A genetically engineered bacterium for synthesizing carotenoids and a construction method and application thereof

By regulating the expression of ROX1, STB5, DID2, VOA1, and SSP1 genes in yeast strains through genetic engineering, the problem of gene combination regulation outside the carotenoid synthesis pathway was solved, and efficient carotenoid production was achieved.

CN117229934BActive Publication Date: 2026-06-30ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311145116.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-09-06
Publication Date
2026-06-30
Estimated Expiration
2043-09-06

AI Technical Summary

Technical Problem

Existing technologies struggle to effectively regulate gene combinations outside of the carotenoid synthesis pathway, leading to low carotenoid synthesis efficiency and potential negative consequences.

Method used

By using genetic engineering techniques, the ROX1 gene in a yeast strain was knocked out, the expression of STB5, DID2, and VOA1 genes was upregulated, and the expression of SSP1 gene was downregulated. The promoter was replaced using CRISPR/Cas9 technology to regulate the expression of these genes, thus constructing a genetically engineered bacterium that efficiently synthesizes carotenoids.

Benefits of technology

It significantly increased the yield of carotenoids, especially β-carotene, canthaxanthin, and astaxanthin, achieving safe and efficient carotenoid production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117229934B_ABST
    Figure CN117229934B_ABST
Patent Text Reader

Abstract

This invention discloses a genetically engineered bacterium for synthesizing carotenoids, its construction method, and its applications, belonging to the field of genetic engineering technology. The genetically engineered bacterium uses a carotenoid-producing yeast strain as the starting material. The gene ROX1, encoding a heme-dependent hypoxia gene repressor, is knocked out, while the expression of genes STB5 (encoding a transcription factor involved in NADPH regeneration), DID2 (encoding a class E protein in the vacuole protein sorting pathway), and VOA1 (encoding an endoplasmic reticulum protein playing a role in the assembly of the V0 region of V-ATPase) is upregulated. This invention promotes carotenoid synthesis and significantly increases carotenoid yield through combined regulation of gene expression outside the carotenoid synthesis pathway, demonstrating promising application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a genetically engineered bacterium that efficiently synthesizes carotenoids, its construction method, and its applications. Background Technology

[0002] Significant progress has been made in constructing engineered strains to achieve heterologous biosynthesis of carotenoids through genetic engineering. Currently, most studies promote carotenoid synthesis by altering the source, activity, and expression levels of enzymes involved in the carotenoid biosynthesis pathway. However, due to the complex metabolic networks of chassis organisms, heterologous carotenoid biosynthesis is influenced by seemingly unrelated genes.

[0003] In addition to genes directly involved in the carotenoid synthesis pathway, a number of genes outside the pathway have been reported to affect carotenoid production. For example, screening a Saccharomyces cerevisiae knockout library revealed that knocking out the transcription factor encoding gene ROX1 or the meiotic control protein encoding gene SSP1 can increase carotenoid production (Carotenoid-based phenotypic screen of the yeast deletion collection reveals new genes with roles in isoprenoid production. Metabolic Engineering, 2013, 15:174-183); in isoprene-producing strains, knocking out or downregulating MPC3 can increase isoprene production by about 20% (Construction of high-isoprene-producing Saccharomyces cerevisiae through comprehensive regulation. Zhejiang University, 2020); random mutagenesis revealed that knocking out the cell wall mannose protein encoding gene DAN4 can promote astaxanthin synthesis (Astaxanthin overproduction in yeast by strain engineering and new gene target uncovering. Biotechnology for Biofuels, 2018, 11:230); in engineered strains of Saccharomyces cerevisiae that produce lycopene, overexpression of transcription factor STB5 and mitochondrial NADH kinase POS5 (Efficient production of lycopene in... The expression of superoxide dismutase SOD1 in engineered β-carotene-producing Saccharomyces cerevisiae by enzyme engineering and increasing membrane flexibility and NAPDH production (Applied Microbiology and Biotechnology, 2019, 103(1):211-223) and overexpression of superoxide dismutase SOD1 in engineered β-carotene-producing Saccharomyces cerevisiae (Transcriptome analysis reveals a promotion of carotenoid production by copper ions in recombinant Saccharomyces cerevisiae. Microorganisms, 2021, 9(2):233) both increase the production of target carotenoids. These results indicate that genes outside the target pathway also play an important role in carotenoid synthesis and cannot be ignored.

