A molecular identity card of the genus Aristolochia, its combination and its application
By designing molecular identification cards for the Aristolochia genus and their combinations, and combining PCR amplification and high-throughput sequencing technologies, the problem of accuracy in identifying Aristolochia plant components was solved, and efficient identification of Aristolochia components in complex samples was achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INST OF MEDICINAL PLANT DEV CHINESE ACADEMY OF MEDICAL SCI
- Filing Date
- 2023-08-25
- Publication Date
- 2026-06-30
AI Technical Summary
Existing technologies struggle to accurately identify components of Aristolochia species, especially in complex samples where differentiation and identification are difficult. Furthermore, the application of conventional DNA barcoding is limited in samples with severely degraded DNA.
A molecular identity card and its combination for the genus Aristolochia were designed. Based on the matK gene sequence, nucleotide sequences were screened using bioinformatics techniques and BLAST was performed in the NCBI database to obtain specific nucleotide sequences. Combined with PCR amplification and high-throughput sequencing technology, Aristolochia components in the test samples were detected.
It enables accurate identification of Aristolochia components in plant materials and deep-processed samples, has stronger applicability and a wider range of applications, and can identify samples with severely degraded DNA.
Smart Images
Figure BDA0004413900050000031 
Figure BDA0004413900050000051 
Figure BDA0004413900050000052
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology, and more specifically, to a molecular identity card of the genus Aristolochia, its combination and its application. Background Technology
[0002] Plants in the genus *Aristolochia* are herbaceous or woody vines, rarely subshrubs or small trees, comprising approximately 400 species. Many plants in this genus have medicinal uses, possessing various pharmacological effects such as antibacterial, anti-inflammatory, analgesic, and antihypertensive properties. However, species in this genus generally contain aristolochic acids (AAs), which can accumulate in the human body and produce toxicity. Long-term or high-dose intake can lead to gene mutations, acute and chronic renal failure, liver cancer, and urothelial carcinoma, and these substances have been classified as Group 1 carcinogens. Avoiding the misuse of *Aristolochia* plants and early detection are crucial for the prevention and treatment of aristolochic acid poisoning. However, the genus *Aristolochia* contains numerous species, and due to their close phylogenetic relationships and similar morphological characteristics and chemical compositions, traditional identification methods are insufficient to accurately identify and distinguish different species. Furthermore, accurately identifying *Aristolochia* plant components is even more difficult in highly processed and complex samples (such as food and traditional Chinese medicine). Currently, DNA barcoding technology is considered a powerful tool for species identification. However, the application of conventional DNA barcoding is limited to some extent for samples with complex compositions and severely degraded DNA. Therefore, it is necessary to develop more versatile and widely applicable identification methods for detecting Aristolochia species components in complex samples. Summary of the Invention
[0003] One of the objectives of this invention is to provide a molecular identification method for accurately identifying the genus Aristolochia, as well as its combinations and applications.
[0004] To achieve this objective, the technical solution of the present invention is as follows:
[0005] This invention provides a molecular identity card for the genus Aristolochia, which is a nucleotide sequence as shown in SEQ ID No. 1.
[0006] The present invention provides another molecular identity card combination of the genus Aristolochia, which is a nucleotide sequence as shown in SEQ ID NO.1-6.
[0007] Based on the fact that the matK gene sequence has a certain ability to identify species of the Aristolochia genus, this invention uses bioinformatics technology to extract sequences of different lengths and perform batch BLAST in the NCBI database (National Center for Biotechnology Information) to obtain nucleotide sequences as shown in SEQ ID No. 1-6.
[0008] The Aristolochic genus molecular identification card or combination of Aristolochic genus molecular identification cards of the present invention can accurately and effectively identify Aristolochic genus components in the sample to be tested.
[0009] In this invention, the nucleotide sequences shown in SEQ ID NO.2-6 can be used as auxiliary molecular identification sequences to further improve the identification accuracy of the nucleotide sequences shown in SEQ ID No.1.
[0010] Furthermore, the present invention provides an application of the above-mentioned Aristolochia molecular identity card or combination of Aristolochia molecular identity cards in identifying whether a sample to be tested contains Aristolochia components.
[0011] The present invention also provides a method for identifying the genus Aristolochia, which determines whether the sample contains Aristolochia components by detecting whether the genomic DNA of the sample contains the aforementioned molecular identity card of the genus Aristolochia or a combination of molecular identity cards of the genus Aristolochia.
