laser confocal microscopy dishes at a density of 1:1 and cultured at 37°C and 5% CO2 for 24 h. Afterward, the complete culture medium was aspirated, and 500 μL of the dual-color composite probe AIENPs (R-AIENPs-H) prepared in Example 1 was added. 1a and G-AIENPs-H 1b The culture medium was soaked in DMEM for 4 hours. After incubation, the medium was removed, and the cells were washed several times with PBS. Lipofectamine 3000 (5 μL) was then used for liposome transfection. Lipofectamine 3000 (5 μL) was diluted to 500 μL with Opti-MEM and mixed with H... 2a (100nM), H 2bA mixture of 100 nM Apt / cDNA and 100 nM Apt / cDNA (10 μL each) was transfected into cells incubated with a dual-color composite probe and incubated for 6 h. After incubation, the culture medium was aspirated, and the cells were washed multiple times with PBS. One group was incubated for 0, 1, 2, 4, 8, and 12 h in DMEM medium containing 100 μM Apt / cDNA. After incubation, the culture medium was aspirated, the cells were washed three times with PBS, fixed with 4% paraformaldehyde for 15 min, and then subjected to fluorescence imaging under a high-resolution laser confocal microscope. In the other group, DMEM medium containing 0, 1, 10, 50, 100, and 500 μM Apt / cDNA was added, and the cells were incubated for 12 h. After incubation, the culture medium was aspirated, the cells were washed three times with PBS, fixed with 4% paraformaldehyde for 15 min, and then subjected to fluorescence imaging under a high-resolution laser confocal microscope.

[0106] The results showed that miR-21 and AA expression were time-dependent. Cell fluorescence intensity was observed after incubation with AA for 0-12 hours. The changes in intracellular dual-color AIENP fluorescence intensity over time under stimulation with a certain concentration of AA (100 μM) were investigated to explore the response relationship between intracellular AA and miR-21. Figure 7 As shown in Figure A, the fluorescence intensity of intracellular dual-color AIENPs gradually decreased with prolonged AA stimulation time. The figure shows that after 4 hours of AA incubation with cells, the fluorescence of R-AIENPs remained relatively stable, while the fluorescence of G-AIENPs remained stable between 4 and 8 hours. This is mainly because the overexpression of miR-21 induced by AA cell stimulation and the CHA cycle are time-dependent. Further observation of the effect of AA concentration on the fluorescence intensity of HepG2 cells is needed. Figure 7 As shown in Figure B, when the amount of AA added was 0 μM, the cells exhibited bright red fluorescence, while the green fluorescence intensity was relatively low. This is because a certain amount of intrinsic miR-21 in HepG2 cells triggered the CHA cycle, resulting in a slight decrease in green fluorescence. With increasing AA levels, the intracellular red fluorescence gradually weakened. This is mainly because AA led to the release of cDNA, initiating the CHA cycle, causing BHQ1 to approach R-AIENPs, and the fluorescence of red AIENPs gradually weakened. Simultaneously, the expression level of miR-21 in the cells increased with increasing AA, triggering another CHA cycle process, causing BHQ3 to approach G-AIENPs, and the fluorescence intensity of green AIENPs decreased.

[0107] Table 1: Comparison of the performance of this invention with other methods for AA detection

[0108]

[0109] Table 2: Comparison of miR-21 detection performance between the present invention and other methods

[0110]

[0111] [1]Z.Gan,W.Zhang,M.Arslan,X.Hu,X.Zhang,Z.Li,J.Shi,X.Zou,RatiometricFluorescent Metal–Organic Framework Biosensor for Ultrasensitive Detection ofAcrylamide,Journal of Agricultural and Food Chemistry,70(2022)10065-10074.

[0112] [2]R.Ali,M.M.El-Wekil,A dual-recognition-controlled electrochemicalbiosensor for selective and ultrasensitive detection of acrylamide in heat-treated carbohydrate-rich food,Food Chemistry,413(2023)135666.

[0113] [3]Y.Rong,M.M.Hassan,Q.Ouyang,Y.Zhang,L.Wang,Q.Chen,An upconversionbiosensor based on DNA hybridization and DNA-templated silver nanoclustersfor the determination of acrylamide,Biosensors and Bioelectronics,215(2022)114581.

[0114] [4]Y.Liu,S.Meng,J.Qin,R.Zhang,N.He,Y.Jiang,H.Chen,N.Li,Y.Zhao,Afluorescence biosensor based on double-stranded DNA and a cationic conjugatedpolymer coupled with exonuclease III for acrylamide detection,InternationalJournal of Biological Macromolecules,219(2022)346-352.

