A method for detecting BRCA genes based on a self-enhanced electrochemiluminescence MOF biosensor.

CN117347446BActive Publication Date: 2026-06-30QINGDAO UNIV OF SCI & TECH

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
QINGDAO UNIV OF SCI & TECH
Filing Date
2023-10-13
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing electrochemiluminescence technologies lack sufficient sensitivity in BRCA gene detection and are difficult to achieve simultaneous and efficient detection of BRCA1 and BRCA2.

Method used

A self-enhanced electrochemiluminescence Cu-MOF sensor was used to construct a space potential-resolved biosensor by modifying Cu-MOF and quencher Au@AgNPs in the electrode channel and combining it with luminescent reagent CdTe/CdS QDs, thereby enabling the simultaneous detection of BRCA1 and BRCA2.

Benefits of technology

It achieves simultaneous detection of BRCA1 and BRCA2 with high sensitivity and zero background signal enhancement, thus improving detection efficiency and accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117347446B_ABST
    Figure CN117347446B_ABST
Patent Text Reader

Abstract

This invention, for the first time, utilizes a novel self-luminescent copper-based metal-organic framework (Cu-MOF) to develop a potentiometric ECL biosensor for the simultaneous detection of two BRCA genes. The self-enhanced electrochemiluminescence Cu-MOF serves as the positive-potential ECL signaling material for the a-channel, with Au@AgNPs acting as a quencher; CdTe / CdS QDs serve as the negative-potential ECL luminescent material for the b-channel. Targeted cyclic amplification of DNA is employed. The Au@Ag NPs quencher is linked to the a-channel to quench the Cu-MOF ECL signal, while the CdTe / CdS QDs are linked to the b-channel, achieving zero-background ECL signal enhancement and enabling the simultaneous detection of BRCA1 and BRCA2. This invention overcomes the limitation of traditional potentiometric ECL biosensors requiring multiple co-reactants, providing a new approach to constructing ECL biosensors and demonstrating significant application potential in environmental monitoring, food safety, and disease analysis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical fields:

[0001] This invention relates to the fabrication of a biosensor based on a self-enhanced electrochemiluminescence MOF, and the application of the electrochemiluminescence sensor in detecting the BRCA gene. Background technology:

[0002] BRCA1 and BRCA2, biomarkers for breast cancer (BRCA), are important tumor suppressor genes [Bruch, R.; Baaske, J. et, al. Adv. Mater., 2019, 31, 1905311], and abnormalities in their structure and function are closely related to the pathogenesis of breast cancer. Therefore, screening and prevention of breast cancer associated with BRCA1 and BRCA2 mutations have received widespread attention [Babamiri, B.; Hallaj, R. et, al. Microchim. Acta., 2021, 188, 181]. Electrochemiluminescence (ECL) combines the advantages of electrochemical and spectroscopic techniques, eliminating the need for external light sources and avoiding the effects of light scattering. Therefore, it exhibits high sensitivity and near-zero background signal [Zinna, F.; Voci, Set, al. Angew. Chem., Int. Ed., 2019, 58, 6952-6956], and holds promise for better application in the detection of BRCA genes. Dual-ligand MOFs can effectively reduce the electron transport distance in the network structure, avoiding the aggregation of photoluminescence. Compared with single-ligand MOFs, dual-ligand MOFs do not require exogenous co-reactants and have a stronger ECL signal. They achieve multiple functions by integrating different ligands and have been widely used in various fields [Zhu, D.; Zhang, Y. et al. J. Am. Chem. Soc., 2021, 143, 3049-3053]. Therefore, this invention constructs a space potential-resolved electrochemiluminescence biosensor based on a novel positively potentiated dual-ligand self-luminescent Cu-MOF, enabling the simultaneous detection of BRCA1 and BRCA2. Summary of the Invention:

[0003] The purpose of this invention is to provide a method for preparing a spatially and potentiometrically resolved electrochemiluminescence (ECL) sensor, and a method for detecting BRCA1 and BRCA2 using the ECL sensor. Specifically, Cu-MOF is modified into the a-channel of ITO, and glutaraldehyde is used to modify the b-channel. Then, the generated DNA is amplified using a target cycle. Au@AgNPs are linked to the a-channel to quench the ECL signal of Cu-MOF, while CdTe / CdS QDs are linked to the b-channel to enhance the ECL signal with zero background, thus enabling the simultaneous detection of BRCA1 and BRCA2.