[0004] However, whether there are interactions between these extra-synthetic gene targets, and whether combinations of these gene targets can have a positive impact on the production of different carotenoids, requires further investigation. Actual studies have shown that simply combining two or more beneficial gene manipulations may have negative effects. Therefore, how to rationally regulate genes outside the synthetic pathway to promote carotenoid biosynthesis is a problem that needs to be solved by those skilled in the art. Summary of the Invention

[0005] The purpose of this invention is to provide a genetically engineered bacterium capable of efficiently synthesizing carotenoids, which prepares carotenoids through heterologous microbial synthesis and promotes the biosynthesis of carotenoids by regulating gene targets outside the carotenoid synthesis pathway.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] This invention provides a genetically engineered bacterium for synthesizing carotenoids. The bacterium uses a carotenoid-producing yeast strain as the starting material, knocking out the gene ROX1 encoding a heme-dependent hypoxia gene repressor, while simultaneously upregulating the expression of the gene STB5 encoding a transcription factor involved in NADPH regeneration, the gene DID2 encoding a class E protein in the vacuole protein sorting pathway, and the gene VOA1 encoding an endoplasmic reticulum protein that plays a role in the assembly of the V0 region of V-ATPase. The nucleotide sequence of ROX1 is shown in SEQ ID NO.1, the nucleotide sequence of STB5 is shown in SEQ ID NO.2, the nucleotide sequence of DID2 is shown in SEQ ID NO.3, and the nucleotide sequence of VOA1 is shown in SEQ ID NO.4.

[0008] This invention silences the expression of the ROX1 gene using gene knockout technology; it upregulates the expression of the STB5, DID2, and VOA1 genes by replacing the promoters upstream of these genes with strong promoters, integrating additional copies of the STB5, DID2, and VOA1 genes into the genome, or introducing recombinant expression plasmids containing STB5, DID2, and VOA1 into the host bacteria. This invention promotes carotenoid synthesis by combining and regulating the expression of genes outside the aforementioned carotenoid synthesis pathways, enabling the safe and efficient mass production of carotenoids using *Saccharomyces cerevisiae* as a cell factory.

[0009] Preferably, the genetically engineered bacteria further includes: a carotenoid-producing yeast strain as the starting strain, which downregulates the expression of the gene SSP1 encoding a protein involved in controlling meiotic nuclear division, the nucleotide sequence of SSP1 being shown in SEQ ID NO. 5. This invention can downregulate gene expression by replacing the promoter upstream of SSP1 in the genome with a weak promoter.

[0010] Preferably, the promoter upstream of the STB5, DID2, and VOA1 genes on the chromosome of the genetically engineered bacterium is the TEF1 promoter, and the promoter upstream of the SSP1 gene is the BTS1 promoter. More preferably, the nucleotide sequence of the TEF1 promoter is shown in SEQ ID NO. 6; and the nucleotide sequence of the BTS1 promoter is shown in SEQ ID NO. 7.

[0011] The yeast strain that produces carotenoids is a well-known yeast strain in the art that has the function of producing carotenoids. The carotenoids may be, but are not limited to, β-carotene, canthaxanthin, and astaxanthin.

[0012] Furthermore, the yeast strain that produces carotenoids is an engineered strain that produces β-carotene, an engineered strain that produces canthaxanthin, or an engineered strain that produces astaxanthin.

[0013] Preferably, the engineered strain producing β-carotene is the engineered strain Ycarot-02, which is publicly available.

[0014] Preferably, the engineered strain producing canthaxanthin is constructed by inserting a gene encoding β-carotene ketolase into the genome of a β-carotene-producing engineered strain or by introducing a recombinant expression plasmid.

[0015] Preferably, the astaxanthin-producing engineered strain is constructed by inserting genes encoding β-carotene ketolase and β-carotene hydroxylase into the genome of a β-carotene-producing engineered strain or by introducing such genes into a recombinant expression plasmid.

[0016] More preferably, the nucleotide sequence of the gene encoding β-carotene ketolase is shown in SEQ ID NO.8; and the nucleotide sequence of the gene encoding β-carotene hydroxylase is shown in SEQ ID NO.9.

[0017] The present invention also provides a method for constructing the aforementioned carotenoid-synthesizing genetically engineered bacteria, the method comprising: using a carotenoid-producing yeast strain as the starting strain, using gene editing technology to knock out ROX1, replacing the promoters upstream of the STB5, DID2, and VOA1 genes on the chromosome with strong promoters, or additionally integrating copies of the STB5, DID2, and VOA1 genes on the chromosome to obtain the aforementioned carotenoid-synthesizing genetically engineered bacteria;

[0018] Alternatively, using a carotenoid-producing yeast strain as the starting strain, ROX1 is knocked out using gene editing technology, and then a recombinant expression plasmid containing STB5, DID2, and VOA1 is introduced to obtain the aforementioned carotenoid-synthesizing genetically engineered strain.

