A SNP molecular marker for identifying the genetic sex of blue dragon fish and its application

Abstract

The present invention discloses a SNP molecular marker for identifying the genetic sex of blue dragon fish and its application. It belongs to the technical field of fish sex identification. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the molecular marker includes a SNP site, and the SNP site is located at the 192nd base at the 5' end of the molecular marker. The single nucleotide polymorphism site (SNP) that is different between male and female blue dragon fish and can characterize the male and female sex is obtained by genome high-throughput sequencing comparison, and primer amplification is combined to obtain an amplified sequence containing the SNP site. On this basis, PCR amplification and sequencing of the sample to be tested are realized by primers to obtain the sample SNP site information, thereby identifying the sex of the sample to be tested. Utilizing the SNP site of the present invention, accurate and rapid sex identification can be achieved without dissecting the blue dragon fish.

Description

Technical Field

[0001] The invention relates to the technical field of fish sex identification, and more specifically to a SNP molecular marker for identifying the genetic sex of blue dragon fish and an application thereof. Background Art

[0002] The scientific name of the blue dragon fish is Scleropagesformosus, which belongs to the order Osteoglossiformes and the family Osteoglossidae. There are three natural populations of the beautiful blue dragon fish in nature, namely the golden dragon fish, the red dragon fish and the blue dragon fish. The blue dragon fish is an ancient "living fossil" fish. At the same time, as a precious ornamental fish, it has very important economic value. It is listed as an endangered species in Appendix I of the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES).

[0003] The external morphological differences between the two sexes of the beautiful bony tongue fish (Qinglong fish) are not obvious, and there are no heteromorphic sex chromosomes. There is currently no accurate sex identification method except for dissection. In other words, there is no method to accurately identify the sex without harming the fish. Therefore, it is impossible to accurately determine and identify the physiological sex and genetic sex of the living fish by relying on traditional methods, which has caused great trouble for the artificial breeding of this fish.

[0004] In summary, how to provide an identification method or molecular marker that can effectively distinguish the male and female of the beautiful bony tongue fish (Qinglong fish) is a problem that technical personnel in this field urgently need to solve. Summary of the invention

[0005] In view of this, the present invention provides a SNP molecular marker for identifying the genetic sex of Qinglong fish and its application. Through the SNP site of the present invention, a small amount of fin rays can be cut without dissection, DNA can be extracted, and PCR amplification reaction can be performed using upstream primer F and downstream primer R. After the reaction is completed, analysis can be performed to determine the sample genotype and identify the sex, without affecting the normal growth and reproduction of Qinglong fish.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] A SNP molecular marker for identifying the sex of blue dragon fish, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, the molecular marker includes a SNP site, and the SNP site is located at the 192nd base at the 5' end of the molecular marker.

[0008] ccgtcctttatttacagcgtctggtttctgtcccagaagcgcagggtgcgccacggaacgggtcccggtccatc aaaaccctacggacagtttaatgccaccagtgaagctgaaatacaaaaaggaacaaagaaggaatctggtacaggtc aaatatgtgccgtgtgggaaaggtgggtcctgagcctgga[C / T]ttcaagagctccagactagttctgatacgttaca ctatttttacactcctgaattaattgaatggaattttctctctatttaaaacatcgggaaggaatttggcatgttttccggaaatggcctgaaccattta tgataaagacattcgattcaactgcaatgaatgagttttttttttttttttttttgaggtccatgtggcgaaagcctgtgtggagacacatttccaccag atggcatcatctgaatttgaaattattatagctcactttacagactccgatgcagagatttcccggttctttatgggaatttttagtggccattcaattcacttacgtttatggcatgtacaggagtaattcctcacttgctcttaaactgtgatcttcgattcccctcgagaagaattccaagagcccagcaccgaa, SEQ ID NO.1.

[0009] Primers for identifying the above SNP molecular markers include:

[0010] Upstream primer F: CCGTCCTTTATTTACAGCGTCTG, SEQ ID NO. 2;

[0011] Downstream primer R: TTCGGTGCTGGGCTCTTGGA, SEQ ID NO.3.

[0012] A kit for identifying the genetic sex of blue dragon fish comprises the above primers.

[0013] Application of the above-mentioned SNP molecular marker, the above-mentioned primer or the above-mentioned kit in genetic sex identification of Qinglong fish.

[0014] Furthermore, when the 192nd base is heterozygous for C / T, the sample is female, and when it is homozygous for C / C, the sample is male.

