A recombinant saccharomyces cerevisiae and its construction method and application

Abstract

The present application relates to the technical field of bioengineering, and particularly relates to a recombinant Saccharomyces cerevisiae and a construction method and application thereof, comprising the following steps: step one, using the whole genome of Enterococcus faecalis as a template, a recombinant strain SC1-1 is constructed; step two, using the recombinant strain SC1-1 as a primary strain, L-lactate dehydrogenase CYB2 gene of Saccharomyces cerevisiae is knocked out to obtain a recombinant strain SC2; step three, using the recombinant strain SC2 as a primary strain, branched-chain-2-oxo acid decarboxylase THI3 gene of Saccharomyces cerevisiae is knocked out to obtain a recombinant strain SC3; step four, using the whole genome of Saccharomyces cerevisiae as a template, a recombinant strain SC4 is constructed. The present application innovatively optimizes the source of L-lactate dehydrogenase L-LDH, knocks out L-lactate dehydrogenase CYB2 and branched-chain-2-oxo acid decarboxylase THI3, overexpresses pyruvate kinase CDC19 and H(+)-ATPase PMA2, and makes the L-lactic acid production of Saccharomyces cerevisiae increase to 33.45 g / L.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, and in particular to a recombinant brewer's yeast, its construction method, and its application. Background Technology

[0002] With the continuous depletion of global fossil resources, the utilization of renewable biomass resources has become an important direction for alleviating pressure. my country's bio-fermentation industry has developed rapidly, utilizing biomass resources to reduce dependence on fossil energy and lower costs. Through metabolic engineering, it can be converted into high-value-added chemicals. Licorice residue is the residue after extracting active ingredients from licorice. Most of the extracted licorice residue is discarded as solid waste, causing significant environmental pollution and resource waste. Licorice residue is rich in lignocellulose, and the cellulose components can be converted into bio-based chemicals through saccharification and fermentation, which have high added economic benefits and broad application prospects. However, the lignin and other encapsulated structures reduce the accessibility of cellulose to enzymes. Therefore, pretreatment to improve biodegradability and to extract cellulose using this pretreatment has become an important research direction.

[0003] L-lactic acid (L-PLA) is a precursor to L-polylactic acid (PLA). PLA is a common substitute for petroleum-based plastics, possessing desirable properties such as biodegradability, biocompatibility, and composability. L-PLA is one of the world's most important building block chemicals. It also serves as a raw material for the synthesis of various chemicals and has wide applications in the food, cosmetics, agriculture, and pharmaceutical industries. With the continuous development of new products based on PLA and other materials, the demand for lactic acid is increasing daily.

[0004] Chemical synthesis methods are costly and environmentally unfriendly, making microbial synthesis a hot research topic for the green production of L-lactic acid. However, *E. coli* has low safety and controllability, making it unsuitable as a conventional fermentation strain, while lactic acid bacteria have high nutritional requirements and are not acid-tolerant, necessitating the addition of large amounts of neutralizing agents during fermentation. *Saccharomyces cerevisiae*, which naturally lacks the lactate dehydrogenase gene, can be modified to produce high-purity lactic acid. Furthermore, *Saccharomyces cerevisiae* has stronger low pH tolerance, allowing for the addition of only small amounts or even no neutralizing agents, significantly reducing production costs. However, currently, few biosynthetic technologies for producing L-lactic acid using *Saccharomyces cerevisiae* have been found. Summary of the Invention

[0005] In view of this, the purpose of this invention is to provide a recombinant brewing yeast, its construction method and application, in order to solve the problem that brewing yeast cannot produce L-lactic acid in high yield.

[0006] To achieve the above objectives, the present invention provides a method for constructing recombinant brewing yeast, comprising the following steps: Step 1: Using the whole genome of Enterococcus faecalis as a template, after PCR amplification, the expression vector pGS217-ELDH was constructed with the amplification product of plasmid pGS217. Then, it was transformed into competent cells of Saccharomyces cerevisiae to obtain recombinant strain SC1-1. Step 2: Using recombinant strain SC1-1 as the original strain, knock out the L-lactate dehydrogenase CYB2 gene in Saccharomyces cerevisiae to obtain recombinant strain SC2. Step 3: Using recombinant strain SC2 as the original strain, knock out the branched-chain 2-oxo acid decarboxylase THI3 gene of Saccharomyces cerevisiae to obtain recombinant strain SC3; Step 4: Using the whole genome of Saccharomyces cerevisiae as a template, after PCR amplification, the expression vector pGS217-CDC19 was constructed with the amplification product of plasmid pGS217. Then, it was transformed into competent cells of recombinant strain SC3 to obtain recombinant strain SC4.

[0007] As a further improvement, the method for constructing recombinant Saccharomyces cerevisiae also includes step five: using the whole genome of Saccharomyces cerevisiae as a template, after PCR amplification, it is combined with the amplification product of plasmid pGS217 to construct the expression vector pGS217-PMA2, ​​which is then transformed into competent cells of recombinant strain SC4 to obtain recombinant strain SC5.

