Use of the eln gene in the preparation of a medicament for repairing aging choroid and / or retinal pigment epithelium
By overexpressing the ELN gene in the retinal pigment epithelium and choroid, the structural laxity caused by aging was addressed, resulting in improved structural morphology and functional recovery, and demonstrating the potential to prevent and treat age-related macular degeneration.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SICHUAN ACADEMY OF MEDICAL SCI SICHUAN PROVINCIAL PEOPLES HOSPITAL
- Filing Date
- 2022-06-17
- Publication Date
- 2026-06-05
AI Technical Summary
With age, dysfunction of the retinal pigment epithelium and choroid is closely related to age-related macular degeneration. However, the relationship between ELN gene expression and RPE and choroidal function has not been reported in the current technology, leading to the loosening of the choroid and retinal pigment epithelium structure in the elderly, and there is a lack of effective repair methods.
By constructing an ELN gene overexpression vector, and using plasmids or adeno-associated viruses containing the ELN gene, especially AAV-DJ type adeno-associated virus, the ELN gene is overexpressed to increase the expression of elastin and actin in the choroid and retinal pigment epithelium, thereby improving basal surface compactness and structural morphology.
In mouse models, ELN gene overexpression increased actin expression in the choroidal and RPE layers, maintained structural morphology and compactness, and improved the structure of aging choroid and RPE, showing promise for the prevention and treatment of age-related macular degeneration.
Smart Images

Figure CN117281924B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedicine, specifically relating to the use of the ELN gene in the preparation of drugs for repairing aging choroid and / or retinal pigment epithelium. Background Technology
[0002] The retinal pigment epithelium (RPE) is a continuous single layer of epithelial cells behind the retina. The RPE has multiple functions, such as absorbing light, storing and absorbing vitamin A esters, and phagocytizing the outer segments of rods and cones. The choroid is a heterogeneous connective tissue that supports the RPE and the outer layer of the retina, located behind the RPE. The choroid contains a rich vascular system that plays a crucial role in supplying oxygenated blood to the RPE and photoreceptor cells. The choroidal vascular bed supplies approximately 85% of the blood to the entire retina and is anatomically composed of a very dense superficial capillary system called the choroidal capillaries. The choroid contains several cell types found in other connective tissues, including fibroblasts, melanocytes, pericytes, and infiltrating immune cells.
[0003] The retinas per their retina (RPE) and choroid work in close coordination, both physiologically and pathologically. With age, lipofuscin accumulates in the human retina, weakening RPE cells. Simultaneously, choroidal thickness decreases dramatically with age, reducing choroidal blood flow. Dysfunction of the RPE and choroid is closely related to the pathogenesis of age-related macular degeneration (AMD).
[0004] The ELN gene (NCBI sequence number: NM_001081754.3) encodes elastin, an important protein in the extracellular matrix of higher vertebrates. This protein endows various tissues and organs with elasticity and plays a crucial role in various physiological processes. For example, studies have found that decreased ELN expression may lead to insufficient expression of cartilage elastic fibers, which is detrimental to the remodeling of elastic cartilage (Dong Kexin. Study on the expression and role of elastic fiber-related components in engineered cartilage tissue [D]. Peking Union Medical College, 2020. DOI:10.27648 / d.cnki.gzxhu.2020.000856.); another example is patent application CN113039273A, which discloses that targeted promotion of ELN gene expression, which encodes elastin protein, can delay skin aging.
[0005] However, the relationship between ELN gene expression and RPE and choroidal function has not yet been reported. Summary of the Invention
[0006] The purpose of this invention is to provide new uses for ELN gene expression.
[0007] This invention provides the use of the ELN gene or plasmids or viruses containing the ELN gene in the preparation of medicaments for repairing aging choroid and / or retinal pigment epithelium.
[0008] Furthermore, the aforementioned drugs are those that increase the expression of elastin and / or actin in the choroid and / or retinal pigment epithelium.
[0009] Furthermore, the aforementioned drugs are those that enhance the density of the basal surface of the retinal pigment epithelium.
[0010] Furthermore, the aforementioned drugs are those that improve the structural morphology of the aging choroid and / or retinal pigment epithelium.
[0011] Furthermore, the aforementioned drugs are for the prevention and treatment of age-related macular degeneration.
[0012] Furthermore, the plasmid containing the ELN gene is a pAV-CMV-P2A-GFP plasmid containing the ELN gene, the sequence of which is shown in SEQ ID NO.1.
[0013] Furthermore, the aforementioned virus containing the ELN gene is an adeno-associated virus containing the ELN gene.
[0014] Furthermore, the aforementioned adeno-associated virus is the AAV-DJ type adeno-associated virus.
[0015] Furthermore, the adeno-associated virus containing the ELN gene described above is an adeno-associated virus that packages a plasmid containing the ELN gene.