[0004] One of the objectives of this invention is the preparation of self-enhanced electrochemiluminescence Cu-MOF.

[0005] Specifically, the following steps are included:

[0006] Preparation of Cu-MOF: 11.59 mg Cu(NO3)2·5H2O, 20 mg DPA and 2.7 mg D-H2 were suspended in 2.5 mL DMF; the mixture was transferred to an autoclave and heated at 120 °C for 48 hours; washed three times with DMF and dried under vacuum at 60 °C.

[0007] The second objective of this invention is to construct a Cu-MOF-based space potential-resolved electrochemiluminescence biosensor for the simultaneous detection of targets BRCA1 and BRCA2.

[0008] Specifically, the following steps are included:

[0009] Step 1. Preparation of Au@Ag NPs: Add 50 mL of deionized water and 1 mL of 1 wt% HAuCl4 to a flask and boil; quickly add 4 mL of 1 wt% sodium citrate and stir until wine red to obtain AuNPs; then mix 1.5 mL of Au NPs, 10.8 mL of ultrapure water, 0.45 mL of 24 mM Tollens' reagent, and 0.72 mL of 10 mM HCHO solution, stir at room temperature for 15 min to obtain Au@AgNPs, and store at 4 °C for later use;

[0010] Step 2. Target scale-up: 20 μL of 5 μM H1, 8 U ExoⅢ and 20 μL of BRCA1 solutions of different concentrations were added to 40 μL Tris-HCl and incubated at 37℃ for 90 min and 80℃ for 10 min to prepare S1; similarly, product chain S2 was prepared.

[0011] Step 3. Probe preparation: Add 10 μL of 10 μM H4 to 90 μL of Au@Ag NPs and stir overnight to obtain Au@Ag NPs-H4 probe; activate the carboxyl groups of CdTe / CdS quantum dots with 0.1 M EDC and 0.025 M NHS, add 10 μL of 10 μM H4 to 90 μL of activated CdTe / CdS QDs, react at 37 °C for 6 h, centrifuge and wash several times, and disperse in an equal volume of PBS;

[0012] Step 4. ECL sensor preparation and detection: Prepare 20 μL of 2 mg / mL sensor. -1Cu-MOF and 1% GLD were added to channels a and b of the electrode, respectively, and allowed to air dry. 20 μL of 5 μM H3 was added, and the mixture was incubated at 37 °C for 2 h, followed by 15 μL of 1 mM 6-mercaptohexanol and incubation for 40 min. 20 μL of S1 was added to channel a, and 20 μL of S2 was added to channel b, and the mixture was incubated at 37 °C for 2 h. Finally, 20 μL of H4-Au@Ag NPs and H4-CdTe / CdS QDs were added to channels a and b, respectively, and the mixture was incubated for 2 h. The prepared electrode was used to detect the ECL signal under the following conditions:

[0013] The ECL detection solution was 0.1M, pH=7.4 PBS containing 50mM potassium persulfate; a three-electrode system was used: a platinum wire electrode as the counter electrode, an Ag / AgCl electrode as the reference electrode, and an ITO electrode as the working electrode; the ECL signal was recorded from -1.4V to 1.5V, and the photomultiplier tube was -750V.

[0014] The DNA used in the experiment was synthesized by Sangon Biotech Shanghai Co., Ltd. The sequence, from left to right (5'-3'), is as follows: BRCA1: GAG CATACATAG GGT TTC TCT TGGTTT CTT TGATTATAATTCATAC

[0015] 1-base: GAG CATACATAGAGTTTC TCT TGGTTT CTT TGATTATAATTCATAC

[0016] 3-base: GAGTATACATAGAGT TTC TCTTGGTGT CTT TGATTATAATTCATAC BRCA2: GGTACGACACGATTT TTAGGGACTTCATCGACATCTACT CTGAC

[0017] 1-base: GGTACGACACGATTG TTAGGGACT TCATCGACATCTACT CTGAC

[0018] 3-base: GGTACCACACGATTGTTAGGGACT TAATCGACATCTACT CTGAC H1: CAG TCGGCATAG GAATGG TTG GAATAG TGC TGC CGACTGAAGAAACCAAGAGAAACC CTATGTATG CTC H2: CAG TCG GCATAG GAATGG TTG GAATAG TGC TGC CGACTG CGATGAAGT CCC TAAAAA TCG TGTCGTACC H3: NH2-(CH2)6-TTT T GCACTATTC CAACCATTC CTATGC CGACTG TGGTTG GAATAGTGCH4: NH2-(CH2)6-TTT T GCACTATTC CAACCACAGTCG GCATAGGAATGGTTG GAA Attached image description:

