A mutant strain ΔarnA and a double mutant strain ΔugdΔarnA of Aeromonas dakar, and a construction method and application thereof

Abstract

The present invention discloses a mutant strain ΔarnA and a double mutant strain ΔugdΔarnA of Aeromonas dhaka, and a construction method and application thereof. The mutant strain of Aeromonas dhaka is obtained by deleting the arnA gene or the ugd gene and the double gene of the arnA gene on the basis of the wild strain of Aeromonas dhaka. The experimental results show that the resistance of the deletion strain of Aeromonas dhaka to polymyxin is weakened, the toxicity to zebrafish is weakened, and the immune protection with the deletion strain can improve the survival rate of zebrafish in the challenge test. Therefore, the proposal of the present invention helps to enhance the understanding of the pathogenic mechanism and drug resistance mechanism of Aeromonas dhaka, provide a reference for the selection of target genes in immune prevention and control, and can also provide effective technical means for promoting the healthy development of the crocodile breeding industry and protecting the property of crocodile breeders.

Description

Technical Field

[0001] The present invention relates to a mutant strain of Aeromonas dakar, a construction method and application thereof, and in particular to a mutant strain ΔarnA and a double mutant strain ΔugdΔarnA of Aeromonas dakar, a construction method and application thereof. The present invention belongs to the field of biotechnology. Background Art

[0002] Crocodile (Crocodile) belongs to the order Crocodilian of the class Chordata and is a carnivorous oviparous animal. Crocodile is an animal with extremely high economic value. Crocodile skin is a high-quality leather material with high price. It is often used in the processing and production of leather bags, leather shoes, etc. (Lin et al., 2019). Crocodile meat is edible, with high protein content, rich in unsaturated fatty acids and trace elements, and has extremely high nutritional value (Ferreira et al., 2020; Pozio et al., 2004). With the development of modern science and technology, the medicinal value of crocodiles has been further developed, and the secret of how crocodiles can survive for a long time on the ever-changing earth without being eliminated by natural selection is also being gradually revealed by scientific researchers (Chui et al., 2006; Siddiqui et al., 2021). Scientists have discovered a variety of antimicrobial peptides with bactericidal and anti-inflammatory effects in the blood and leukocytes of crocodiles. Crude extracts of crocodile organs also contain active ingredients that affect the viability of prostate cancer cells (PC-3). In addition, the cytoplasmic and microsomal parts of crocodile livers play a role in the detoxification of xenobiotics (Thiendedsakul et al., 2022).

[0003] The Siamese crocodile (Crocodylus siamensis), also known as the Thai crocodile, is native to Southeast Asia. It is a medium-sized crocodile that lives in freshwater environments in tropical and subtropical regions and is considered to be a critically endangered species (Kommanee et al., 2012). The Siamese crocodile has the advantages of strong reproductive capacity, easy breeding, and high leather quality (Han Yu et al., 2021). Studies have shown that Siamese crocodile plasma can show antibacterial activity against a variety of human pathogens (Zeng Jifeng et al., 2018).

[0004] Due to the presence of multiple antibacterial substances in their bodies, cases of adult crocodiles dying from bacterial infections are relatively rare, but cases of juvenile crocodiles suffering from bacterial infections are relatively common. Chen et al. reported a case of death of semi-adult crocodiles caused by Aeromonas infection (Chen et al., 2023).

[0005] Aeromonas dhakensis is a highly toxic pathogen that is prevalent in tropical and subtropical regions and is extremely harmful to aquatic animals. In the aquaculture industry, antibiotics are often used to prevent and treat bacterial infections, but with the emergence of drug-resistant bacteria, even polymyxin, which is regarded as the "last line of defense", has gradually lost its effectiveness.