[0015] A method for identifying the genetic sex of blue dragon fish comprises the following steps:

[0016] (1) extracting genomic DNA of the tested blue dragon fish;

[0017] (2) using the genomic DNA of the tested blue dragon fish as a template and using the primers described in claim 2 to perform a PCR amplification reaction;

[0018] (3) After the reaction is completed, analysis is performed to determine the sample genotype and identify the gender;

[0019] When the 192nd base in the nucleotide sequence is C / T heterozygous, the sample is female, and when it is C / C homozygous, the sample is male.

[0020] Furthermore, the reaction system of the PCR amplification reaction in step (2) is 40 μl, including 20 μl of 2*Taq MasterMix, 2 μl of upstream primer F, 2 μl of downstream primer R, 15 μl of ddH2O, and 1 μl of genomic DNA.

[0021] Furthermore, the reaction conditions of the PCR amplification reaction in step (2) are 94°C for 3 min; then 35 cycles are performed, including 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s; and then 72°C is maintained for 5 min to end.

[0022] Furthermore, the method for determining the sample genotype in step (3) is Sanger sequencing.

[0023] It can be seen from the above technical solution that, compared with the prior art, the beneficial effects achieved by the present invention are:

[0024] The present invention can realize the sex identification of Qinglong fish without dissection, and can realize batch sequencing by means of multiple sequencing methods or sequencing platforms including the present invention. On this basis, it is more conducive to application in the breeding and research of Qinglong fish, so as to quickly distinguish the sex of Qinglong fish and improve the identification and breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0026] Figure 1The attached figure is a representative diagram of Sanger sequencing in the present invention, a sequencing peak diagram of the SNP marker site (position 192), the upper figure is a female (genotype CT), and the lower figure is a male (genotype CC). DETAILED DESCRIPTION

[0027] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] The drugs required for the present invention are conventional experimental drugs, which are purchased from commercial channels; the experimental methods not mentioned are conventional experimental methods and will not be described in detail here.

[0029] Example 1

[0030] Using a high-throughput sequencing strategy, 5 female samples and 5 male fish samples were selected for DNA extraction. According to the requirements of the Illumina library construction process, a double-end genomic DNA library with an insert size of 500bp was constructed. Then the genome was sequenced with high throughput using the IlluminaNovaSeq sequencing platform, with a sequencing volume of 30Gb per sample and a sequencing strategy of Pair-End 150bp. Using a high-throughput sequencing sequence alignment strategy, the single nucleotide polymorphism sites (SNPs) of the sequenced female samples and the single nucleotide polymorphism sites (SNPs) of the male samples were detected, and the SNP sites that were completely identical between female samples, completely identical between male samples, and different between male and female samples were screened as molecular markers for sex identification.

[0031] Based on high-throughput sequencing, specific DNA molecular markers were screened for female and male samples, and it was found that their gene sequences contained SNP molecular markers that distinguish sex. On this basis, high-throughput sequencing data was combined with primers for amplification to obtain sequences containing SNP sites that can be used for PCR and Sanger sequencing to identify the sex of Qinglong fish.

[0032] Specifically, the primer sequences are as follows:

[0033] Upstream primer F: CCGTCCTTTATTTACAGCGTCTG, SEQ ID NO. 2;

[0034] Downstream primer R: TTCGGTGCTGGGCTCTTGGA, SEQ ID NO.3.

[0035] The obtained sequence containing the SNP site is shown as SEQ ID NO.1, and the SNP molecular marker is the 192nd position in SEQ ID NO.1.

[0036] ccgtcctttatttacagcgtctggtttctgtcccagaagcgcagggtgcgccacggaacgggtcccggtccatc aaaaccctacggacagtttaatgccaccagtgaagctgaaatacaaaaaggaacaaagaaggaatctggtacaggtc aaatatgtgccgtgtgggaaaggtgggtcctgagcctgga[C / T]ttcaagagctccagactagttctgatacgttaca ctatttttacactcctgaattaattgaatggaattttctctctatttaaaacatcgggaaggaatttggcatgttttccggaaatggcctgaaccattta tgataaagacattcgattcaactgcaatgaatgagttttttttttttttttttttgaggtccatgtggcgaaagcctgtgtggagacacatttccaccag atggcatcatctgaatttgaaattattatagctcactttacagactccgatgcagagatttcccggttctttatgggaatttttagtggccattcaattcacttacgtttatggcatgtacaggagtaattcctcacttgctcttaaactgtgatcttcgattcccctcgagaagaattccaagagcccagcaccgaa, SEQ ID NO.1.

[0037] In the above sequences, capital letters represent SNP sites.