[0019] Furthermore, the construction method also includes using gene editing technology to replace the promoter upstream of the SSP1 gene on the chromosome with a weak promoter.

[0020] Preferably, genes STB5, DID2, and VOA1 all have a TEF1 promoter upstream, and gene SSP1 has a BTS1 promoter upstream. The target gene is located upstream of the strong promoter P. TEF1 The expression level of the target gene is increased under the action of the weak promoter P. BTS1 The expression level decreases under the influence of [the substance / mechanism].

[0021] This invention constructs a genetically engineered bacterium capable of efficiently producing carotenoids by combining and regulating the expression of genes outside the carotenoid synthesis pathway, such as ROX1, STB5, DID2, VOA1, and SSP1. Specifically, the construction method includes the following steps:

[0022] (1) Using carotenoid-producing engineered strains as the starting strains, the gene ROX1 encoding the heme-dependent hypoxia gene repressor in the genome was knocked out using CRISPR / Cas9 gene editing technology.

[0023] (2) Using CRISPR / Cas9 gene editing technology, the natural promoters upstream of the transcription factor gene STB5, which is involved in NADPH regeneration, the E-type protein gene DID2, which encodes the vacuole protein sorting pathway, and the endoplasmic reticulum protein gene VOA1, which plays a role in the assembly of V-ATPase V0 region, were all replaced with the TEF1 promoter.

[0024] (3) Using CRISPR / Cas9 gene editing technology, the natural promoter upstream of the gene SSP1, which encodes a protein involved in controlling meiotic nuclear division, is replaced with the BTS1 promoter to obtain the genetically engineered bacteria that synthesize carotenoids.

[0025] Furthermore, the engineered strain that produces carotenoids is an engineered strain that produces β-carotene, an engineered strain that produces canthaxanthin, or an engineered strain that produces astaxanthin, and the corresponding fermentation products are β-carotene, canthaxanthin, and astaxanthin, respectively.

[0026] This invention also provides the application of the genetically engineered bacteria for synthesizing carotenoids in the preparation of carotenoids. Various carotenoids are prepared from the fermentation cultures of the genetically engineered strains constructed in this invention.

[0027] Furthermore, the carotenoid is β-carotene, canthaxanthin, or astaxanthin.

[0028] Specifically, the application includes: expanding the culture of the genetically engineered bacteria that synthesize carotenoids, inoculating them into YPD liquid culture medium, shaking the culture to obtain a fermentation broth; collecting the bacterial cells in the fermentation broth, and extracting the corresponding carotenoids after cell disruption.

[0029] Carotenoids in cell lysate are extracted using an organic phase extractant, with acetone being the preferred extractant.

[0030] Preferably, the fermentation conditions are: cultured in a constant temperature shaker at 28-30℃ for 72-84 hours at 200-250 rpm.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] This invention provides a recombinant genetically engineered bacterium that produces high levels of carotenoids. Using a carotenoid-producing yeast strain as the chassis cell, it promotes carotenoid synthesis and significantly increases carotenoid yield by combining and regulating gene expression outside the target pathway of carotenoid synthesis. Specifically, it includes knocking out ROX1 and upregulating the expression of STB5, DID2, and VOA1 genes. This has good application prospects. Attached Figure Description

[0033] Figure 1 The results of screening for extragenic libraries are shown in Figure 1. A is the yeast transformation plate used for the initial screening; B is a magnified view of the area enclosed in the box in A, where the single colony indicated by the arrow is redder and may have a higher β-carotene production; C is the second round of screening, where positive colonies selected in the initial screening are spotted and inoculated onto new plates; D is the high-performance liquid chromatography analysis of β-carotene production by the strains screened in the second round.

[0034] Figure 2 The effect of extra-pathogen target knockout on β-carotene production in Example 3.

[0035] Figure 3 This illustrates the effect of upregulation of extra-gene targets in Example 3 on β-carotene production.

[0036] Figure 4 This illustrates the effect of downregulation of extra-gene targets in Example 3 on β-carotene production.

[0037] Figure 5 This is the effect of extra-gene combination regulation on β-carotene production in Example 3.

[0038] Figure 6 The effects of extragenic gene combination regulation on cantharidin production.

[0039] Figure 7 The effect of extragenic gene combination regulation on astaxanthin production. Detailed Implementation

[0040] The present invention will be further described below with reference to specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention.

[0041] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0042] The starting strain used in this invention to construct carotenoid-producing bacteria is Ycarot-02, which was previously constructed by our research group. This strain enables the Gal4p protein to be regulated by glucose instead of galactose, thus avoiding the problem of traditional inducible promoters requiring the addition of exogenous inducers. Therefore, by changing the glucose concentration, the growth and product synthesis of Saccharomyces cerevisiae can be separated, thereby reducing the metabolic burden on the cells caused by exogenous protein expression. The construction method is referenced in the literature (Alleviation of metabolic bottleneck by combinatorial engineering enhanced astaxanthinsynthesis in Saccharomyces cerevisiae. Enzyme and Microbial Technology, 2017, 100: 28-36.).