[0008] The method for obtaining recombinant strain SC1-1 in step one includes the following steps: A1. Design primer pairs as shown in SEQ ID NO.1-4 to insert the gene sequence of L-lactate dehydrogenase ELDH of Enterococcus faecalis into pGS217. Using the whole genome of Enterococcus faecalis as a template, perform PCR amplification using primer pairs as shown in SEQ ID NO.1-2; use plasmid pGS217 as a template, and perform PCR amplification using primer pairs as shown in SEQ ID NO.3-4. A2. After purifying the PCR product obtained in A1, the product was seamlessly cloned and ligated into the expression vector pGS217-ELDH. A3. Transform the expression vector pGS217-ELDH into competent cells of Saccharomyces cerevisiae to obtain the recombinant strain SC1-1.

[0009] Step two involves obtaining the recombinant strain SC2, which includes the following steps: B1. Using plasmid pSCM as a template, PCR amplification was performed using primers shown in SEQ ID NO.9-10 to obtain the first gRNA fragment. Using plasmid pSCM as a template, PCR amplification was performed using primers shown in SEQ ID NO.11-12 to obtain the pSCM fragment. After purifying the PCR products obtained from B2 and B1, the first gRNA fragment, pSCM fragment, and plasmid pTCL were transformed into competent cells of recombinant strain SC1-1 to obtain recombinant strain SC2.

[0010] Step 3, the method for obtaining recombinant strain SC3, includes the following steps: C1. Using plasmid pSCM as a template, PCR amplification was performed using primers shown in SEQ ID NO. 9 and SEQ ID NO. 13 to obtain the second gRNA fragment. Using plasmid pSCM as a template, PCR amplification was performed using primers shown in SEQ ID NO. 11-12 to obtain the pSCM fragment. After purifying the PCR products obtained from C2 and C1, the second gRNA fragment, pSCM fragment, and plasmid pTCL were transformed into competent cells of recombinant strain SC2 to obtain recombinant strain SC3.

[0011] Step four, which involves obtaining the recombinant strain SC4, includes the following steps: D1. Design primer pairs as shown in SEQ ID NO.14-17 to insert the gene sequence of pyruvate kinase CD19 into pGS217. Using the whole genome of Saccharomyces cerevisiae as a template, perform PCR amplification using primer pairs as shown in SEQ ID NO.14-15; use plasmid pGS217 as a template, and perform PCR amplification using primer pairs as shown in SEQ ID NO.16-17. A2. After purifying the PCR product obtained in A1, the product was seamlessly cloned and ligated into the expression vector pGS217-CDC19. A3. Transform the expression vector pGS217-CDC19 into competent cells of recombinant strain SC3 to obtain recombinant strain SC4.

[0012] Step 5, which involves obtaining the recombinant strain SC5, includes the following steps: D1. Design primer pairs as shown in SEQ ID NO.17-20 to insert the gene sequence of H(+)-ATPase PMA2 into pGS217. Using the whole genome of Saccharomyces cerevisiae as a template, perform PCR amplification using primer pairs as shown in SEQ ID NO.18-19; use plasmid pGS217 as a template, and perform PCR amplification using primer pairs as shown in SEQ ID NO.20-21. D2. After purifying the PCR product obtained in A1, the product was seamlessly cloned and ligated into the expression vector pGS217-CDC19. D3. Transform the expression vector pGS217-CDC19 into competent cells of recombinant strain SC3 to obtain recombinant strain SC4.

[0013] The present invention also provides a recombinant brewing yeast, which is constructed using the recombinant brewing yeast construction method.

[0014] The present invention also provides the application of the recombinant brewing yeast in the production of L-lactic acid from licorice residue.

[0015] The method for producing L-lactic acid from licorice residue is to first extract cellulose from licorice residue to prepare a licorice residue culture medium, and then inoculate, saccharify, and ferment to produce L-lactic acid.

[0016] The beneficial effects of this invention are as follows: This invention innovatively optimizes the source of L-lactate dehydrogenase (L-LDH), knocks out L-lactate dehydrogenase CYB2 and branched-chain 2-oxoacid decarboxylase THI3, and overexpresses pyruvate kinase CDC19 and H(+)-ATPase PMA2, ​​thereby increasing the L-lactic acid production of Saccharomyces cerevisiae to 33.45 g / L and making it more resistant to acidic environments. Furthermore, by extracting cellulose from licorice residue for saccharification and fermentation, the L-lactic acid yield was further increased to 38.88 g / L, achieving the reuse of waste resources. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only for this invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 This is the liquid phase chromatogram of L-lactic acid standard.

[0019] Figure 2 This is a liquid phase diagram of the fermentation broth.

[0020] Figure 3 This is a standard curve for the detection of L-lactic acid content by liquid chromatography.