[0038] In the above sequence containing SNP sites, the corresponding relationship between SNP sites and male and female is as follows:

[0039] When the 192nd base is heterozygous for C / T, the sample is female, and when it is homozygous for C / C, the sample is male.

[0040] Example 2

[0041] In order to verify the accuracy of SNP sites in identifying the sex of Qinglong fish, this example verifies the SNP molecular markers in Example 1, and verifies whether the molecular markers detected in Qinglong fish are accurate by PCR and Sanger sequencing methods.

[0042] Specifically, genomic DNA is extracted from the sample to be tested, and the specificity of the primers is verified by PCR and Sanger sequencing, and compared with the physiological sex of the Qinglong fish sample to confirm whether the SNP molecular markers and primers in Example 1 can be used for Qinglong fish sex identification.

[0043] 1. Sample preparation

[0044] Twenty samples of blue dragon fish, including 12 female samples and 8 male samples, were selected for verification.

[0045] 2. Genomic DNA Extraction

[0046] The genomic DNA of the tested Qinglong fish was extracted using a kit.

[0047] 3. PCR amplification

[0048] The genomic DNA of the tested blue dragon fish was used as a template, and a PCR amplification reaction was performed using an upstream primer F (CCGTCCTTTATTTACAGCGTCTG, SEQ ID NO. 2) and a downstream primer R (TTCGGTGCTGGGCTCTTGGA, SEQ ID NO. 3).

[0049] Reaction system: The reaction system used for PCR amplification was 40 μl, including 20 μl of 2*Taq MasterMix (Dye), 2 μl of upstream primer F, 2 μl of downstream primer R, 15 μl of ddH2O, and 1 μl of genomic DNA.

[0050] Reaction conditions: 94°C for 3 min; then 35 cycles, including 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s; then 72°C for 5 min.

[0051] 4. Combined with Sanger sequencing, the genotype of the sample was determined and the gender was identified.

[0052] When the 192nd base is heterozygous for C / T, the sample is female, and when it is homozygous for C / C, the sample is male.

[0053] The results are shown in the following table.

[0054] Table 1 Comparison of sample sequencing genotype sex determination and anatomical genotype sex determination results

[0055]

[0056]

[0057] The results showed that the sex information reflected by the SNP loci was consistent with the sex information confirmed by physiological anatomy, that is, accurate sex identification of Qinglong fish can be achieved through the above primers and SNP loci. Compared with traditional sex identification, biological anatomy is not required.

[0058] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0059] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A SNP molecular marker for identifying the genetic sex of blue dragon fish, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1. The molecular marker includes a SNP site, and the SNP site is located at the 192nd base at the 5' end of the molecular marker.

2. A primer for identifying the SNP molecular marker according to claim 1, characterized in that: include: Upstream primer F: CCGTCCTTTATTTACAGCGTCTG, SEQ ID NO. 2; Downstream primer R: TTCGGTGCTGGGCTCTTGGA, SEQ ID NO.

3.

3. A kit for identifying the genetic sex of blue dragon fish, characterized in that: Comprising the primer described in claim 2.

4. Use of the SNP molecular marker described in claim 1, the primer described in claim 2, or the kit described in claim 3 in genetic sex identification of Qinglong fish.

5. The use according to claim 4, characterized in that: When the 192nd base at the 5' end of the SNP molecular marker shown in SEQ ID NO.1 is C / T heterozygous, the sample is female, and when it is C / C homozygous, the sample is male.

6. A method for identifying the genetic sex of blue dragon fish, characterized in that: The steps include: (1) Extracting genomic DNA from the tested Qinglong fish; (2) using the genomic DNA of the tested blue dragon fish as a template and using the primers described in claim 2 to perform a PCR amplification reaction; (3) After the reaction is completed, analysis is performed to determine the sample genotype and identify the gender; When the 192nd base at the 5' end of the SNP molecular marker nucleotide sequence shown in SEQ ID NO.1 is C / T heterozygous, the sample is female, and when it is C / C homozygous, the sample is male.

7. The method according to claim 6, characterized in that The reaction system of the PCR amplification reaction in step (2) is 40 μl, including 20 μl of 2×Taq MasterMix, 2 μl of upstream primer F, 2 μl of downstream primer R, 15 μl of ddH2O, and 1 μl of genomic DNA.

8. The method according to claim 6, characterized in that The reaction conditions of the PCR amplification reaction in step (2) are 94°C for 3 min; then 35 cycles are performed, including 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s; and then 72°C is maintained for 5 min to end.

9. The method according to claim 6, characterized in that The method for determining the sample genotype in step (3) is Sanger sequencing.

Images