[0019] Figure 1 A schematic diagram of a Cu-MOF-based space-potential resolved ECL biosensor for the simultaneous detection of BRCA1 and BRCA2. Figure 2 (A) SEM image of Cu-MOF; (B) SEM-EDX elemental map: C, Cu, O, N; (C) FT-IR spectrum; (D) ECL and FL emission spectra; (E) XPS spectrum.

[0020] Figure 3 (A) TEM image of Au@Ag NPs, (B) TEM image of CdTe / CdS (inset: particle size distribution), (C) EDS energy spectrum of CdTe / CdS, (D) ECL emission and FL emission spectra of CdTe / CdS.

[0021] Figure 4 (A) ECL signal values ​​of the biosensor at different BRCA1 and BRCA2 concentrations, (B) ΔECL versus the logarithm of BRCA1 concentration (10) -15 -10 -9 The linear relationship between M) and (C)ΔECL and the logarithm of BRCA2 concentration (10) -15 -10 -9 The linear relationship between M and M. Figure 5 (A) Detecting the ECL sensor selectivity of BRCA1, (B) Detecting the ECL sensor selectivity of BRCA2, (C) Sensor stability, (D) Sensor repeatability. Detailed implementation method:

[0022] Example 1. A Cu-MOF-based space-potential resolved ECL biosensor for simultaneous detection of BRCA1 and BRCA2.

[0023] 20 μL 2 mg·mL -1 Cu-MOF and 1% GLD were added to channels a and b of the electrode, respectively, and allowed to air dry. 20 μL of H3 (5 μM) was added, and the electrode was incubated at 37°C for at least 2 hours, followed by incubation with 15 μL of MCH (1 mM) for 40 minutes. 20 μL of S1 was added to channel a, and 20 μL of S2 was added to channel b, and the electrode was incubated at 37°C for 2 hours. Finally, 20 μL of H4-Au@Ag NPs and H4-CdTe / CdS QDs were added to channels a and b, respectively, and the electrodes were incubated for at least 2 hours. After these steps, the electrode was stored as an ECL sensor. The ECL detection solution was PBS (0.1 M, pH 7.4) containing 50 mM potassium persulfate. A three-electrode system was used: a platinum wire electrode as the counter electrode, an Ag / AgCl electrode as the reference electrode, and an ITO electrode as the working electrode. The ECL signal was recorded from -1.4 V to 1.5 V, and the photomultiplier tube was at -750 V.

[0024] Example 2. A Cu-MOF-based space-potential resolved ECL biosensor for ultrasensitive simultaneous detection of BRCA1 and BRCA2.

[0025] The preparation conditions were the same as in Example 1, but with "20 μL H3 (5 μM), incubation at 37°C for at least 2 h" changed to "20 μL H3 (5 μM), incubation at 37°C for at least 2.5 h". The resulting biosensor had morphology and properties similar to those in Example 1. The detection results for BRCA1 and BRCA2 were the same as in Example 1.

[0026] Example 3. A Cu-MOF-based space-potential resolved ECL biosensor for ultrasensitive simultaneous detection of BRCA1 and BRCA2.

[0027] The process of adding 20 μL of S1 generated by cyclic amplification of BRCA1 to channel a and 20 μL of S2 generated by BRCA2 to channel b, and incubating at 37°C for 2 hours, was changed to adding 20 μL of S1 generated by cyclic amplification of BRCA1 to channel a and 20 μL of S2 generated by BRCA2 to channel b, and incubating at 37°C for 3 hours. Other preparation conditions remained the same as in Example 1, resulting in a biosensing platform with morphology and properties similar to that of Example 1. The detection results for BRCA1 and BRCA2 were the same as in Example 1.