[0021] Figure 4 Figure showing the L-lactic acid production of strains S288C, SC1-1, SC1-2, SC2, SC3, SC4 and SC5 in YPD medium and licorice residue medium.

[0022] Figure 5 The growth curves of the original strain S288C in YPD medium and licorice residue medium are shown.

[0023] Figure 6 The growth curves of strains SC4 and SC5 are shown in YPD medium containing 5 g / L L-lactic acid and licorice residue medium containing 5 g / L L-lactic acid. Detailed Implementation

[0024] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments.

[0025] It should be noted that, unless otherwise defined, the technical or scientific terms used in this invention should have the ordinary meaning understood by one of ordinary skill in the art to which this invention pertains. Terms such as "comprising" or "including" mean that the element or object preceding the word encompasses the elements or objects listed following the word and their equivalents, without excluding other elements or objects.

[0026] Preparation of licorice residue culture medium 1. The dried licorice residue was pulverized using a plant pulverizer and then sieved through a 40-mesh sieve. The sieved particles were dried to constant weight. The licorice residue was placed in a 50 mL stoppered Erlenmeyer flask containing 2% NaOH at a solid-liquid ratio of 1 g:10 mL. The mixture was thoroughly mixed and heated to 100 °C in a constant-temperature magnetically stirred water bath. The mixture was reacted for 2 h with stirring at 200 r / min, and then cooled to obtain a pretreated solution. The mixture (pretreated solution) was transferred to a Buchner funnel with three times the volume of distilled water. The mixture (pretreated solution) was washed with an equal volume of distilled water. Solid-liquid separation was performed by vacuum filtration. The washing and filtration operations were repeated multiple times until the filtrate was colorless and transparent with a pH close to neutral, confirming complete washing. The filter residue was transferred to a glass container and dried in a vacuum drying oven at 105 °C to constant weight to obtain the pretreated licorice residue.

[0027] 2. Add 6 g of pretreated licorice residue and 20 mL of citrate buffer (pH=4.8, 0.05 mol / L) to a 50 mL Erlenmeyer flask, add 0.3 g of licorice residue cellulase, and incubate for 72 h in a constant temperature shaking incubator (50 °C, 200 r / min). Set up 3 parallel experiments. The glucose concentration in the enzymatic hydrolysate was determined to be 66.8 g / L and the xylose concentration to be 10.3 g / L using a Silman biosensor.

[0028] 3. Take 15 mL of the enzymatic hydrolysate (with the same glucose concentration as in YPD medium) and add it to an Erlenmeyer flask. Then add 5 g / L of soybean peptone and 2 g / L of yeast extract to prepare 50 mL of licorice residue medium.

[0029] 4. Single colonies of the original strain S288C were picked from the slant culture medium and cultured in 50 mL YPD medium and licorice residue medium at 30 °C with constant temperature shaking at 220 r / min for 72 h. Growth curve analysis showed that the cell density (OD600) of the original strain S288C increased at a higher rate in licorice residue medium than in YPD medium, indicating better growth of the strain compared to YPD medium. Example

[0030] Construction and fermentation of recombinant strain SC1-1 Using Saccharomyces cerevisiae S288C as the original strain, follow these steps in sequence: The whole genome of Enterococcus faecalis was extracted using Tiangen's bacterial genomic DNA extraction kit and stored at -20 °C.

[0031] Escherichia coli was inoculated into liquid LB medium containing 50 μg / μL ampicillin and incubated overnight (12–16 h) at 37 °C. Plasmid pGS217 was extracted using a plasmid extraction kit and stored at -20 °C.

[0032] The gene sequence of L-lactate dehydrogenase (ELDH) from Enterococcus faecalis was downloaded from NCBI and inserted into the pGS217 plasmid map on snapgene. Primer pairs (SEQ ID NO.1-4) were designed as follows: Primer-L (SEQ ID NO.1) 5'-GCATAGCAATCTAATCTAAGATGAAAGTATTTAACAAAAAAGTCGCAATTATTGG 3' Primer-R (SEQ ID NO.2) 5'-CTAATTACATGAGAATTCCTAAGCGTTCGGTTGTAACGATG 3' Primer-L (SEQ ID NO.3) 5'-CCGAACGCTTAGGAATTCTCATGTAATTAGTTATGTCACGCTTACATTC 3' Primer-R (SEQ ID NO.4) 5'-GTTAAATACTTTCATCTTAGATTAGATTGCTATGCTTTCTTTCTAATGAGC3' Using *Enterococcus faecalis* whole-genome DNA as a template, PCR amplification was performed using Taq DNA polymerase. The amplification program was: 98℃ for 3 min, 98℃ for 10 s, 58℃ for 5 s, 72℃ for 10 s, 34 cycles, followed by 72℃ for 5 min, and incubation at 4℃. The target fragment was approximately 954 bp. Using plasmid pGS217 as a template, PCR amplification was performed using Taq DNA polymerase. The amplification program was: 98℃ for 3 min, 98℃ for 10 s, 59℃ for 5 s, 72℃ for 55 s, 34 cycles, followed by 72℃ for 5 min, and incubation at 4℃.