[0043] The plasmids pSpSgH, pSaSgH, pSpH, and pAID6 can be found in the literature (Combinatorial metabolic engineering using an orthogonal tri-functional CRISPR system. Nature Communications, 2017, 8: 1688).

[0044] plasmid pUMRI-11-P GAL1 -PM SeV-C -OBKTM29-T ADH1 See the literature (Construction of canthaxanthin-producing yeast by combining spatiotemporal regulation and pleiotropic drug resistance engineering. ACS Synthetic Biology, 2022, 11(1):325-333).

[0045] plasmids p426-SpSgH, p426-ccdB, p423-LbSgH, pUMRI-11-P GAL1 -OCrtZM1-P GAL10 -OBKTM29, p416-TEF1-Cas9-CYC1-G418, pSg121 and p426-DLY are referenced in the literature (Spatiotemporal regulation of astaxanthin synthesis in S. cerevisiae.ACS Synthetic Biology, 2022, 11(8):2636-2649).

[0046] The construction method of the astaxanthin production control strain YM4 can be found in the literature (Spatiotemporal regulation of astaxanthin synthesis in S. cerevisiae.ACS Synthetic Biology, 2022, 11(8):2636-2649).

[0047] In this invention, the nucleotide sequence is written from left to right in the direction from 5' to 3'.

[0048] Example 1: Construction of gRNA plasmid libraries targeting carotenoids outside the carotenoid synthesis pathway.

[0049] 1. Searching and organizing the external target database

[0050] A total of 28 extragene targets related to carotenoid biosynthesis were collected through literature search, as shown in Table 1.

[0051] Table 1. Pathway exogenous targets associated with carotenoid biosynthesis

[0052] Gene name Function Operation to be carried out YKR035W-A(DID2) Class E proteins in the vacuole protein sorting pathway Upward YGR106C(VOA1) Endoplasmic reticulum proteins that play a role in the assembly of V-ATPase V0 region. Upward YGL166W(ACE1) Copper-binding transcription factors Upward YJR104C(SOD1) Superoxide dismutase Upward YGL055W(OLE1) Fatty acid desaturase Upward YHR178W(STB5) transcription factors Upward YPL188W(POS5) Mitochondrial NADH kinase Upward YMR070W(MOT3) transcription factors Knockout YGR240C(PFK1) α subunit of heterooctameric phosphofructokinase Knockout YDR068W(DOS2) Function unknown Knockout YER134C Magnesium-dependent acid phosphatase Knockout YNR063W(PUL4) It is speculated to be a zinc cluster transcription factor. Knockout YGR259C Function unknown Knockout YPR065W(ROX1) transcription factors Knockout YPL062W Function unknown Knockout YJL064W Function unknown Knockout YLR085C(ARP6) Actin-associated proteins that bind to nucleosomes Knockout YIL074C(SER33) 3-Glycerol phosphate dehydrogenase / α-ketoglutarate reductase Knockout YNL280C(ERG24) Dehydrocholesterol reductase 14 Knockout YDR215C Function unknown Knockout YHR184W(SSP1) Proteins involved in controlling meiotic nuclear division Lower YOR291W(YPK9) Vacuole proteins may play a role in storing heavy metals. Lower YER060W-A(FCY22) It may be a purine-cytosine permease. Lower YOR389W Function unknown Lower YJR151C(DAN4) Cell wall mannose protein Lower YIL169C(CSS1) Function unknown Lower YBR012W-B Retrotransposon Lower YGR243W(MPC3) Conserved subunits of mitochondrial pyruvate carrier Lower

[0053] 2. Construction of gRNA plasmid library (primers used are shown in Table 2, and plasmids constructed are shown in Table 3)

[0054] To construct the gRNA plasmid library, gRNA plasmids targeting each individual target in Table 1 were first constructed. Suitable gRNA sequences for each gene target were designed using the Benchling platform (https: / / www.benchling.com). The gRNAs were then annealed to form double strands with sticky ends and ligated to pSpSgH, pSaSgH, or p423-LbSgH plasmids linearized with BsaI-HFv2 using T4 DNA ligase.

[0055] To construct the gRNA plasmid library, single gRNA expression cassettes were amplified using the three primer pairs in Table 2. After digestion with BsaI-HFv2, different sticky ends were formed, and the cassettes were assembled and ligated to the pSpH plasmid using Golden-Gate.