[0006] At present, some achievements have been made in the study of the mechanism of Gram-negative bacteria's resistance to cationic antimicrobial peptides caused by the positive charge modification of lipid A, such as the derivation of the biosynthetic pathway of lipid A-Ara4N, the revelation of the protein structure characteristics and functions of some key enzymes in the pathway, and the development of new selective inhibitor drugs. However, most of the related studies are based on negative bacteria such as Escherichia coli and Salmonella, and the research conducted in Aeromonas is still relatively lacking. The mechanism of Aeromonas dhaka's resistance to CAMPs has yet to be studied and confirmed.

[0007] Therefore, the present invention knocks out the arnA gene of Aeromonas daka to construct a knockout strain ΔarnA, and on the basis of constructing a successful deletion mutant strain Δugd, further knocks out the arnA gene to construct a double knockout strain ΔugdΔarnA, and complements the arnA gene to obtain a complemented strain ΔarnA+CarnA of the deletion strain ΔarnA and a single complemented strain ΔugdΔarnA+CarnA of the double deletion strain ΔugdΔarnA, and studies the effects of the deletion of genes arnA and ugd on the biological characteristics of the biosynthesis pathway of lipid A-Ara4N of Aeromonas daka and the bacterial virulence through relevant phenotypic experiments and virulence analysis, and provides technical means for screening immune prevention and control target genes of Aeromonas daka. Summary of the invention

[0008] The object of the present invention is to provide an Aeromonas cardiogenicum mutant strain ΔarnA and a double mutant strain ΔugdΔarnA and a construction method and application thereof.

[0009] In order to achieve the above object, the present invention adopts the following technical means:

[0010] The present invention uses the principle of homologous recombination to construct a deletion mutant strain ΔarnA and a complemented strain ΔarnA+CarnA with stable genetic ability on the basis of strain A.dhakensis C160501; and also constructs a double deletion mutant strain ΔugdΔarnA and a single complemented strain ΔugdΔarnA+CarnA on the basis of the successfully constructed deletion mutant strain Δugd. Subsequently, the phenotypic characteristics and virulence of the constructed deletion mutant strain and the complemented strain were tested, and analyzed and compared with the wild strain. The experimental results show that the deletion strain is more sensitive to the cationic antimicrobial peptide drug polymyxin. In terms of bacterial virulence, the median lethal dose of the deletion strain ΔarnA to zebrafish is increased by 2.03 times, and the LD50 of the double deletion strain ΔugdΔarnA is increased by 7.13 times. In the immune protection experiment, the zebrafish inoculated with the deletion strain ΔarnA and the double deletion strain ΔugdΔarnA for immunization had survival rates of 65% and 40% respectively after being challenged with the wild strain, which was higher than the 5% survival rate of the PBS control group.

[0011] Based on the above research, the present invention proposes a mutant strain of Aeromonas dakar, which is a single deletion mutant strain ΔarnA or a double deletion mutant strain ΔugdΔarnA of Aeromonas dakar obtained by deleting the arnA gene or the ugd and arnA double genes on the basis of the wild strain of Aeromonas dakar.

[0012] Among them, preferably, the wild strain of Aeromonas dhakensis is A. dhakensis C160501.

[0013] Furthermore, the present invention also proposes a method for constructing the Aeromonas cardiogensis mutant, comprising the following steps:

[0014] (1) Extraction of Aeromonas dakar genome

[0015] The genome was extracted using a bacterial genome extraction kit;

[0016] (2) Amplification of upstream and downstream homology arms of the target gene

[0017] The extracted genome of Aeromonas dakar was used as a template, and the specific amplification primers arnA-UF / R and arnA-DF / R of the upstream and downstream homologous arms of the arnA gene were used to amplify the upstream and downstream homologous arms of the arnA gene, respectively. The overlap fragments used for subsequent homologous arm fusion and seamless cloning were designed in the primers arnA-UF / R and arnA-DF / R, which can be added to the appropriate positions at both ends of the homologous arms through PCR amplification;

[0018] arnA-UF: TGCCCGGCATCCAACCTACGGTCAGCATGCC

[0019] arnA-UR: ATCCGCAGACCTACCTGTTGAGCTTCCT

[0020] arnA-DF:GGTAGGTCTGCGGATCGACG

[0021] arnA-DR:GTAATTTTTTTAAGGCCCGAGCAGGGCATC

[0022] (3) Recovery of PCR products

[0023] According to the instructions provided by the manufacturer, the PCR product was recovered and purified using the gel recovery method.