[0033] 4. After purifying the PCR product using a PCR product purification kit, perform seamless cloning using a seamless cloning kit and ligate it into the expression vector pGS217-ELDH.

[0034] 5. The obtained expression vector pGS217-ELDH was transformed into Saccharomyces cerevisiae S288C using a Saccharomyces cerevisiae competent cell preparation and transformation kit. Transformants were screened on histidine-free medium. After successful verification by colony PCR, the recombinant strain SC1-1 was obtained.

[0035] 6. Single colonies of the original strain S288C and the recombinant strain SC1-1 were picked from the slant culture medium and pre-cultured in 50 mL YPD medium at 30 °C with constant temperature shaking at 220 r / min for 24 h. Seed cultures of the original strain S288C and the recombinant strain SC1-1 were inoculated at a 3% inoculum into 50 mL YPD medium and licorice residue medium for anaerobic fermentation, and cultured for 72 h. Fermentation broths of the original strain S288C and the recombinant strain SC1-1 were obtained. High-performance liquid chromatography (HPLC) analysis showed that S288C did not produce L-lactic acid in either YPD or licorice residue medium, while SC1-1 produced 8.77 ± 0.22 g / L of L-lactic acid in YPD medium and 10.55 ± 0.12 g / L in licorice residue medium.

[0036] Construction and fermentation of recombinant strain SC1-2 Using Saccharomyces cerevisiae S288C as the original strain, follow these steps in sequence: 1. The whole genome of Streptococcus pneumoniae was extracted using Tiangen's bacterial genomic DNA extraction kit and stored at -20 °C.

[0037] 2. Inoculate *E. coli* into liquid LB medium containing 50 μg / μL ampicillin and incubate overnight (12-16 h) at 37 ℃. Extract plasmid pGS217 using a plasmid extraction kit and store at -20 ℃.

[0038] 3. The gene sequence of L-lactate dehydrogenase 1 (SLDH) from Streptococcus pneumoniae was downloaded from NCBI and inserted into the pGS217 plasmid map on snapgene. Primer pairs (SEQ ID NO. 5-8) were designed as follows: Primer-L (SEQ ID NO.5) 5'-GCATAGCAATCTAATCTAAGCTAAGCGTTCGGTTGTAACGATG 3' Primer-R (SEQ ID NO.6) 5'-CTAATTACATGAGAATTCATGAAAGTATTTAACAAAAAAGTCGCAATTATTGG 3' Primer-L (SEQ ID NO.7) 5'-GTTAAATACTTTCATGAATTCTCATGTAATTAGTTATGTCACGCTTACATTCAC 3' Primer-R (SEQ ID NO.8) 5'-CAACCGAACGCTTAGCTTAGATTAGATTGCTATGCTTCTTTCTAATGAGC 3' Using Streptococcus pneumoniae whole genome DNA as a template, PCR amplification was performed using Taq DNA polymerase. The PCR program was: 98℃ for 3 min, 98℃ for 10 s, 59℃ for 5 s, 72℃ for 10 s, 34 cycles, 72℃ for 5 min, 4℃ for incubation. The target fragment was approximately 954 bp. Using plasmid pGS217 as a template, PCR amplification was performed using Taq DNA polymerase. The PCR program was: 98℃ for 3 min, 98℃ for 10 s, 60℃ for 5 s, 72℃ for 55 s, 34 cycles, 72℃ for 5 min, 4℃ for incubation.

[0039] 4. After purifying the PCR product using a PCR product purification kit, perform seamless cloning using a seamless cloning kit and ligate it into the expression vector pGS217-SLDH.

[0040] 5. The obtained expression vector pGS217-SLDH was transformed into Saccharomyces cerevisiae S288C using a Saccharomyces cerevisiae competent cell preparation and transformation kit. Transformants were screened on histidine-free medium. After successful verification by bacterial culture PCR, the recombinant strain SC1-2 was obtained.

[0041] 6. Single colonies of recombinant strain SC1-2 were picked from the slant culture medium and pre-cultured in 50 mL YPD medium at 30 °C with constant temperature shaking at 220 r / min for 24 h. The seed culture of recombinant strain SC1-2 was inoculated at a rate of 3% into 50 mL YPD medium and licorice residue medium for anaerobic fermentation, and cultured for 72 h. The fermentation broth of recombinant strain SC1-2 was obtained. High-performance liquid chromatography (HPLC) analysis showed that SC1-2 produced 5.54 ± 0.24 g / L of L-lactic acid in YPD medium and 7.98 ± 0.22 g / L in licorice residue medium.