[0056] Table 2. Primers used for constructing extrapathway gene gRNA plasmid libraries

[0057]

[0058]

[0059]

[0060]

[0061] Table 3. gRNA plasmid libraries

[0062]

[0063]

[0064]

[0065] Example 2: High-throughput screening of targets that promote carotenoid synthesis

[0066] 1. Construction of the knockout donor library (primers used are shown in Table 4)

[0067] The knockout donor uses the primer itself as a template, through... The DNA fragments were amplified using HS DNA polymerase to form 100 bp DNA fragments, and then concentrated using ethanol precipitation.

[0068] Table 4. Primers used to construct the donor knockout mechanism

[0069]

[0070]

[0071] 2. High-throughput screening

[0072] Using the LiAc / SS carrier DNA / PEG method (High-efficiency yeast transformation using the LiAc / SS carrier DNA / PEG method. Nature Protocols, 2007, 2(1):31-34), the pAID6 plasmid expressing three Cas proteins was first linearized with PmeI and then transformed into Ycarot-02, integrating into the yeast genome. Then, the gRNA plasmid library constructed in Example 1 and the knockout donor library constructed in step 1 of Example 2 were transformed into yeast and plated on SD-HIS. - On agar plates. A first round of preliminary screening was conducted based on the color of single colonies on the transformation plates. Colonies with the redder color were selected and inoculated onto new plates for a second round of screening; the redder the single colony, the higher the potential yield. The strains obtained from the second round of plate screening were then activated and inoculated into shake flasks for shake-flask fermentation. HPLC analysis was used to identify strains that resulted in increased yields.

[0073] Fermentation culture of genetically engineered bacteria and extraction and analysis of products:

[0074] (1) Pick a single colony of the engineered bacteria from the streaked plate and inoculate it into 5 mL of YPD medium and incubate for about 46 hours. Then, inoculate the strain into 50 mL of YPD liquid medium to allow the initial OD to rise. 600nm The concentration was 0.05. Fermentation was carried out in a constant temperature shaker at 220 rpm and 30°C for 84 hours.

[0075] (2) Collect 0.2 mL of yeast fermentation broth into a 2 mL centrifuge tube, centrifuge at 12000 rpm for 2 min, discard the supernatant, then wash twice with 1 mL of distilled water, centrifuge and discard the supernatant, add about 0.5 mL of grinding beads (half 0.1 mm and half 0.5 mm zirconium oxide beads) to the centrifuge tube, add 200 μL of acetone to the centrifuge tube, and resuspend the cells.

[0076] (3) Place the centrifuge tube containing the beads and bacteria into a fully automatic sample rapid grinder and grind for 5 minutes at 65 Hz.

[0077] (4) After grinding, add 800 μL of acetone to the centrifuge tube, mix thoroughly, and sonicate for 5 min.

[0078] (5) After sonication, place the centrifuge tube in a centrifuge at 4°C for 12,000 rpm for 2 min and collect the supernatant into a new 2 mL centrifuge tube.

[0079] (6) Filter the extract with a 0.22 μm organic filter and then perform HPLC analysis.

[0080] The following conditions were used to determine the content of various carotenoids in engineered strains of *Saccharomyces cerevisiae* by HPLC. The HPLC instrument was a Shimadzu LC-20AT, the column was an Amethyst C18-H column (4.6 × 150 mm, 5 μm), and the detection wavelength was 470 nm. Gradient elution was used. Mobile phase A consisted of acetonitrile and pure water (9:1), and mobile phase B consisted of methanol and isopropanol (3:2). The flow rate was 1 mL / min. The gradient elution conditions were as follows: 0–15 min, mobile phase B increased from 0% to 90%; 15–27 min, mobile phase B remained at 90%; 27–28 min, mobile phase B decreased from 90% to 0%; 27–35 min, mobile phase B remained at 0%.

[0081] The results are as follows Figure 1 As shown, through the above method, after two rounds of initial color screening, 63 single colonies were identified as potentially having high β-carotene production and were inoculated into shake flasks for a third round of screening. HPLC analysis confirmed 57 strains as positive mutants, with the highest increase in β-carotene production reaching 185.36%. The production of five strains, numbered 11, 36, 45, 60, and 63, was actually lower than that of the original strain.

[0082] 3. Identification of positive target sites

[0083] gRNA plasmids were extracted from positive mutants using a yeast plasmid extraction kit, amplified in E. coli Top 10, and the gene targets corresponding to the gRNA plasmids were identified by DNA sequencing. Several targets with high frequency of occurrence are shown in Table 5.