[0016] Furthermore, the plasmid containing the ELN gene is a pAV-CMV-P2A-GFP plasmid containing the ELN gene, the sequence of which is shown in SEQ ID NO.1.
[0017] The beneficial effects of this invention are as follows: By constructing an ELN overexpression vector and overexpressing the gene in mouse eyes, the amount of actin in the choroidal and retinal pigment epithelium (RPE) layers increases, which helps maintain the structural morphology of the mouse choroid and RPE layers; helps maintain the compactness of the RPE layer basal surface and the integrity of the RPE structure; and helps maintain the smoothness of the choroidal fiber structure, without significantly affecting the blood vessels and pigment of the choroidal layer. This indicates that the ELN gene can serve as a research target for improving the relaxation of the choroidal and RPE structure and remodeling the aging choroid and RPE, and has application prospects in the preparation of drugs for repairing the aging choroid and / or retinal pigment epithelium (e.g., drugs for the prevention and treatment of age-related macular degeneration).
[0018] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.
[0019] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description
[0020] Figure 1 This is a map of the pAV-CMV-P2A-GFP plasmid.
[0021] Figure 2 The expression of ELN protein in the choroid and RPE layers of the eyeball of aged mice.
[0022] Figure 3 The expression of actin in the choroid and RPE layers of the eyeball of aged mice.
[0023] Figure 4 Comparison of RPE layer morphology in the eyes of aged and young mice.
[0024] Figure 5 The RPE layer structure of aged and young mice.
[0025] Figure 6 The microstructure of the choroid layer in the eyes of aged and young mice.
[0026] Figure 7 This study describes the changes in choroidal blood vessels (BVs) and pigment granules (PGs) in the eyes of aged and young mice. Detailed Implementation
[0027] Unless otherwise stated, all raw materials and equipment used in this invention are known products, obtained by purchasing commercially available products.
[0028] Example 1: ELN gene overexpression plasmid
[0029] The plasmid carrying the ELN gene was constructed as pAV-CMV-P2A-GFP (NM_001081754.3). The pAV-ELN-CMV-P2A-GFP plasmid of this invention was customized by Shandong Weizhen Biotechnology Co., Ltd. The plasmid uses the CMV promoter to start the expression of human ELN, adds the Kozak sequence GCCACC before the target gene ATG, adds a flag tag to the C-terminus of the target gene, and expresses the target gene and GFP in a P2A non-fusion manner.
[0030] The pAV-CMV-ELN-P2A-GFP (7361bp) plasmid sequence (SEQ ID NO.1) is shown below, where the underlined portion is the sequence of the target gene ELN:
[0031] ATGGCGGGTCTGACGGCGGCGGCCCCGCGGCCCGGAGTCCTCCTGCTCCTGCTGTCCATCCTCCAC CCCTCTCGGCCTGGAGGGGTCCCTGGGGCCATTCCTGGTGGAGTTCCTGGAGGAGTCTTTTATCCAGGGGCTGGTCT CGGAGCCCTTGGAGGAGGAGCGCTGGGGCCTGGAGGCAAACCTCTTAAGCCAGTTCCCGGAGGGCTTGCGGGTGCTG GCCTTGGGGCAGGGCTCGGCGCCTTCCCCGCAGTTACCTTTCCGGGGGCTCTGGTGCCTGGTGGAGTGGCTGACGCT GCTGCAGCCTATAAAGCTGCTAAGGCTGGCGCTGGGCTTGGTGGTGTCCCAGGAGTTGGTGGCTTAGGAGTGTCTGC AGCCCCTTCTGTGCCAGGTGCGGTGGTTCCTCAGCCTGGAGCCGGAGTGAAGCCTGGGAAAGTGCCGGGTGTGGGGC TGCCAGGTGTATACCCAGGTGGCGTGCTCCCAGGAGCTCGGTTCCCCGGTGTGGGGGTGCTCCCTGGAGTTCCCACT GGAGCAGGAGTTAAGCCCAAGGCTCCAGGTGTAGGTGGAGCTTTTGCTGGAATCCCAGGAGTTGGACCCTTTGGGGG ACCGCAACCTGGAGTCCCACTGGGGTATCCCATCAAGGCCCCCAAGCTGCCTGGTGGCTATGGACTGCCCTACACCA CAGGGAAACTGCCCTATGGCTATGGGCCCGGAGGAGTGGCTGGTGCAGCGGGCAAGGCTGGTTACCCAACAGGGACA