[0028] Example 4. A Cu-MOF-based space-potential resolved ECL biosensor for ultrasensitive simultaneous detection of BRCA1 and BRCA2.

[0029] The procedure was modified by changing "Adding 20 μL of H4-Au@Ag NPs and H4-CdTe / CdS QDs to channels a and b respectively, and incubating for at least 2 hours" to "Adding 20 μL of H4-Au@Ag NPs and H4-CdTe / CdS QDs to channels a and b respectively, and incubating for at least 1 hour." Other preparation conditions remained the same as in Example 1, resulting in a biosensor with morphology and properties similar to that of Example 1. The detection results for BRCA1 and BRCA2 were the same as in Example 1.

Claims

1. A method for detecting BRCA genes for non-diagnostic and therapeutic purposes using a biosensor based on self-enhanced electrochemiluminescence MOF, characterized by: Two probes were introduced using the target product: Au@Ag NPs quenched the positive potential ECL signal of Cu-MOF, and CdTe / CdS QDs generated a negative potential ECL signal. A potential-resolved ECL sensor was constructed, and BRCA1 and BRCA2 were simultaneously detected and analyzed based on the changes in the dual potential ECL signals. The specific steps are as follows: Step 1. Preparation of Cu-MOF: 11.59 mg Cu(NO3)2·5H2O, 20 mg DPA and 2.7 mg D-H2 were suspended in 2.5 mL DMF; the mixture was transferred to an autoclave and heated at 120 °C for 48 hours; washed three times with DMF and dried under vacuum at 60 °C; Step 2. Preparation of Au@Ag NPs: Add 50 mL of deionized water and 1 mL of 1 wt% HAuCl4 to a flask and boil; quickly add 4 mL of 1 wt% sodium citrate and stir until wine red to obtain Au NPs; then mix 1.5 mL of Au NPs, 10.8 mL of ultrapure water, 0.45 mL of 24 mM Tollens' reagent, and 0.72 mL of 10 mM HCHO solution, stir at room temperature for 15 min to obtain Au@Ag NPs, and store at 4 ℃ for later use; Step 3. Target Scale-up: 20 μL of 5 μM H1, 8 U ExoⅢ, and 20 μL of BRCA1 solutions of different concentrations were added to 40 μL Tris-HCl and incubated at 37 °C for 90 min, followed by incubation at 80 °C for 10 min to prepare S1; similarly, 20 μL of 5 μM H2, 8 U ExoⅢ, and 20 μL of BRCA2 solutions of different concentrations were added to 40 μL Tris-HCl and incubated at 37 °C for 90 min, followed by incubation at 80 °C for 10 min to prepare S2; Step 4. Probe preparation: Add 10 μL of 10 μM H4 to 90 μL of Au@Ag NPs and stir overnight to obtain Au@AgNPs-H4 probe; activate the carboxyl groups of CdTe / CdS quantum dots with 0.1 M EDC and 0.025 M NHS, add 10 μL of 10 μM H4 to 90 μL of activated CdTe / CdS QDs, react at 37 ℃ for 6 h, centrifuge and wash several times, and disperse in an equal volume of PBS; Step 5. ECL sensor preparation and detection: 20 μL of 2 mg·mL⁻¹ ECL sensor was prepared. -1 Cu-MOF and 1% GLD were added to channels a and b of the electrode, respectively, and allowed to air dry. 20 μL of 5 μM H3 was added, and the mixture was incubated at 37 °C for 2 h. Then, 15 μL of 1 mM 6-mercaptohexanol was added and the mixture was incubated for 40 min. 20 μL of S1 was added to channel a, and 20 μL of S2 was added to channel b. The mixture was incubated at 37 °C for 2 h. Finally, 20 μL of H4-Au@Ag NPs and H4-CdTe / CdS QDs were added to channels a and b, respectively, and the mixture was incubated for 2 h. The prepared electrode was used to detect ECL signals under the following conditions. The ECL detection solution was 0.1 M, pH=7.4, and the PBS contained 50 mM potassium persulfate. A three-electrode system was used: a platinum wire electrode as the counter electrode, an Ag / AgCl electrode as the reference electrode, and an ITO electrode as the working electrode. The ECL signal was recorded from -1.4 V to 1.5 V, and the photomultiplier tube was set to -750 V.