[0084] Table 5. Frequency of positive target occurrence

[0085]

[0086] Example 3: Regulation of high β-carotene production through extra-pathway gene combination

[0087] 1. Construction of reverse-engineered strains with target knockout

[0088] Using the primers in Table 6, single and combined gRNA plasmids targeting YJL064W and ROX1 were constructed according to Examples 1 and 2 (the plasmid backbone for the single gRNA was p426-SpSgH, and the plasmid backbone for the combined gRNA was p426-ccdB), as well as the knockout donor. p416-TEF1-Cas9-CYC1-G418, the gRNA plasmids (single and combined), and the knockout donor were transformed into Ycarot-02 according to the transformation method in Example 2, constructing Ycar-1 (ΔYJL064W), Ycar-2 (ΔROX1), and Ycar-3 (ΔYJL064W+ΔROX1), respectively.

[0089] Table 6. Primers required for constructing donors that knock out target sites.

[0090] YJL064W-donor-59F agccgtatcgttcaccacataggcggagtaaacttcattagggggcatgatgatcacat YJL064W-donor-59R cagaagaaacaagagagaatagcgtcaggatagctcgctcgatgtgatcatcatgcccc ROX1-donor-59F3 gaaaatactaatacttcttcacacaaaagaacgcagttagacaatcaacagcaacactg ROX1-donor-59R3 aaatcatttcggagaaactaggctagttttagcggtgacctcagtgttgctgttgattg

[0091] The strain was cultured and the products were extracted and analyzed according to the method in Example 2. The results are as follows: Figure 2 As shown, compared with the control strain Ycarot-02, the β-carotene production of strain Ycar-2 with ROX1 knocked out alone increased by 24.2%, but the β-carotene production was greatly reduced by knocking out YJL064W alone, and the β-carotene production was also reduced by knocking out both ROX1 and YJL064W at the same time.

[0092] 2. Construction of reverse-engineered strains for upregulating target sites

[0093] Using the primers in Table 7, single and combined gRNA plasmids targeting the promoter regions of DID2, STB5, VOA1, and POS5 were constructed according to Example 1 (the plasmid backbone for single gRNAs was p426-SpSgH, and the plasmid backbone for combined gRNAs was p426-ccdB). Using *Saccharomyces cerevisiae* BY4741 as a template, [the following was performed]. HSDNA polymerase amplified the TEF1 promoter with homologous arms, which served as the integration donor. p416-TEF1-Cas9-CYC1-G418, gRNA plasmids (single and combined), and the donor were transformed into Ycar-2 cells according to the transformation method in Example 2, constructing Ycar-4(↑POS5), Ycar-5(↑STB5), Ycar-6(↑DID2), Ycar-7(↑VOA1), Ycar-8(↑POS5+↑DID2+↑VOA1), Ycar-9(↑STB5+↑DID2+↑VOA1), and Ycar-10(↑POS5+↑STB5).

[0094] Table 7. Primers required for reverse engineering of upregulation targets

[0095]

[0096] The strain was cultured and the products were extracted and analyzed according to the method in Example 2. The results are as follows: Figure 3 As shown, compared to Ycar-2, strain Ycar-9, which simultaneously upregulated STB5, DID2, and VOA1, increased β-carotene production by 58.8%. Upregulating POS5, STB5, DID2, and VOA1 individually also increased β-carotene production, but the effect was not as significant as when all three genes were upregulated simultaneously. Simultaneous upregulation of POS5, DID2, and VOA1, or simultaneous upregulation of POS5 and STB5, was not conducive to β-carotene accumulation.

[0097] 3. Construction of reverse-engineered strains for downregulating target sites

[0098] Using the primers in Table 8, single and combined gRNA plasmids targeting the promoter regions of MPC3, SSP1, and DAN4 were constructed according to Example 1 (the plasmid backbone for the single gRNA was p426-SpSgH, and the plasmid backbone for the combined gRNA was p426-ccdB). Using *Saccharomyces cerevisiae* BY4741 as a template, [the following was performed]. HSDNA polymerase amplified the BTS1 promoter with a homologous arm, which served as the integration donor. p416-TEF1-Cas9-CYC1-G418, gRNA plasmids (single and combined), and the donor were transformed into Ycar-9 cells according to the transformation method in Example 2, constructing Ycar-11(↓MPC3), Ycar-12(↓SSP1), Ycar-13(↓DAN4), Ycar-14(↓MPC3+↓SSP1), Ycar-15(↓MPC3+↓DAN4), Ycar-16(↓SSP1+↓DAN4), and Ycar-17(↓MPC3+↓SSP1+↓DAN4).