GGGGTTGGCCCCCAGGCAGCAGCAGCAGCGGCAGCTAAAGCAGCAGCAAAGTTCGGTGCTGGAGCAGCCGGAGTCCT CCCTGGTGTTGGAGGGGCTGGTGTTCCTGGCGTGCCTGGGGCAATTCCTGGAATTGGAGGCATCGCAGGCGTTGGGA CTCCAGCTGCAGCTGCAGCTGCAGCAGCAGCCGCTAAGGCAGCCAAGTATGGAGCTGCTGCAGGCTTAGTGCCTGGT GGGCCAGGCTTTGGCCCGGGAGTAGTTGGTGTCCCAGGAGCTGGCGTTCCAGGTGTTGGTGTCCCAGGAGCTGGGAT TCCAGTTGTCCCAGGTGCTGGGATCCCAGGTGCTGCGGTTCCAGGGGTTGTGTCACCAGAAGCAGCTGCTAAGGCAG CTGCAAAGGCAGCCAAATACGGGGCCAGGCCCGGAGTCGGAGTTGGAGGCATTCCTACTTACGGGGTTGGAGCTGGG GGCTTTCCCGGCTTTGGTGTCGGAGTCGGAGGTATCCCTGGAGTCGCAGGTGTCCCTGGTGTCGGAGGTGTTCCCGG AGTCGGAGGTGTCCCGGGAGTTGGCATTTCCCCCGAAGCTCAGGCAGCAGCTGCCGCCAAGGCTGCCAAGTACGGAG TGGGGACCCCAGCAGCTGCAGCTGCTAAAGCAGCCGCCAAAGCCGCCCAGTTTGGGTTAGTTCCTGGTGTCGGCGTG GCTCCTGGAGTTGGCGTGGCTCCTGGTGTCGGTGTGGCTCCTGGAGTTGGCTTGGCTCCTGGAGTTGGCGTGGCTCC TGGAGTTGGTGTGGCTCCTGGCGTTGGCGTGGCTCCCGGCATTGGCCCTGGTGGAGTTGCAGCTGCAGCAAAATCCG CTGCCAAGGTGGCTGCCAAAGCCCAGCTCCGAGCTGCAGCTGGGCTTGGTGCTGGCATCCCTGGACTTGGAGTTGGT GTCGGCGTCCCTGGACTTGGAGTTGGTGCTGGTGTTCCTGGACTTGGAGTTGGTGCTGGTGTTCCTGGCTTCGGGGC AGTACCTGGAGCCCTGGCTGCCGCTAAAGCAGCCAAATATGGAGCAGCAGTGCCTGGGGTCCTTGGAGGGCTCGGGG CTCTCGGTGGAGTAGGCATCCCAGGCGGTGTGGTGGGAGCCGGACCCGCCGCCGCCGCTGCCGCAGCCAAAGCTGCT GCCAAAGCCGCCCAGTTTGGCCTAGTGGGAGCCGCTGGGCTCGGAGGACTCGGAGTCGGAGGGCTTGGAGTTCCAGG TGTTGGGGGCCTTGGAGGTATACCTCCAGCTGCAGCCGCTAAAGCAGCTAAATACGGAGTGGCAGCAAGACCTGGCT TCGGATTGTCTCCCATTTTCCCAGGTGGGGCCTGCCTGGGGAAAGCTTGTGGCCGGAAGAGAAAA
[0032] plasmid maps as follows Figure 1 As shown.
[0033] Example 2: AAV-DJ type adeno-associated virus (AAV DJ) overexpressing the ELN gene
[0034] The plasmid from Example 1 was packaged into AAV-DJ type adeno-associated virus. The final viral concentration was 2.2 × 10⁻⁶. 13 viral genomes / mL, the virus was stored in balanced salt solution (BSS) with 0.014% Tween 20 (Alcon, Forth Worth Texas).
[0035] Comparative Example 1: AAV-DJ type adeno-associated virus without the ELN gene
[0036] AAV-DJ type adeno-associated virus expressing only GFP was used as a control.
[0037] The following experimental examples demonstrate the beneficial effects of the present invention.
[0038] Experimental Example 1: Effects of ELN gene overexpression on the choroid and retinal pigment epithelium
[0039] Experimental methods:
[0040] 1. Intravitreal injection of AAV DJ virus into mice:
[0041] This invention uses C57BL / 6J mice, housed in a 25°C environment with 12-hour light-dark cycles and a continuous supply of water and food. Mice were divided into an old group (18 months old) and a young group (2 months old). Based on mouse weight, mice were anesthetized by intraperitoneal injection of 4% chloral hydrate, and their pupils were dilated with tropicamide eye drops. A 30g needle (manufacturer: Decton, Dickinson and Company, model: 30g x 1 / 2) was used to make a puncture at the lower edge of the mouse's eye along the equator. One microliter of virus containing 0.5% sodium fluorescein (Example 2) (virus titer: 2.2 × 10⁻⁶) was injected using a microsyringe (syringe, Hamilton No. 7632-01; needle, Hamilton No. 7803-05). 13 A dose of virus (vg / ml) was injected into the vitreous humor, and the needle was left in the eye for 10 seconds before being withdrawn. The same dose of the virus from Comparative Example 1 was injected into the vitreous humor of aged and young mice using the same injection method as a control. Three months after the virus injection, the mice were anesthetized and euthanized, and their eyeballs were harvested for experimental observation.