[0012] Specifically, the identification method of the present invention includes:
[0013] 1) Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed on fragments containing the nucleotide sequence shown in SEQ ID No. 1 or the nucleotide sequences shown in SEQ ID NO. 1-6;
[0014] 2) Detect whether the Aristolochia molecular identity card or a combination of Aristolochia molecular identity cards exists in the amplified fragment.
[0015] Or, including:
[0016] 1) Use high-throughput sequencing technology to sequence the genomic DNA of the sample to be tested;
[0017] 2) Detect whether there are reads in the high-throughput sequencing raw data that contain the molecular identity card of the Aristolochia genus or a combination of molecular identity cards of the Aristolochia genus.
[0018] If the sequence fragment shown in SEQ ID No. 1 or SEQ ID No. 1-6 is present in the sequencing results of the PCR amplification product or the raw high-throughput sequencing data, it can be determined that the sample to be tested contains Aristolochia components.
[0019] This invention can detect whether any Aristolochia species are present in any sample from which DNA can be extracted.
[0020] The sample to be tested can be a plant material used for species identification, or a complex mixed sample after deep processing, such as food or traditional Chinese medicine, used to identify the presence of Aristolochia components.
[0021] Specifically, the sample to be tested is a plant material or a mixed sample, such as Aristolochia plant material, medicinal materials, traditional Chinese medicine, and mixed food samples.
[0022] In the identification method of the present invention, the primers used for PCR amplification are nucleotide sequences as shown in SEQ ID No. 7 and SEQ ID No. 8.
[0023] Optionally, the reaction system for the PCR amplification is as follows:
[0024] 12.5 μL of 2×PCR Master Mix, 1.0 μL each of forward and reverse primers (2.5 μmol / L), 2 μL of template DNA, and sterile double-distilled water were added to a final volume of 25 μL for PCR amplification.
[0025] Optionally, the PCR amplification reaction procedure is as follows:
[0026]
[0027] The present invention also provides a reagent or kit comprising the above-mentioned Aristolochia molecular identity card or a combination of Aristolochia molecular identity cards. Furthermore, the application of the above-mentioned reagent or kit in identifying whether a sample contains Aristolochia components.
[0028] The beneficial effects of this invention are at least as follows:
[0029] The molecular identification card and its detection method provided by this invention have stronger applicability and a wider range of applications. They can be used to detect Aristolochia components in samples such as plant materials, medicinal materials, traditional Chinese medicine, and mixed foods. At the same time, they can also be used to identify Aristolochia components in materials with severely degraded DNA. Attached Figure Description
[0030] Figure 1 The result of BLAST alignment of the SEQ ID No. 9 sequence in Example 1 in NCBI.
[0031] Figure 2 The result of BLAST alignment of the SEQ ID No. 12 sequence in Example 1 in NCBI.
[0032] Figure 3 This is a partial result of the BLAST comparison of the Aristolochia genus molecular identification sequence SEQ ID No.1 in NCBI in Example 1.
[0033] Figure 4 The result of BLAST alignment of the Aristolochia genus molecular identification sequence SEQ ID No. 2 in Example 1 in NCBI.
[0034] Figure 5The result of BLAST alignment of the Aristolochia genus molecular identification sequence SEQ ID No. 3 in Example 1 in NCBI.
[0035] Figure 6 The result of BLAST alignment of the Aristolochia genus molecular identification sequence SEQ ID No. 4 in Example 1 in NCBI.
[0036] Figure 7 The result of BLAST alignment of the Aristolochia genus molecular identification sequence SEQ ID No. 5 in Example 1 with NCBI.
[0037] Figure 8 This is a partial result of the BLAST comparison of the Aristolochia genus molecular identification sequence SEQ ID No. 6 in NCBI in Example 1.
[0038] Figure 9 The sequence alignment results of the Aristolochia genus and other genera and species in the Aristolochiaceae family in Example 1 within the molecular identification region described in this invention.
[0039] Figure 10 The results of molecular identification searches for Aristolochia genus in the original high-throughput sequencing data of Example 2. Detailed Implementation
[0040] The preferred embodiments of the present invention will now be described in detail with reference to specific examples. It should be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.