[0115] [5]M.A.El-Naka,A.El-Dissouky,G.Y.Ali,S.Ebrahim,A.Shokry,Fluorescentgarlic-capped Ag nanoparticles as dual sensors for the detection ofacetoneand acrylamide,RSC Advances,12(2022)34095-34106.

[0116] [6]Z.Lu,W.Ni,N.Liu,D.Jin,T.Li,K.Li,Y.Zhang,Q.Yao,G.-J.Zhang,CRISPR / Cas12a-based fluorescence biosensor for detection ofexosomal miR-21derivedfrom lung cancer,Microchemical Journal,187(2023)108370.

[0117] [7]L.-N.Huang,Z.-J.Zhong,Q.-J.Lu,F.Chen,L.-L.Xie,C.-Y.Wu,Y.-Y.Zhang,Simple Enzyme-Free Biosensor for Highly Sensitive and Selective DetectionofmiR-21Based on Multiple Signal Amplification Strategy,Journal ofAnalysisand Testing,6(2022)36-43.

[0118] [8] G.Sun, C.Chen, X.Li, S.Hong, C.Gu, X.Shi, Rapid microRNA detection method based on DNA strand displacement for ovarian cancer cells, Journal of Cancer, 14 (2023) 707-716.

[0119] [9] M.Shen, J.Shi, Z.Chen, S.Zhang, Z.Zhang, Self-assembly of DNA-hyperbranched aggregates catalyzed by a dual-targets recognition probe formiRNAs SERS detection in single cells, Biosensors and Bioelectronics, 222(2023)114997.

[0120]

[10] Y.Zhang,D.Luo,Y.Zhang,Q.-H.Zhang,Q.-Y.Ji,S.-K.Zhou,S.Huang,L.-l.Li,F.Lu,W.-F.Yao,F.-F.Cheng,J.-J.Zhu,L.Zhang,DNAzymes-conjugatedupconversion nanoamplicon for in-situ ultrasensitive detection and imaging of microRNA in vivo,Chemical Engineering Journal,454(2023)140489.

[0121] Example 5: Evaluation of AA cytotoxicity using a dual-color gold nanocluster composite probe.

[0122] According to 5×10 4 500 μL of the cell sample suspension to be tested was seeded into laser confocal microplates at a density of / dish and cultured at 37°C and 5% CO2 for 24 h. Afterwards, the complete culture medium was aspirated, and 500 μL of the dual-color composite probe AIENPs (R-AIENPs-H) prepared in Example 1 was added. 1a and G-AIENPs-H 1bThe culture medium was soaked in DMEM for 4 hours. After incubation, the medium was removed, and the cells were washed several times with PBS. Lipofectamine 3000 (5 μL) was then used for liposome transfection. Lipofectamine 3000 (5 μL) was diluted to 500 μL with Opti-MEM and mixed with H... 2a (100nM), H 2b A mixture of 100 nM AA and 100 nM Apt / cDNA (10 μL each) was transfected into cell samples incubated with a dual-color composite probe and incubated for 6 h. After incubation, the culture medium was aspirated, the cells were washed three times with PBS solution, fixed with 4% paraformaldehyde for 15 min, and then subjected to fluorescence imaging under a high-resolution laser confocal microscope to assess the toxicity of AA to cell samples and the expression of miR-21.

[0123] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A method for preparing a dual-color aggregation-induced composite probe, characterized in that, The method includes the following steps: (1) Mix AIE dye A and styrene-maleic anhydride copolymer solution, dilute with tetrahydrofuran, and then ultrasonically mix with deionized water to remove tetrahydrofuran. Filter to obtain AIE nanoparticles R-AIENPs; mix AIE dye B and styrene-maleic anhydride copolymer solution in equal amounts and use the same method to obtain AIE nanoparticles G-AIENPs. (2) The AIE nanoparticles and hairpin DNA prepared in step (1) were ligated by an EDC / NHS-catalyzed amide reaction to obtain mixed solutions 1a and 1b, resulting in a two-color aggregation-induced composite probe; the hairpin DNA included H 1a and H 1b Among them, AIE nanoparticles R-AIENPs and H 1a Connection, AIE nanoparticles G-AIENPs with H 1b connect; The H 1a The sequence is: NH2-TGG TGG ATG AGT GTG TGG CCA CGT GGA TTT CAT TCA GCTTTT TTT TTT AAA TCC ACG TGG CCA CAC ACT; the H 1b The sequence is NH2-TCA ACA TCA GTC TGATAA GCT ACC CAT GCG ATC TTT TTT TTT TGA TCG CAT GGG TAG CTT ATC AGA; The AIE dye A or AIE dye B can be any two AIE dyes with different fluorescence.