[0042] 2. Immunofluorescence staining of mouse eyeball sections:
[0043] (1) The removed eyeball was briefly fixed in 4% PFA (about 10 minutes). A small incision was made in the cornea with ophthalmic scissors, and the eyeball was kept on ice for 2 hours. It was then washed 3 times with PBS.
[0044] (2) Place the fixed eyeball in a 30% sucrose solution to dehydrate it overnight at 4°C until the eyeball settles to the bottom;
[0045] (3) Remove the eyeball, and under a dissecting microscope, cut off the cornea along the equator. Carefully remove the lens to avoid damaging other parts of the eyeball, and aspirate the fluid. Place it in an embedding cassette filled with OCT and freeze at -80°C for 30 minutes. Perform sectioning on a cryostat with a thickness of 12 μm.
[0046] (4) Dry the cut slides at 37℃ for 30 min. Remove the slides and place them in an immunohistochemistry humidifier. Draw circles around the tissue with an oil-based pen. Wash with PBS 3 times, 5 min each time.
[0047] (5) Add 50 μl of blocking solution (5% serum, 0.25% Triton X-100 + 0.06% sodium azide) and incubate at room temperature for 2 h;
[0048] (6) Remove the blocking solution, add an appropriate ratio of primary antibody ((ELN:Elastin,Abcam,#ab21610,1:100), F-Actin (Invitrogen,#A12381,1:40)), incubate at 4°C overnight, remove the primary antibody, wash with PBS 3 times, 5 min each time;
[0049] (7) Add appropriate concentrations of fluorescent secondary antibody (1:500), incubate in the dark at room temperature for 1 h, wash 3 times with PBS, 5 min each time;
[0050] (8) Mount the slide with DAPI-containing mounting medium and observe and photograph it under a laser confocal microscope.
[0051] 3. Sample preparation and observation for transmission electron microscopy of mouse eyeballs:
[0052] The eyeballs were pre-fixed with 3% glutaraldehyde, fixed in 1% osmium tetroxide, dehydrated in a series of acetones, and embedded in Epox 812. Semi-thin sections were stained with methylene blue for observation, and ultrathin sections were cut with a diamond scalpel and stained with uranyl acetate and lead citrate. The images were taken using a JEM-1400-FLASH transmission electron microscope.
[0053] 4. Scanning electron microscopy sample preparation and observation of mouse eyeballs:
[0054] The ocular tissue was rinsed twice with water for 5 minutes each time, and then dehydrated with a series of gradient alcohols (30%, 50%, 70%, 80%, 90%, 95%, 100%) for 10 minutes each. The sample was gently adhered to a conductive adhesive and sprayed using ion sputtering. The images were observed and photographed using an ion sputtering apparatus (E-1045, Japan) and a scanning electron microscope (INSPECT, FEI, USA).
[0055] Experimental results:
[0056] like Figure 2 As shown, it can be seen that after the virus AAV DJ overexpressing ELN of the present invention was injected into the eyeballs of aged mice via intravitreal injection, the expression of ELN protein increased in the choroidal layer and RPE layer of the mouse eyeball.
[0057] like Figure 3 As shown, it can be seen that after the virus AAV DJ overexpressing ELN of the present invention was injected into the eyeball of aged mice via intravitreal injection, the expression of the cytoskeletal protein Actin was increased in the choroidal layer and RPE layer of the mouse eyeball.
[0058] like Figure 4 As shown, the AAV DJ virus overexpressing ELN of this invention, after intravitreal injection into the eyeballs of aged mice, exhibits a more compact basal surface compared to the control RPE layer.
[0059] like Figure 5 As shown, after the ELN-overexpressing virus AAV DJ of this invention was injected into the eyeball of aged mice via intravitreal injection, the RPE formation results showed that the RPE structure was well maintained and the structural morphology was comparable to that of the young mice, which was significantly improved compared to the aged mouse control group.
[0060] like Figure 6 As shown, the choroidal fibrous structure of the virus AAV DJ overexpressing ELN in this invention was smoother than that of the control after intravitreal injection into the eyes of aged and young mice.
[0061] like Figure 7 As shown, after intravitreal injection of the ELN-overexpressing virus AAV DJ into the eyes of aged and young mice, no significant changes were observed in the choroidal blood vessels (BVs) and pigment granules (PGs), and no significant side effects were observed.