[0041] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available or prepared according to conventional methods in the art. Example 1: Development and Validation of Molecular Identification Materials from the Genus Aristolochia
[0042] 1) The matK (maturase K) gene sequence of the genus *Aristolochia* was downloaded from the NCBI database. Multiple candidate sequences were obtained by screening conserved regions within the sequence. BLAST alignment of these candidate sequences was performed on each sequence in NCBI, and a region within the *Aristolochia* matK sequence that was relatively conserved within the genus and exhibited intergeneric specificity was selected. Fragments of different lengths within this sequence region were further extracted and BLASTed again to determine the optimal sequence fragment that could serve as a molecular identifier for the genus *Aristolochia* (Table 1). The alignment results showed that when the sequence fragment was longer, its conservation within the genus *Aristolochia* decreased, and a single sequence could not cover all species within the genus. Figure 1); however, when the sequence is too short, its specificity decreases, and the alignment results may match other genera and species ( ); Figure 2 Based on the combined verification results of intergeneric specificity and intrageneric conservation of sequences of different lengths, a set of molecular identity sequence combinations of the genus *Aristolochia* with a length of 24 bp was finally obtained (SEQ ID No. 1-6, Table 2), among which TTTATTGGGCTATCTCTCAAGTCTA (SEQ ID No. 1) is the core molecular identity sequence of the genus *Aristolochia*. BLAST results in NCBI showed that each sequence in the obtained molecular identity sequence combination matched 100% of species within the genus *Aristolochia*, and the TTTATTGGGCTATCTCTCAAGTCTA (SEQ ID No. 1) sequence covered the largest number of *Aristolochia* species. Therefore, this sequence was selected as the core molecular identity sequence of the genus *Aristolochia*. Figure 3 Meanwhile, the other five sequences in the sequence combination (SEQ ID No. 2-6) were 100% matched only by species of the genus Aristolochia (see below for details). Figures 4-8 The similarity between other species and the molecular identity sequence (SEQ ID No. 1-6) of the Aristolochia genus is less than 100%.
[0043] Table 1. BLAST alignment results of sequence fragments of different lengths in NCBI.
[0044]
[0045] A total of 599 matK sequences of the genus *Aristolochia*, up to July 11, 2023, were downloaded from NCBI, covering 161 species in the genus. The core molecular identifier sequence (SEQ ID No. 1) matched 100% with 471 *Aristolochia* species sequences, accounting for 78.6% of all *Aristolochia* sequences, proving that this sequence can serve as the core molecular identifier for the genus. Furthermore, comparisons of molecular identifier sequences of other genera within the Aristolochiaceae family with those of the genus *Aristolochia* showed that species from other genera outside the genus possessed one or more variation sites in this region. Figure 9 The above results indicate that the molecular identification code described in this invention is a unique sequence of the Aristolochia genus, which can be used to distinguish Aristolochia species from non-Aristolochia species, and is suitable as a specific molecular marker for the Aristolochia genus.
[0046] Table 2. Identification Sequence of Aristolochia Genus Molecular Elements
[0047] Serial Number Molecular ID sequence Number of Aristolochia genus sequences matched by BLAST SEQ ID No.1 TTTATGGGCTATCTCTCAAGTCTA 471 SEQ ID No.2 TTTATGGGCTATCTTTCAAGTCTA 4 SEQ ID No. 3 TTTATAGGCTATCTCTCAATTCTA 3 SEQ ID No. 4 TTTTTGGGCTATCTCTCAAGTCTA 6 SEQ ID No. 5 TTTATGGGCTATCTCTTAAGTCTA 1 SEQ ID No. 6 TTTATGGGATATCTCTCAAGTCTA 114
[0048] 2) Twenty samples of Aristolochia species were collected, comprising 12 species (Table 3). Approximately 30 mg of each sample was taken, thoroughly ground in a ball mill, and total DNA was extracted using the Plant Genomic DNA Extraction Kit from Tiangen Biotech (Beijing) Co., Ltd.
[0049] Table 3. Information on samples of the genus Aristolochia
[0050]
[0051]
[0052] 3) PCR amplification
[0053] The primer sequences used for PCR amplification were: forward primer MDL-1F: 5'-CAACCGGGCAGAATCCATAT-3' (SEQ ID No. 7), and reverse primer MDL-1R: 5'-GCATTTGACTCCTTACCATCG-3' (SEQ ID No. 8), synthesized by Beijing Nuosai Genome Research Center Co., Ltd. The primers were dissolved in sterile deionized water and diluted to 2.5 μmol / L.
[0054] 25μL reaction system: 12.5μL 2×PCR Master Mix, 1.0μL each of forward and reverse primers (2.5μmol / L), 2.0μL template DNA, add sterile double-distilled water to 25μL, and perform PCR amplification.