[0024] (4) Homologous arm fusion

[0025] The purified upstream and downstream homology arm fragments of arnA gene were fused, and the homology arm fusion fragment was named UDarnA;

[0026] (5) The extracted plasmid pRE112 was linearized, and the homology arm fusion fragment UDarnA was connected to the linearized vector pRE112 using a seamless cloning kit to construct the recombinant plasmid pRE112-UDarnA;

[0027] (6) Construction of the ΔarnA deletion mutant of Aeromonas dakar

[0028] The obtained Escherichia coli WM3064 containing the recombinant plasmid pRE112-UDarnA was co-cultured with the wild-type strain of Aeromonas dakar, and during this period, the conjugation transfer occurred, transferring the recombinant plasmid from the Escherichia coli cells to the Aeromonas dakar cells;

[0029] (7) In the Dhaka Aeromonas cells containing the recombinant plasmid, the UDarnA fragment on the plasmid will undergo homologous recombination with the upstream and downstream homologous arms of the arnA gene on the genome, thereby knocking out the arnA gene from the wild-type strain. Then, by utilizing the characteristics of the suicide plasmid containing the SacB gene, screening was performed on a plate supplemented with sucrose to obtain the deletion mutant strain ΔarnA of Dhaka Aeromonas.

[0030] (8) Using the obtained Escherichia coli WM3064 containing the recombinant plasmid pRE112-UDarnA as the donor bacterium and the Aeromonas dakar Δugd deletion strain as the recipient bacterium, the double deletion strain ΔugdΔarnA was constructed according to the methods of steps (6) and (7).

[0031] Wherein, preferably, the Aeromonas dakar Δugd deletion strain is constructed by the following method:

[0032] (1) Extraction of Aeromonas dakar genome

[0033] The genome was extracted using a bacterial genome extraction kit;

[0034] (2) Amplification of upstream and downstream homology arms of the target gene

[0035] The extracted genome of Aeromonas dakar was used as a template, and the specific amplification primers Up-F / R and Down-F / R of the upstream and downstream homologous arms of the ugd gene were used to amplify the upstream and downstream homologous arms of the ugd gene, respectively;

[0036] Up-F: ACGAATTCGAGCATCCGCACCTTGTCT

[0037] Up-R: GCAGTTGCCGTAGATGATGTTGCGTTGCAGCAGG

[0038] Down-F:ATCTACGGCAACTGCGACA

[0039] Down-R:ACAAGCTTCCACTCTCTCACCTCATCGG

[0040] (3) Recovery of PCR products

[0041] The PCR product was recovered and purified by gel recovery method;

[0042] (4) Homologous arm fusion

[0043] After completing the PCR amplification of the upstream and downstream homologous arms of the ugd gene and the purification and recovery of the products, the fusion PCR method is used to make the upstream and downstream homologous arms perform base complementary pairing through the common 15bp sequence and then amplify the fusion fragment;

[0044] (5) Using restriction endonucleases EcoR I and HindIII, the upstream and downstream homology arm fusion fragment gel recovery products were double-digested with the pK18mobsacB plasmid, and then after gel recovery, the double-digested plasmid and the fusion fragment purification and recovery products were connected using T4 DNA ligase, and the connection products were transformed into Δasd Escherichia coli competent cells, and Escherichia coli containing the recombinant plasmid Δugd-pK18mobsacB were screened;

[0045] (6) Construction of the ΔarnA deletion mutant of Aeromonas dakar

[0046] The obtained Δasd Escherichia coli containing the recombinant plasmid Δugd-pK18mobsacB was co-cultured with the wild-type strain of Aeromonas dakar, and during this period, the conjugation transfer occurred, transferring the recombinant plasmid from the Escherichia coli cells to the Aeromonas dakar cells;

[0047] In the Aeromonas dakar cells containing the recombinant plasmid, the Δugd fragment on the plasmid will undergo homologous recombination with the upstream and downstream homologous arms of the ugd gene on the genome, thereby knocking out the ugd gene from the wild strain. Colony PCR is performed using primers designed with the gene sequences outside the upstream and downstream homologous arms of the ugd gene to screen positive clones, thereby obtaining the Aeromonas dakar Δugd deletion strain.