[0099] Table 8. Primers required for reverse engineering of downregulation targets

[0100]

[0101] The strain was cultured and the products were extracted and analyzed according to the method in Example 2. The results are as follows: Figure 4 As shown, compared to Ycar-9, strain Ycar-12, which downregulated SSP1 alone, increased β-carotene production by 4.1%. The effect of downregulating SSP1 was not significant, and other strategies of downregulation alone and in combination all reduced β-carotene production.

[0102] like Figure 5 As shown, the β-carotene yield in Ycar-12 was 153.0 mg / L, which was 51.0% higher than that of the starting strain Ycarot-02.

[0103] Example 4: Construction of a high-yield engineered strain of Cantharides yeast

[0104] 1. Build and integrate donor

[0105] The gene encoding β-carotene ketolase variant (OBKTM29) was previously optimized by our research group, and its nucleotide sequence is shown in SEQ ID NO.8.

[0106] use HS DNA polymerase amplifies P DNA with homologous arms using the primers in Table 9. GAL1 -PM SeV-C -OBKTM29-T ADH1 Expression cassette, used as an integration donor. The plasmid pUMRI-11-P used as the template. GAL1 -PM SeV-C -OBKTM29-T ADH1 .

[0107] Table 9. Primers required for cloning the β-carotene ketolase encoding gene OBKTM29

[0108] Primer name Primer sequences (5' to 3') DPP1-TADH1-59F tgaatcaccgttgatgcctttatggagaaaaatggtggcctgaattggagcgacctcat DPP1-TCYC1-59R atcgacgaaatgatgtctgtaatcttgagttctggatagcttcgagcgtcccaaaacct

[0109] 2. Construction of a yeast that produces cantharidin

[0110] p416-TEF1-Cas9-CYC1-G418, gRNA plasmid (pSg121), and integrator were transformed into Ycarot-02 and Ycar-12 constructed in Example 3, respectively, so that P GAL1 -PM SeV -C-OBKTM29-T ADH1 They were integrated into the DPP1 site of the Ycarot-02 and Ycar-12 genomes, respectively, to obtain Ycan-1 and Ycan-2.

[0111] 3. Fermentation culture of genetically engineered bacteria and extraction and analysis of products

[0112] The strain was cultured and the products were extracted and analyzed according to the method in Example 2. The results are as follows: Figure 6 As shown, the cantharidin yield in Ycan-2 was 148.6 mg / L, which was 34.0% higher than that of the control strain Ycan-1.

[0113] Example 5: Construction of a high-yield astaxanthin brewing yeast

[0114] 1. Build and integrate donor

[0115] The gene encoding β-carotene hydroxylase (β-carotene hydroxylase variant, OCrtZM1) was previously optimized by our research group, and its nucleotide sequence is shown in SEQ ID NO.9.

[0116] use HS DNA polymerase amplified T cells with homologous arms using the primers in Table 10. ADH1 -OBKTM29-P GAL10 -P GAL1 -OCrtZM1-T CYC1 Expression box and P GAL1 -OCrtZM1-T CYC1 Expression cassette, used as an integration donor. The plasmid pUMRI-11-P used as the template. GAL1 -OCrtZM1-P GAL10 -OBKTM29.

[0117] Construct a 100bp knockout donor for the YPL062W site using the primers in Table 10, following step 1 of Example 2.

[0118] Table 10. Primers used to construct astaxanthin-producing Saccharomyces cerevisiae

[0119] Primer Sequence (5’→3’) DPP1-TADH1-59F tgaatcaccgttgatgcctttatggagaaaaatggtggcctgaattggagcgacctcat DPP1-TCYC1-59R atcgacgaaatgatgtctgtaatcttgagttctggatagcttcgagcgtcccaaaacct LPP1-PGAL1-59F agctatactactttcagtacatgataattggtctatgtacggattagaagccgccgagc LPP1-TCYC1-59R ataacgttttgatatactggggtcatcaagactaaattccttcgagcgtcccaaaacct YPL062W-donor-59F aaactaaaaaccgtactcacaactttccgcggacgctaacagacaaatagccttgttag YPL062W-donor-59R tttgatgtgttactcaaccgttaaatcgctgtttgagctgactaacaaggctatttgtc

[0120] 2. Construction of Astaxanthin-producing Saccharomyces cerevisiae

[0121] p416-TEF1-Cas9-CYC1-G418, gRNA plasmid (p426-DLY), and integration / knockout donor were transformed into the Ycar-12 constructed in Example 3, resulting in T ADH1 -OBKTM29-P GAL10 -P GAL1 -OCrtZM1-T CYC1 Expression box and P GAL1 -OCrtZM1-T CYC1 The expression cassettes were integrated into the DPP1 and LPP1 sites of the Ycar-12 genome, respectively, while the YPL062W site was knocked out to obtain Yast-3.