[0042] Construction and fermentation of recombinant strain SC2 Using recombinant strain SC1-1 as the original strain, the following steps were performed sequentially: 1. The L-lactate dehydrogenase CYB2 gene sequence of Saccharomyces cerevisiae S288C was downloaded from NCBI. The 20 bp before the PAM site was located, and the first gRNA primer (SEQ ID NO. 9-10) and plasmid pSCM primer (SEQ ID NO. 11-12) were designed: Primer-L (SEQ ID NO.9) 5'-TAATGTGAGTTAGCTCACTCATTAGGCACCC 3' Primer-R (SEQ ID NO.10) 5'-GTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACAGAAATCGGTGTAAGTGGGGGATCATTTATCTTTCACTGC 3' Primer-L (SEQ ID NO.11) 5'-GTTTTAGAGCTAGAAATAGCAAG 3' Primer-R (SEQ ID NO.12) 5'-AGCTCCAGCTTTTGTTCCC 3' Using plasmid pSCM as a template, the first gRNA fragment was amplified by PCR using primers shown in SEQ ID NO. 9-10. The amplification program was: 8℃ for 3 min, 98℃ for 10 s, 61℃ for 5 s, 72℃ for 7 s, 34 cycles, 72℃ for 5 min, 4℃, and incubation. Using plasmid pSCM as a template, the pSCM fragment was amplified by PCR using primers shown in SEQ ID NO. 11-12. The amplification program was: 98℃ for 3 min, 98℃ for 10 s, 48℃ for 5 s, 72℃ for 65 s, 34 cycles, 72℃ for 5 min, 4℃, and incubation.

[0043] 2. Inoculate *E. coli* into liquid LB medium containing 50 μg / μL ampicillin and incubate overnight (12-16 h) at 37 ℃. Extract plasmid pTCL using a plasmid extraction kit and store at -20 ℃.

[0044] 3. After purifying the PCR products using a PCR product purification kit, the first gRNA fragment, pSCM fragment, and plasmid pTCL were transformed into recombinant strain SC1-1 using a Saccharomyces cerevisiae competent cell preparation and transformation kit. CYB2 was knocked out using CRISPR-Cas9 technology, and transformants were screened using a medium without uracil and leucine. After successful verification by colony PCR, recombinant strain SC2 was obtained.

[0045] 4. Single colonies of recombinant strain SC2 were picked from the slant culture medium and pre-cultured in 50 mL YPD medium at 30 °C with constant temperature shaking at 220 r / min for 24 h. The seed culture of recombinant strain SC2 was then inoculated into 50 mL YPD medium and licorice residue medium at a 3% inoculation rate for anaerobic fermentation for 72 h. The fermentation broth of recombinant strain SC2 was obtained. High-performance liquid chromatography (HPLC) analysis showed that SC2 produced 17.84 ± 0.21 g / L of L-lactic acid in YPD medium and 20.32 ± 0.15 g / L in licorice residue medium.

[0046] Construction and fermentation of recombinant strain SC3 Using recombinant strain SC2 as the original strain, follow these steps in sequence: 5. The gene sequence of branched-chain 2-oxoacid decarboxylase THI3 from *Saccharomyces cerevisiae* was downloaded from NCBI. The 20 bp before the PAM site was located, and primers for the second gRNA (SEQ ID NO. 9 and SEQ ID NO. 13) and plasmid pSCM primers (SEQ ID NO. 11-12) were designed: Primer-L (SEQ ID NO.9) 5'-TAATGTGAGTTAGCTCACTCATTAGGCACCC 3' Primer-R (SEQ ID NO.13) 5'-GTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACTATCAGATTATCTTTTCCATGATCATTTATCTTTCACTGC 3' Primer-L (SEQ ID NO.11) 5'-GTTTTAGAGCTAGAAATAGCAAG 3' Primer-R (SEQ ID NO.12) 5'-AGCTCCAGCTTTTGTTCCC 3' Using plasmid pSCM as a template, the second gRNA fragment was amplified by PCR using primers shown in SEQ ID NO. 9 and SEQ ID NO. 13. The amplification program was: 98℃ for 3 min, 98℃ for 10 s, 60℃ for 5 s, 72℃ for 7 s, 34 cycles, 72℃ for 5 min, 4℃, and incubation. Using plasmid pSCM as a template, the pSCM fragment was amplified by PCR using primers shown in SEQ ID NO. 11-12. The amplification program was: 98℃ for 3 min, 98℃ for 10 s, 48℃ for 5 s, 72℃ for 65 s, 34 cycles, 72℃ for 5 min, 4℃, and incubation.

[0047] 6. Inoculate *E. coli* into liquid LB medium containing 50 μg / μL ampicillin and incubate overnight (12-16 h) at 37 ℃. Extract plasmid pTCL using a plasmid extraction kit and store at -20 ℃.

[0048] 7. After purifying the PCR products using a PCR product purification kit, the second gRNA fragment, pSCM fragment, and plasmid pTCL were transformed into recombinant strain SC2 using a Saccharomyces cerevisiae competent cell preparation and transformation kit. THI3 was knocked out using CRISPR-Cas9 technology, and transformants were screened using a medium lacking uracil and leucine. After successful verification by colony PCR, recombinant strain SC3 was obtained.