[0062] In summary, this invention provides a novel application for the ELN gene. By constructing an ELN overexpression vector and overexpressing the gene in mouse eyes, the amount of actin in the choroidal and retinal pigment epithelium (RPE) layers increases, which is beneficial for maintaining the structural morphology of the choroid and RPE layers. Furthermore, it maintains the compactness of the RPE layer basal surface and the integrity of the RPE structure, as well as the smoothness of the choroidal fiber structure, without significantly affecting the blood vessels and pigment of the choroidal layer. This indicates that the ELN gene has potential for improving the relaxation of the choroidal and RPE structures, remodeling aging choroid and RPE, and is promising for use in the preparation of drugs to repair aging choroid and / or retinal pigment epithelium (e.g., drugs for the prevention and treatment of age-related macular degeneration). SEQUENCE LISTING <110> Sichuan Academy of Medical Sciences & Sichuan Provincial People's Hospital <120> Use of the ELN gene in the preparation of drugs for repairing aging choroid and / or retinal pigment epithelium <130> GYKH1123-2022P0115018CC <160> 2 <170> PatentIn version 3.5 <210> 1 <211> 7361 <212> DNA <213> pAV-CMV-ELN-P2A-GFP <400> 1 cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct gcggccggtc gcgtctagtt attaatagta atcaattacg gggtcattag 180 ttcatagccc atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct 240 gaccgcccaa cgacccccgc ccattgacgt caataatgac gtatgttccc atagtaacgt 300 caatagggac tttccattga cgtcaatggg tggagtattt acggtaact gcccacttgg 360 cagtacatca agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat 420 ggcccgcctg gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca 480 tctacgtatt agtcatcgct attaccatgg tgatgcggtt tggcagtac atcaatgggc 540 gtggatagcg gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga 600 gtttgttttg caccaaaatc aacggactt tccaaatgt cgtaacact ccgccccatt 660 gacgcaaatg ggcggtaggc gtgtacggtg ggggtctat ataagcagag ctcgtttagt 720 gaaccgtcag atcgcctgga gacgccatcc acgctgtttt gacctccata gaagacaccg 780 ggaccgatcc agcctccgcg gattcgaatc ccggccggga acggtgcatt ggaacgcgga 840 ttccccgtgc caagtgac gtaagtaccg cctatagagt ctataggcccc acaaaaaatg 900 ctttctctt ttatatact ttttgttta tcttatttct atactttcc ctaatctctt 960 tctttcagggg caataatgat acatgtatc atgcccttt gcaccattct aagaataac 1020 agtgataatt tctgggttaa ggcaatagca atatttctgc atataaatat ttctgcatat 1080 aaattgtaac tgatgtaaga ggtttcatat tgctaatagc agctacaatc cagctaccat 1140 tctgctttta ttttatggtt gggataaggc tggattattc tgagtccaag ctaggccctt 1200 ttgctaatca tgttcatacc tcttatcttc ctcccacagc tcctgggcaa cgtgctggtc 1260 tgtgtgctgg cccatcactt tggcaaagaa ttgggattcg aacatcgatt gaattcagat 1320 ccgctagtaa tacgactcac tatagggaga ggatccggta ccgaggagat ctgccgccgc 1380 gatgccacca tggcgggtct gacggcggcg gccccgcggc ccggagtcct cctgctcctg 1440 ctgtccatcc tccacccctc tcggcctgga ggggtccctg gggccattcc tggtggagtt 1500 cctggaggag tcttttatcc aggggctggt ctcggagccc ttggaggagg agcgctgggg 1560 cctggaggca aacctcttaa gccagttccc ggagggcttg cgggtgctgg ccttggggca 1620 gggctcggcg ccttccccgc agttaccttt ccgggggctc tggtgcctgg tggagtggct 1680 gacgctgctg cagcctataa agctgctaag gctggcgctg ggcttggtgg tgtcccagga 1740 gttggtggct taggagtgtc tgcagcccct tctgtgccag gtgcggtggt tcctcagcct 1800 ggagccggag tgaagcctgg gaaagtgccg ggtgtggggc tgccaggtgt atacccaggt 1860 ggcgtgctcc caggagctcg gttccccggt gtgggggtgc tccctggagt tcccactgga 1920 gcaggagtta agcccaaggc tccaggtgta ggtggagctt ttgctggaat cccaggagtt 1980 ggaccctttg ggggaccgca