[0122] 3. Fermentation culture of genetically engineered bacteria and extraction and analysis of products

[0123] The strain culture and product extraction and analysis were performed according to the method in Example 2, such as... Figure 7 As shown, the astaxanthin yield in Yast-3 was 21.5 mg / L, which was 63.9% higher than that of the control strain YM4 (obtained by transforming Ycarot-02 into OBKTM29 and OCrtZM1).

Claims

1. A genetically engineered bacterium for synthesizing carotenoids, characterized in that, The genetically engineered bacteria used a carotenoid-producing yeast strain as the starting material, and the gene encoding the heme-dependent hypoxia gene repressor was knocked out. ROX1 At the same time, it upregulates the expression of genes encoding transcription factors involved in NADPH regeneration. STB5 Genes encoding class E proteins in the vacuole protein sorting pathway DID2 and genes encoding endoplasmic reticulum proteins that play a role in the assembly of the V0 region of V-ATPase. VOA1 ;in, ROX1 The nucleotide sequence is shown in SEQ ID NO.

1. STB5 The nucleotide sequence is shown in SEQ ID NO.

2. DID2 The nucleotide sequence is shown in SEQ ID NO.

3. VOA1 The nucleotide sequence is shown in SEQ ID NO.4; The yeast strain that produces carotenoids is an engineered strain that produces β-carotene, an engineered strain that produces canthaxanthin, or an engineered strain that produces astaxanthin.

2. The genetically engineered bacterium for synthesizing carotenoids as described in claim 1, characterized in that, This also includes downregulating the expression of genes encoding proteins involved in controlling meiotic nuclear division. SSP1 , SSP1 The nucleotide sequence is shown in SEQ ID NO.

5.

3. The genetically engineered bacteria for synthesizing carotenoids as described in claim 2, characterized in that, The chromosome of the genetically engineered bacteria STB5 , DID2 , VOA1 The promoter upstream of the gene is TEF1 promoter; SSP1 The promoter upstream of the gene is BTS1 Promoter.

4. The method for constructing a genetically engineered bacterium for synthesizing carotenoids as described in any one of claims 1-3, characterized in that, include: Using a carotenoid-producing engineered yeast strain as the starting strain, gene editing technology was used to knock out... ROX1 , on chromosomes STB5 , DID2 , VOA1 The promoters upstream of the gene are replaced with strong promoters or additionally integrated into the chromosome. STB5 , DID2 , VOA1 Gene copying was performed to obtain the genetically engineered bacteria that synthesize carotenoids. Alternatively, using engineered yeast strains that produce carotenoids as the starting strain, gene editing technology can be used to knock out... ROX1 Then import the included STB5 , DID2 , VOA1 The recombinant expression plasmid was used to obtain the genetically engineered bacteria that synthesize carotenoids; The yeast strain that produces carotenoids is an engineered strain that produces β-carotene, an engineered strain that produces canthaxanthin, or an engineered strain that produces astaxanthin.

5. The construction method as described in claim 4, characterized in that, This also includes using gene editing technology to cut chromosomes. SSP1 The promoter upstream of the gene is replaced with a weak promoter.

6. The construction method as described in claim 5, characterized in that, Includes the following steps: (1) Using carotenoid-producing engineered strains as the starting strain, the gene encoding the heme-dependent hypoxia gene repressor in the genome was knocked out using CRISPR / Cas9 gene editing technology. ROX1 ; (2) Using CRISPR / Cas9 gene editing technology to edit genes in the genome that encode transcription factors involved in NADPH regeneration. STB5 Genes encoding class E proteins in the vacuole protein sorting pathway DID2 and genes encoding endoplasmic reticulum proteins that play a role in the assembly of the V0 region of V-ATPase. VOA1 The upstream natural promoters were all replaced with TEF1 promoter; (3) Using CRISPR / Cas9 gene editing technology to edit genes in the genome that encode proteins involved in controlling meiotic nuclear division. SSP1 The upstream natural promoter is replaced with BTS1 Promoter, to obtain the genetically engineered bacteria that synthesize carotenoids.

7. The use of the genetically engineered bacteria for synthesizing carotenoids as described in any one of claims 1-3 in the preparation of carotenoids.

8. The application as described in claim 7, characterized in that, The carotenoids mentioned are β-carotene, canthaxanthin, or astaxanthin.

9. The application as described in claim 7 or 8, characterized in that, include: After the genetically engineered bacteria that synthesize carotenoids were cultured on a large scale, they were inoculated into YPD liquid medium and cultured with shaking to obtain fermentation broth; Collect the bacterial cells from the fermentation broth, and extract the corresponding carotenoids after cell disruption.