[0049] 8. Single colonies of recombinant strain SC3 were picked from the slant culture medium and pre-cultured in 50 mL YPD medium with constant temperature shaking at 30 °C and 220 r / min for 24 h. The seed culture of recombinant strain SC3 was then inoculated into 50 mL YPD medium and licorice residue medium at a 3% inoculum for anaerobic fermentation, and cultured for 72 h. The fermentation broth of recombinant strain SC3 was obtained. Single colonies of recombinant strain SC2 were picked from the slant culture medium and pre-cultured in 50 mL YPD medium with constant temperature shaking at 30 °C and 220 r / min for 24 h. The seed culture of recombinant strain SC2 was then inoculated into 50 mL YPD medium and licorice residue medium at a 3% inoculum for anaerobic fermentation, and cultured for 72 h. The fermentation broth of recombinant strain SC3 was obtained. High performance liquid chromatography (HPLC) analysis showed that SC3 produced 24.89 ± 0.18 g / L of L-lactic acid in YPD medium and 29.01 ± 0.23 g / L in licorice residue medium.

[0050] Construction and fermentation of recombinant strain SC4 Using Saccharomyces cerevisiae SC3 as the original strain, follow these steps in sequence: The whole genome of Saccharomyces cerevisiae S288C was extracted using a rapid yeast genomic DNA extraction kit and stored at -20 °C.

[0051] Escherichia coli was inoculated into liquid LB medium containing 50 μg / μL ampicillin and incubated overnight (12–16 h) at 37 °C. Plasmid pGS217 was extracted using a plasmid extraction kit and stored at -20 °C.

[0052] The gene sequence of pyruvate kinase (CDC19) was downloaded from NCBI and inserted into the pGS217 plasmid map on snapgene. Primer pairs (SEQ ID NO.14-17) were designed as follows: Primer-L (SEQ ID NO.14) 5'-GCATAGCAATCTAATCTAAGATGTCTAGATTAGAAAGATTGACCTCATTAAACG 3' Primer-R (SEQ ID NO.15) 5'-CTAATTACATGAGAATTCTTAAACGGTAGAGACTTGCAAAGTGTTG 3' Primer-L (SEQ ID NO.16) 5'-GCAAGTCTCTACCGTTTAAGAATTCTCATGTAATTAGTTATGTCACGCTTAC 3' Primer-R (SEQ ID NO.17) 5'-CTTTCTAATCTAGACATCTTAGATTAGATTGCTATGCTTTCTTTCTAATGAGC 3' Using the whole genome DNA of *Saccharomyces cerevisiae* S288C as a template, PCR amplification was performed using Taq DNA polymerase. The PCR program was: 98℃ for 3 min, 98℃ for 10 s, 58℃ for 5 s, 72℃ for 20 s, 34 cycles, followed by 72℃ for 5 min, and incubation at 4℃. The target fragment was approximately 1503 bp. Using plasmid pGS217 as a template, PCR amplification was performed using Taq DNA polymerase. The PCR program was: 98℃ for 3 min, 98℃ for 10 s, 59℃ for 5 s, 72℃ for 65 s, 34 cycles, followed by 72℃ for 5 min, and incubation at 4℃.

[0053] 4. After purifying the PCR product using a PCR product purification kit, perform seamless cloning using a seamless cloning kit and ligate it into the expression vector pGS217-CDC19.

[0054] 5. The obtained expression vector was transformed into *Saccharomyces cerevisiae* SC3 cells using a *Saccharomyces cerevisiae* competent cell preparation and transformation kit. Transformants were screened on histidine-free medium. After successful verification by colony PCR, recombinant strain SC4 was obtained.

[0055] 6. Single colonies of recombinant strain SC4 were picked from the slant culture medium and pre-cultured in 50 mL YPD medium at 30 °C with constant shaking at 220 r / min for 24 h. The seed culture of recombinant strain SC4 was then inoculated at a 3% inoculum into 50 mL YPD medium and licorice residue medium for anaerobic fermentation, and cultured for 72 h. The fermentation broth of recombinant strain SC4 was obtained. High-performance liquid chromatography (HPLC) analysis showed that SC4 produced 30.66 ± 0.21 g / L of L-lactic acid in YPD medium and 34.79 ± 0.17 g / L in licorice residue medium.

[0056] Construction and fermentation of recombinant strain SC5 Using Saccharomyces cerevisiae SC4 as the original strain, follow these steps in sequence: The whole genome of Saccharomyces cerevisiae S288C was extracted using a rapid yeast genomic DNA extraction kit and stored at -20 °C.

[0057] Escherichia coli was inoculated into liquid LB medium containing 50 μg / μL ampicillin and incubated overnight (12–16 h) at 37 °C. Plasmid pGS217 was extracted using a plasmid extraction kit and stored at -20 °C.