2. The method according to claim 1, characterized in that, In step (1), the mass ratio of the styrene-maleic anhydride copolymer solution to the AIE dye is (0.5-1.5):1; in step (2), the concentration of the hairpin DNA is 100nM-2μM.

3. The dual-color aggregation-induced composite probe prepared according to the method described in claim 1 or 2.

4. A kit for simultaneous detection of acrylamide and miR-21, characterized in that, The kit contains the dual-color aggregation-inducing composite probe as described in claim 3, H 2a H 2b Apt and cDNA; The H 2a The sequence is: AGT GTG TGG CCA CGT GGA TTT AAA AAA AAA AGC TGA ATG AAA TCCACG TGG CCA CAC ACT CAT CCA CCA–BHQ1; the H 2b The sequence is: TCT GAT AAG CTA CC CAT GCGATC A AAA AAA AAA GAT CGC ATG GGT AGC TTA TCA GAC TGA TGT TGA-BHQ3; the Apt sequence is: CAG TCC AGG ACA GAT TCG CGA GTG GTC GTG GTG AGG TGC GTG TAT GGG TGG TGGATG AGT GTG TGG CCA CGT GGA TTT CAT TCA GCG ATT; the cDNA sequence is: GC TGA ATG AAATCC ACG TGG CCA CAC ACT CAT CCA CCA.

5. A method for simultaneous in vitro detection of acrylamide and miR-21, characterized in that, The method described herein is to detect acrylamide and miR-21 using the kit described in claim 4.

6. The method according to claim 5, characterized in that, The method steps are as follows: (1) Add H to the mixed solution 1a in the dual-color aggregation-inducing composite probe 2a Solution, add H to mixed solution 1b 2b The solutions were analyzed to obtain mixed solutions 1a-2a and 1b-2b. (2) Mix equal volumes of Apt solution and cDNA solution and incubate at 25℃–40℃ for 0.1–1 h to obtain Apt / cDNA hybridization strand solution; (3) Add the Apt / cDNA hybridization chain solution prepared in step (2) to the mixed solutions 1a-2a and 1b-2b in step (1) respectively to obtain mixed solutions 1a-2a-Apt / cDNA and 1b-2b-Apt / cDNA; (4) Add the test sample to the mixed solutions 1a-2a-Apt / cDNA and 1b-2b-Apt / cDNA prepared in step (3), respectively. The mixed solution 1a-2a-Apt / cDNA and the test sample are incubated for 55-65 min to detect acrylamide, and the mixed solution 1b-2b-Apt / cDNA and the test sample are incubated for 35-45 min to detect miR-21.

7. The method according to claim 6, characterized in that, In step (1), the mixed solution 1a and solution H 2a The volume ratio of the solutions is (8:1)-(1:1), and the mixed solution 1b and H 2b The volume ratio of the solution is (8:1)-(1:1); In step (1), the H 2a The concentration of H is 200 nM-800 nM. 2b The concentration is: 100nM-400nM; In step (2), the concentration of Apt is 0.5 μM-1.5 μM, and the concentration of cDNA is 0.5 μM-1.5 μM; In step (3), the volume ratio of the mixed solution 1a-2a or 1b-2b to the Apt / cDNA hybridization chain solution is (9:1)-(2:1), and the concentration is 20-100 nM.

8. A method for detecting acrylamide cytotoxicity, characterized in that, The detection method using the kit described in claim 4, which is not intended for disease diagnosis, comprises the following steps: (1) Seed the cells to be tested in a laser confocal culture dish and incubate them to allow the cells to adhere and grow. (2) Add basic culture medium containing the dual-color aggregation-inducing composite probe to the adherent cells obtained in step (1) for incubation; (3) H 2a H 2b Mix with Apt / cDNA and transfect into the cells of step (2), incubate for a certain period of time, and discard the supernatant; (4) Fix the cells from step (3) with fixative and perform fluorescence imaging; In step (2), the dual-color aggregation-inducing composite probe is diluted 1 to 5 times and then added to the basic culture medium.

9. The method according to claim 8, characterized in that, In step (2), the incubation time is 2-8 hours; in step (3), the incubation time is 4-10 hours. 2a The concentration is 10-200 nM, H 2b The concentration of Apt / cDNA is 10-200 nM.

10. The method according to claim 8 or 9, characterized in that, Different concentrations of acrylamide were added to the cells in step (3) and incubated for 0–12 h. The cells were then fixed with fixative and subjected to fluorescence imaging.

Images