acctggagtc ccactggggt atcccatcaa ggcccccaag 2040 ctgcctggtg gctatggact gccctacacc acagggaaac tgccctatgg ctatgggccc 2100 ggaggagtgg ctggtgcagc gggcaaggct ggttacccaa cagggacagg ggttggcccc 2160 caggcagcag cagcagcggc agctaaagca gcagcaaagt tcggtgctgg agcagccgga 2220 gtcctccctg gtgttggagg ggctggtgtt cctggcgtgc ctggggcaat tcctggaatt 2280 ggaggcatcg caggcgttgg gactccagct gcagctgcag ctgcagcagc agccgctaag 2340 gcagccaagt atggagctgc tgcaggctta gtgcctggtg ggccaggctt tggcccggga 2400 gtagttggtg tcccaggagc tggcgttcca ggtgttggtg tcccaggagc tgggattcca 2460 gttgtcccag gtgctgggat cccaggtgct gcggttccag gggttgtgtc accagaagca 2520 gctgctaagg cagctgcaaa ggcagccaaa tacggggcca ggcccggagt cggagttgga 2580 ggcattccta cttacggggt tggagctggg ggctttcccg gctttggtgt cggagtcgga 2640 ggtatccctg gagtcgcagg tgtccctggt gtcggaggtg ttcccggagt cggaggtgtc 2700 ccgggagttg gcatttcccc cgaagctcag gcagcagctg ccgccaaggc tgccaagtac 2760 ggagtgggga ccccagcagc tgcagctgct aaagcagccg ccaaagccgc ccagtttggg 2820 ttagttcctg gtgtcggcgt ggctcctgga gttggcgtgg ctcctggtgt cggtgtggct 2880 cctggagttg gcttggctcc tggagttggc gtggctcctg gagttggtgt ggctcctggc 2940 gttggcgtgg ctcccggcat tggccctggt ggagttgcag ctgcagcaaa atccgctgcc 3000 aaggtggctg ccaaagccca gctccgagct gcagctgggc ttggtgctgg catccctgga 3060 cttggagttg gtgtcggcgt ccctggactt ggagttggtg ctggtgttcc tggacttgga 3120 gttggtgctg gtgttcctgg cttcggggca gtacctggag ccctggctgc cgctaaagca 3180 gccaaatatg gagcagcagt gcctggggtc cttggagggc tcggggctct cggtggagta 3240 ggcatcccag gcggtgtggt gggagccgga cccgccgccg ccgctgccgc agccaaagct 3300 gctgccaaag ccgcccagtt tggcctagtg ggagccgctg ggctcggagg actcggagtc 3360 ggagggcttg gagttccagg tgttgggggc cttggaggta tacctccagc tgcagccgct 3420 aaagcagcta aatacggagt ggcagcaaga cctggcttcg gattgtctcc cattttccca 3480 ggtggggcct gcctggggaa agcttgtggc cggaagagaa aagattacaa ggatgacgac 3540 gataagcgcg tgctactaac ttcagcctgc tgaagcaggc tggagacgtg gaggagaacc 3600 ctggacctgt cgacatggtg agcaagggcg aggagctgtt caccggggtg gtgcccatcc 3660 tggtcgagct ggacggcgac gtaaacggcc acaagttcag cgtgtccggc gagggcgagg 3720 gcgatgccac ctacggcaag ctgaccctga agttcatctg caccaccggc aagctgcccg 3780 tgccctggcc caccctcgtg accaccctga cctacggcgt gcagtgcttc agccgctacc 3840 ccgaccacat gaagcagcac gacttcttca agtccgccat gcccgaaggc tacgtccagg 3900 agcgcaccat cttcttcaag gacgacggca actacaagac ccgcgccgag gtgaagttcg 3960 agggcgacac cctggtgaac cgcatcgagc tgaagggcat cgacttcaag gaggacggca 4020 acatcctggg gcacaagctg gagtacaact acaacagcca caacgtctat atcatggccg 4080 acaagcagaa gaacggcatc aaggtgaact tcaagatccg ccacaacatc gaggacggca 4140 gcgtgcagct cgccgaccac taccagcaga acacccccat cggcgacggc cccgtgctgc 4200 tgcccgacaa ccactacctg agcacccagt ccgccctgag caaagacccc aacgagaagc 4260 gcgatcacat ggtcctgctg gagttcgtga ccgccgccgg gatcactctc ggcatggacg 4320 agctgtacaa gtaagatatc cgatccaccg gatctagata actgatcata atcagccata 4380 ccacatttgt agaggtttta cttgctttaa aaaacctccc acacctcccc ctgaacctga 4440 aacataaaat gaatgcaatt gttgttgtta acttgtttat tgcagcttat aatggttaca 4500 aataaagcaa tagcatcaca aatttcacaa ataaagcatt tttttcactg cattctagtt 4560 gtggtttgtc caaactcatc aatgtatctt aacgcggtaa ccacgtgcgg accgagcggc 4620 cgcaggaacc cctagtgatg gagttggcca ctccctctct gcgcgctcgc tcgctcactg 4680 aggccgggcg accaaaggtc gcccgacgcc cgggctttgc ccgggcggcc tcagtgagcg 4740 agcgagcgcg cagctgcctg caggggcgcc tgatgcggta ttttctcctt acgcatctgt 4800 gcggtatttc acaccgcata cgtcaaagca accatagtac gcgccctgta gcggcgcatt 4860 aagcgcggcg ggtgtggtgg ttacgcgcag cgtgaccgct acacttgcca gcgccctagc 4920 gcccgctcct ttcgctttct tcccttcctt tctcgccacg ttcgccggct ttccccgtca 4980 agctctaaat