[0058] The gene sequence of H(+)-ATPase (PMA2) was downloaded from NCBI and inserted into the pGS217 plasmid map on snapgene. Primer pairs (SEQ ID NO.18-21) were designed as follows: Primer-L (SEQ ID NO.18) 5'-GCATAGCAATCTAATCTAAGATGTCTTCCACTGAAGCAAAGC 3' Primer-R (SEQ ID NO.19) 5'-CTAATTACATGAGAATTCCTAACTGCTTTTTTCGTGTTGAGTAGAAAC 3' Primer-L (SEQ ID NO.20) 5'-CGAAAAAAGCAGTTAGGAATTCTCATGTAATTAGTTATGTCACGCTTAC 3' Primer-R (SEQ ID NO.21) 5'-GCTTCAGTGGAAGACATCTTAGATTAGATTGCTATGCTTTCTTTCTAATGAGC 3' Using the whole genome DNA of *Saccharomyces cerevisiae* S288C as a template, PCR amplification was performed using Taq DNA polymerase. The PCR program was: 98℃ for 3 min, 98℃ for 10 s, 59℃ for 5 s, 72℃ for 30 s, 34 cycles, followed by 72℃ for 5 min, and incubation at 4℃. The target fragment was approximately 2844 bp. Using plasmid pGS217 as a template, PCR amplification was performed using Taq DNA polymerase. The PCR program was: 98℃ for 3 min, 98℃ for 10 s, 60℃ for 5 s, 72℃ for 75 s, 34 cycles, followed by 72℃ for 5 min, and incubation at 4℃.

[0059] 4. After purifying the PCR product using a PCR product purification kit, perform seamless cloning using a seamless cloning kit and ligate it into the expression vector pGS217-PMA2.

[0060] 5. The obtained expression vector was transformed into *Saccharomyces cerevisiae* SC4 using a *Saccharomyces cerevisiae* competent cell preparation and transformation kit. Transformants were screened on histidine-free medium. After successful verification by colony PCR, recombinant strain SC5 was obtained.

[0061] 6. Single colonies of recombinant strain SC5 were picked from the slant culture medium and pre-cultured in 50 mL YPD medium at 30 °C with constant temperature shaking at 220 r / min for 24 h. The seed culture of recombinant strain SC5 was inoculated at a rate of 3% into 50 mL YPD medium and licorice residue medium for anaerobic fermentation, and cultured for 72 h. The fermentation broth of recombinant strain SC5 was obtained. High-performance liquid chromatography (HPLC) analysis showed that SC5 produced 33.45 ± 0.19 g / L of L-lactic acid in YPD medium and 38.88 ± 0.2 g / L in licorice residue medium. SC4 and SC5 were cultured for 72 h in YPD medium containing 5 g / L of L-lactic acid and licorice residue medium containing 5 g / L of L-lactic acid, respectively, and OD600 was measured. The results showed that the cell density (OD600) growth rate of strain SC5 in both media was higher than that of strain SC4, indicating that SC5 was more tolerant to acidic environments.

[0062] L-lactic acid in the fermentation broth supernatant was detected using an HPLC-UV system (Shimadzu). After fermentation, the fermentation broth and cells were separated by centrifugation. 2 mL of the fermentation supernatant was centrifuged at 5000 rpm for 5 min. The supernatant was filtered through a 0.22 μm organic membrane and then detected using a C18 column (250 × 4.6 mm, 5 μm). The injection volume was 20 μL, the detection wavelength was 210 nm, the column temperature was 35 ℃, and the flow rate was 1.0 mL / min. The mobile phase was acetonitrile:phosphoric acid solution = 2.5:97.5. Isocratic elution was used.

[0063] Those skilled in the art should understand that the discussion of any of the above embodiments is merely exemplary and is not intended to imply that the scope of the invention is limited to these examples; within the framework of the invention, the technical features of the above embodiments or different embodiments can also be combined, the steps can be implemented in any order, and there are many other variations of the different aspects of the invention as described above, which are not provided in detail for the sake of brevity. Any omissions, modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the invention should be included within the scope of protection of the invention.

Claims

1. A method for constructing recombinant brewing yeast, characterized in that, Includes the following steps: Step 1: Using the whole genome of Enterococcus faecalis as a template, after PCR amplification, the expression vector pGS217-ELDH was constructed with the amplification product of plasmid pGS217. Then, it was transformed into competent cells of Saccharomyces cerevisiae to obtain recombinant strain SC1-1. Step 2: Using recombinant strain SC1-1 as the original strain, knock out the L-lactate dehydrogenase CYB2 gene in Saccharomyces cerevisiae to obtain recombinant strain SC2. Step 3: Using recombinant strain SC2 as the original strain, knock out the branched-chain 2-oxo acid decarboxylase THI3 gene of Saccharomyces cerevisiae to obtain recombinant strain SC3; Step 4: Using the whole genome of Saccharomyces cerevisiae as a template, after PCR amplification, the expression vector pGS217-CDC19 was constructed with the amplification product of plasmid pGS217. Then, it was transformed into competent cells of recombinant strain SC3 to obtain recombinant strain SC4.