[0055] PCR reaction procedure: Perform the amplification reaction on the PCR instrument according to the following procedure:
[0056]
[0057] 4) Sequencing
[0058] The PCR products were sent to the Major Engineering Laboratory of the Chinese Academy of Agricultural Sciences for Sanger sequencing. The sequencing primers were the same as the PCR amplification primers MDL-1F and MDL-1R of this invention. To ensure the reliability of the DNA barcode sequence, forward and reverse sequencing or repeated sequencing was required, and then the forward and reverse sequencing results were spliced to obtain the DNA barcode sequence.
[0059] 5) Sequence splicing
[0060] This embodiment uses CodonCode Aligner 5.2.0 (CodonCode Co., USA) for sequence assembly and proofreading. First, sequencing quality assessment and preprocessing are performed, i.e., removing low-quality portions at both ends of the sequencing result and assessing the quality of the remaining portion. Only if the quality requirements are met can it be used for sequence assembly. Specifically, a 20bp window is slid from the 5' and 3' ends of the sequence. If more than two bases within the window have a Q value less than 20, one base is deleted, and the window continues to slide. If the number of bases with a Q value less than 20 within the window is less than or equal to two, the window stops sliding. The average Q value of the sequencing result is greater than or equal to 30. The primer regions at both ends of the sequence are removed to obtain the final target sequence.
[0061] 6) Sequence alignment
[0062] The sequence obtained after sequencing and splicing was compared with the matK sequence of Aristolochia genus downloaded from NCBI using MEGA 5 software. The comparison results showed that the molecular identification sequence described in this invention could be detected in the sequencing results of all Aristolochia genus plant samples tested, and this region is relatively conserved within the Aristolochia genus.
[0063] Example 2: Species detection of Aristolochia based on high-throughput sequencing and molecular identification
[0064] 1) After grinding the Aristolochia plant samples in liquid nitrogen, total DNA was extracted using the plant genomic DNA extraction kit from Tiangen Biotech (Beijing) Co., Ltd.
[0065] 2) Construct a PCR-free DNA sequencing library using the extracted DNA sample, and perform high-throughput sequencing on it using the Illumina sequencing platform.
[0066] 3) Directly retrieve molecular identity sequences of the Aristolochia genus from the obtained raw high-throughput sequencing data.
[0067] 4) The results showed that sequencing reads containing the molecular identifier sequence of the Aristolochia genus described in this invention could be directly retrieved from high-throughput sequencing data. Figure 10 Therefore, the detection of Aristolochia species can be achieved by combining high-throughput sequencing with molecular identification methods. Furthermore, the molecular identification sequence of this invention can also be accurately detected in Aristolochia sample powder, thus this method can be applied to the detection of Aristolochia components in complex materials with severely degraded DNA after deep processing, such as traditional Chinese medicine and mixed food samples.
[0068] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
Claims
1. A molecular identity card of the Aristolochia genus, characterized in that, The nucleotide sequence of the Aristolochia molecular identity card is shown in SEQ ID No.
1.
2. A molecular identity card combination of Aristolochia species, characterized in that, The nucleotide sequence of the Aristolochia molecular identity card combination is shown in SEQ ID NO.1-6.
3. The application of the Aristolochia molecular identification card as described in claim 1 or the Aristolochia molecular identification card combination as described in claim 2 in identifying whether a sample to be tested contains Aristolochia components.
4. A method for identifying species in the genus Aristolochia, characterized in that, Whether the sample contains Aristolochia components is determined by detecting whether the Aristolochia molecular identity card as described in claim 1 or the Aristolochia molecular identity card combination as described in claim 2 exists in the genomic DNA of the sample.
5. The identification method according to claim 4, characterized in that, include: 1) Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed on fragments containing the nucleotide sequence shown in SEQ ID No. 1 or the nucleotide sequences shown in SEQ ID NO. 1-6; 2) Detect whether the Aristolochia molecular identity card or a combination of Aristolochia molecular identity cards exists in the amplified fragment.
6. The identification method according to claim 4, characterized in that, include: 1) Use high-throughput sequencing technology to sequence the genomic DNA of the sample to be tested; 2) Detect whether there are reads in the high-throughput sequencing raw data that contain the molecular identity card of the Aristolochia genus or a combination of molecular identity cards of the Aristolochia genus.
7. The identification method according to claim 5 or 6, characterized in that, The sample to be tested is a plant material or a mixed sample.
8. The identification method according to claim 5, characterized in that, The primers used for PCR amplification are nucleotide sequences as shown in SEQ ID No. 7 and SEQ ID No.
8.
9. A reagent or kit containing the Aristolochia molecular identity card as described in claim 1 or the Aristolochia molecular identity card combination as described in claim 2.
10. The use of the reagent or kit according to claim 9 in identifying whether a sample to be tested contains Aristolochia components.