cgggggctcc ctttagggtt ccgatttagt gctttacggc acctcgaccc 5040 caaaaaactt gatttgggtg atggttcacg tagtgggcca tcgccctgat agacggtttt 5100 tcgccctttg acgttggagt ccacgttctt taatagtgga ctcttgttcc aaactggaac 5160 aacactcaac cctatctcgg gctattcttt tgatttataa gggattttgc cgatttcggc 5220 ctattggtta aaaaatgagc tgatttaaca aaaatttaac gcgaatttta acaaaatatt 5280 aacgtttaca attttatggt gcactctcag tacaatctgc tctgatgccg catagttaag 5340 ccagccccga cacccgccaa cacccgctga cgcgccctga cgggcttgtc tgctcccggc 5400 atccgcttac agacaagctg tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc 5460 5520 tgtcatgata ataatggttt cttagacgtc aggtggcact tttcgggggaa atgtgcgcgg 5580 aacccctatt tgtttatttt tctaaataca ttcaaatatg tatccgctca tgagacaata 5640 accctgataa atgcttcaat aatattgaaa aaagaagagt atgagtattc aacatttccg 5700 tgtcgccctt attccctttt ttgcggcatt ttgccttcct gtttttgctc acccagaaac 5760 gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca cgagtgggtt acatcgaact 5820 ggatctcaac agcggtaaga tccttgagag ttttcgcccc gaagaacgtt ttccaatgat 5880 gagcactttt aaagttctgc tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga 5940 gcaactcggt cgccgcatac actattctca gaatgacttg gttgagtact caccagtcac 6000 agaaaagcat cttacggatg gcatgacagt aagagaatta tgcagtgctg ccataaccat 6060 gagtgataac actgcggcca acttacttct gacaacgatc ggaggaccga aggagctaac 6120 cgctttttg cacaacatgg gggatcatgt aactcgcctt gatcgttggg aaccggagct 6180 gaatgaagcc ataccaaacg acgagcgtga caccacgatg cctgtagcaa tggcaacaac 6240 gttgcgcaaa ctattaactg gcgaactact tactctagct tcccggcaac aattaataga 6300 ctggatggag gcggataaag ttgcaggacc acttctgcgc tcggcccttc cggctggctg 6360 gttattgct gataaatctg gagccggtga gcgtgggtct cgcggtatca ttgcagcact 6420 ggggccagat ggtaagccct cccgtatcgt agttatctac acgacgggga gtcaggcaac 6480 tatggatgaa cgaatagac agatcgctga gataggtgcc tcactgatta agcattggta 6540 actgtcagac caagtttact catatatact ttagattgat ttaaaacttc atttttaatt 6600 taaaaggatc taggtgaaga tccttttga taatctcatg accaaaatcc cttaacgtga 6660 gtttcgtc cactgagcgt cagaccccgt agaaaagatc aaaggatctt cttgagatcc 6720 ttttttctg cgcgtaatct gctgcttgca aaaaaaaa ccaccgctac cagcggtggt 6780 ttgtttgccg gatcaagagc taccaactct ttttccgaag gtaactggct tcagcagagc 6840 gcagatacca aatactgtcc ttctagtgta gccgtagtta ggccaccact tcaagaactc 6900 tgtagcaccg cctacatacc tcgctctgct aatcctgtta ccagtggctg ctgccagtgg 6960 cgataagtcg tgtcttaccg ggttggactc aagacgatag ttaccggata aggcgcagcg 7020 gtcgggctga acggggggtt cgtgcacaca gcccagcttg gagcgaacga cctacaccga 7080 actgagatac ctacagcgtg agctatgaga aagcgccacg cttcccgaag ggagaaaggc 7140 ggacaggtat ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg agcttccagg 7200 gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg 7260 atttttgtga tgctcgtcag gggggcggag cctatggaaa aacgccagca acgcggcctt 7320 tttacggttc ctggcctttt gctggccttt tgctcacatg t 7361 <210> 2 <211> 2133 <212> DNA <213> ELN <400> 2 atggcgggtc tgacggcggc ggccccgcgg cccggagtcc tcctgctcct gctgtccatc 60 ctccacccct ctcggcctgg aggggtccct ggggccattc ctggtggagt tcctggagga 120 gtcttttatc caggggctgg tctcggagcc cttggaggag gagcgctggg gcctggaggc 180 aaacctctta agccagttcc cggagggctt gcgggtgctg gccttggggc agggctcggc 240 gccttccccg cagttacctt tccggggct ctggtgcctg gtggagtggc tgacgctgct 300 gcagcctata aagctgctaa ggctggcgct gggcttggtg gtgtcccagg agttggtggc 360 ttaggagtgt ctgcagcccc ttctgtgcca ggtgcggtgg ttcctcagcc tggagccgga 420 gtgaagcctg ggaaagtgcc gggtgtgggg ctgccaggtg tatacccagg tggcgtgctc 480 ccaggagctc ggttccccgg tgtgggggtg ctccctggag ttcccactgg agcaggagtt 540 aagcccaagg ctccaggtgt aggtggagct tttgctggaa tcccaggagt tggacccttt 600 gggggaccgc aacctggagt cccactgggg