2. The method for constructing recombinant brewer's yeast according to claim 1, characterized in that, The process also includes step five: using the whole genome of Saccharomyces cerevisiae as a template, the expression vector pGS217-PMA2 is constructed by PCR amplification and then combined with the amplification product of plasmid pGS217. This vector is then transformed into competent cells of recombinant strain SC4 to obtain recombinant strain SC5.

3. The method for constructing recombinant brewer's yeast according to claim 1, characterized in that, The method for obtaining recombinant strain SC1-1 in step one includes the following steps: A1. Design primer pairs as shown in SEQ ID NO.1-4 to insert the gene sequence of L-lactate dehydrogenase ELDH of Enterococcus faecalis into pGS217. Using the whole genome of Enterococcus faecalis as a template, perform PCR amplification using primer pairs as shown in SEQ ID NO.1-2; use plasmid pGS217 as a template, and perform PCR amplification using primer pairs as shown in SEQ ID NO.3-4. A2. After purifying the PCR product obtained in A1, the product was seamlessly cloned and ligated into the expression vector pGS217-ELDH. A3. Transform the expression vector pGS217-ELDH into competent cells of Saccharomyces cerevisiae to obtain the recombinant strain SC1-1.

4. The method for constructing recombinant brewer's yeast according to claim 1, characterized in that, Step two involves obtaining the recombinant strain SC2, which includes the following steps: B1. Using plasmid pSCM as a template, PCR amplification was performed using primers shown in SEQ ID NO.9-10 to obtain the first gRNA fragment. Using plasmid pSCM as a template, PCR amplification was performed using primers shown in SEQ ID NO.11-12 to obtain the pSCM fragment. After purifying the PCR products obtained from B2 and B1, the first gRNA fragment, pSCM fragment, and plasmid pTCL were transformed into competent cells of recombinant strain SC1-1 to obtain recombinant strain SC2.

5. The method for constructing recombinant brewing yeast according to claim 1, characterized in that, Step 3, the method for obtaining recombinant strain SC3, includes the following steps: C1. Using plasmid pSCM as a template, PCR amplification was performed using primers shown in SEQ ID NO. 9 and SEQ ID NO. 13 to obtain the second gRNA fragment. Using plasmid pSCM as a template, PCR amplification was performed using primers shown in SEQ ID NO. 11-12 to obtain the pSCM fragment. After purifying the PCR products obtained from C2 and C1, the second gRNA fragment, pSCM fragment, and plasmid pTCL were transformed into competent cells of recombinant strain SC2 to obtain recombinant strain SC3.

6. The method for constructing recombinant brewing yeast according to claim 1, characterized in that, Step four, which involves obtaining the recombinant strain SC4, includes the following steps: D1. Design primer pairs as shown in SEQ ID NO.14-17 to insert the gene sequence of pyruvate kinase CD19 into pGS217. Using the whole genome of Saccharomyces cerevisiae as a template, perform PCR amplification using primer pairs as shown in SEQ ID NO.14-15; use plasmid pGS217 as a template, and perform PCR amplification using primer pairs as shown in SEQ ID NO.16-17. A2. After purifying the PCR product obtained in A1, the product was seamlessly cloned and ligated into the expression vector pGS217-CDC19. A3. Transform the expression vector pGS217-CDC19 into competent cells of recombinant strain SC3 to obtain recombinant strain SC4.

7. The method for constructing recombinant brewer's yeast according to claim 2, characterized in that, Step 5, which involves obtaining the recombinant strain SC5, includes the following steps: D1. Design primer pairs as shown in SEQ ID NO.17-20 to insert the gene sequence of H(+)-ATPase PMA2 into pGS217. Using the whole genome of Saccharomyces cerevisiae as a template, perform PCR amplification using primer pairs as shown in SEQ ID NO.18-19; use plasmid pGS217 as a template, and perform PCR amplification using primer pairs as shown in SEQ ID NO.20-21. D2. After purifying the PCR product obtained in D1, the product was seamlessly cloned and ligated into the expression vector pGS217-PMA2. D3. Transform the expression vector pGS217-PMA2 into competent cells of recombinant strain SC4 to obtain recombinant strain SC5.

8. A recombinant brewing yeast, characterized in that, It was constructed using the method for constructing recombinant brewer's yeast as described in any one of claims 1-7.

9. The application of the recombinant brewing yeast of claim 8 in the production of L-lactic acid from licorice residue.

10. The application according to claim 9, characterized in that, The method for producing L-lactic acid from licorice residue is to first extract cellulose from licorice residue to prepare a licorice residue culture medium, and then inoculate, saccharify, and ferment to produce L-lactic acid.

Images