tatcccatca aggcccccaa gctgcctggt 660 ggctatggac tgccctacac cacagggaaa ctgccctatg gctatgggcc cggaggagtg 720 gctggtgcag cgggcaaggc tggttaccca acagggacag gggttggccc ccaggcagca 780 gcagcagcgg cagctaaagc agcagcaaag ttcggtgctg gagcagccgg agtcctccct 840 ggtgttggag gggctggtgt tcctggcgtg cctggggcaa ttcctggaat tggaggcatc 900 gcaggcgttg ggactccagc tgcagctgca gctgcagcag cagccgctaa ggcagccaag 960 tatggagctg ctgcaggctt agtgcctggt gggccaggct ttggcccggg agtagttggt 1020 gtcccaggag ctggcgttcc aggtgttggt gtcccaggag ctgggattcc agttgtccca 1080 ggtgctggga tcccaggtgc tgcggttcca ggggttgtgt caccagaagc agctgctaag 1140 gcagctgcaa aggcagccaa atacggggcc aggcccggag tcggagttgg aggcattcct acttacgggg ttggagctgg gggctttccc ggctttggtg tcggagtcgg aggtatccct 1260 ggagtcgcag gtgtccctgg tgtcggaggt gttcccggag tcggaggtgt cccgggagtt 1320 ggcatttccc ccgaagctca ggcagcagct gccgccaagg ctgccaagta cggagtgggg 1380. accccagcag ctgcagctgc taaagcagcc gccaaagccg cccagtttgg gttagttcct ggtgtcggcg tggctcctgg agttggcgtg gctcctggtg tcggtgtggc tcctggagtt 1500 ggcttggctc ctggagttgg cgtggctcct ggagttggtg tggctcctgg cgttggcgtg 1560 gctcccggca ttggccctgg tggagttgca gctgcagcaa aatccgctgc caaggtggct 1620 gccaaagccc agctccgagc tgcagctggg cttggtgctg gcatccctgg acttggagtt 1680 ggtgtcggcg tccctggact tggagttggt gctggtgttc ctggacttgg agttggtgct 1740 ggtgttcctg gcttcggggc agtacctgga gccctggctg ccgctaaagc agccaaatat 1800 ggagcagcag tgcctggggt ccttggaggg ctcggggctc tcggtggagt aggcatccca 1860 ggcggtgtgg tgggagccgg acccgccgcc gccgctgccg cagccaaagc tgctgccaaa 1920 gccgcccagt ttggcctagt gggagccgct gggctcggag gactcggagt cggagggctt 1980 ggagttccag gtgttggggg ccttggaggt atacctccag ctgcagccgc taaagcagct 2040 aaatacggag tggcagcaag acctggcttc ggattgtctc ccattttccc aggtggggcc 2100 tgcctgggga aagcttgtgg ccggaagaga aaa 2133
Claims
1. The use of an agent overexpressing the ELN gene in the preparation of a drug for repairing aging choroid and / or retinal pigment epithelium, characterized in that, The reagent for overexpressing the ELN gene is a plasmid or virus containing the ELN gene, the sequence of which is shown in SEQ ID NO.2; the drug is a drug for preventing and treating age-related macular degeneration.
2. The use as described in claim 1, characterized in that, The drug is a drug that increases the expression of elastin and / or actin in the choroid and / or retinal pigment epithelium.
3. The use as described in claim 1, characterized in that, The drug is a drug that increases the density of the basal surface of the retinal pigment epithelium.
4. The use as described in claim 1, characterized in that, The drug is a drug that improves the structural morphology of aging choroid and / or retinal pigment epithelium.
5. The use as described in claim 1, characterized in that, The plasmid containing the ELN gene is a pAV-CMV-P2A-GFP plasmid containing the ELN gene, the sequence of which is shown in SEQ ID NO.
1.
6. The use as described in claim 1, characterized in that, The virus containing the ELN gene is an adeno-associated virus containing the ELN gene.
7. The use as described in claim 6, characterized in that, The adeno-associated virus mentioned is the AAV-DJ type adeno-associated virus.
8. The use as described in claim 6, characterized in that, The adeno-associated virus containing the ELN gene is an adeno-associated virus that packages a plasmid containing the ELN gene.
9. The use as described in claim 8, characterized in that, The plasmid containing the ELN gene is a pAV-CMV-P2A-GFP plasmid containing the ELN gene, the sequence of which is shown in SEQ ID NO.1.