[0048] Furthermore, the present invention also proposes the use of the Aeromonas dakar mutant in the preparation of a drug for treating or preventing a disease caused by Aeromonas dakar infection.

[0049] Compared with the prior art, the present invention has the following beneficial effects:

[0050] The present invention constructs the deletion mutants ΔarnA and ΔugdΔarnA of A.dhakensis C160501, and complements the arnA gene to obtain complemented strains ΔarnA+CarnA and ΔugdΔarnA+CarnA, and explores the differences in biological characteristics between them and wild strains. The experimental results show that the dhaka Aeromonas deletion strain has weakened resistance to polymyxin, weakened toxicity to zebrafish, and immune protection with the deletion strain can improve the survival rate of zebrafish in the attack test. Therefore, the proposal of the present invention helps to enhance the understanding of the pathogenic mechanism and drug resistance mechanism of dhaka Aeromonas, provides a reference for the selection of target genes in immune prevention and control, and can also provide effective technical means for promoting the healthy development of the crocodile breeding industry and protecting the property of crocodile breeders. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 Amplification (A) and fusion (B) of upstream and downstream homology arms;

[0052] Note: (A) M: Marker; 1: upstream homology arm; 2: downstream homology arm; (B) M: Marker; 1: fusion homology arm;

[0053] Figure 2 The homology arm fusion fragment was ligated into the plasmid;

[0054] Note: M: Marker; 1: UDarnA fragment;

[0055] Figure 3 The recombinant plasmid was transformed into Aeromonas dhaka;

[0056] Note: M: Marker; 1: UDarnA fragment on the recombinant plasmid;

[0057] Figure 4 Verification of the ΔarnA deletion strain of Aeromonas dhaka;

[0058] Note: M: Marker; 1&2: Colony PCR products; 3&4: Wild strain PCR products;

[0059] Figure 5 Genetic stability test of ΔarnA deletion strain;

[0060] Note: M: Marker; 1: arnA gene deletion; 2: arnA gene outer fragment;

[0061] Figure 6 Aeromonas dhaka colony PCR

[0062] M: molecular weight 2000bp marker; 1-2: colony PCR products;

[0063] Figure 7 Verification of ugd gene knockout strain

[0064] M: molecular weight 5000bp marker; 1: wild-type strain PCR product; 2: knockout strain PCR product;

[0065] Figure 8 arnA gene amplification;

[0066] Note: M: Marker; 1: arnA gene complementation fragment;

[0067] Fig. 9 Plasmid pBBR1MCS-2;

[0068] Note: M: Marker; 1: plasmid pBBR1MCS-2; 2: plasmid after double enzyme digestion;

[0069] Fig.10 Verification of the recombinant expression plasmid pBBR-arnA;

[0070] Note: M: Marker; 1: a sequence containing arnA gene on the plasmid;

[0071] Fig.11 Screening of complemented strain ΔarnA+CarnA;

[0072] Note: M: Marker; 1: arnA gene;

[0073] Fig.12 Genetic stability test of complemented strain ΔarnA+CarnA;

[0074] Note: M: Marker; 1: arnA gene;

[0075] Fig.13 Verification of the double deletion strain ΔugdΔarnA of Aeromonas dhaka;

[0076] Note: M: Marker; 1-4: Colony PCR products; 5-8: Wild strain PCR products;

[0077] Fig.14 Genetic stability test of the double deletion strain ΔugdΔarnA;

[0078] Note: M: Marker; 1: arnA gene deletion; 2: arnA gene outer fragment; 3: ugd gene deletion; 4: ugd gene outer fragment;

[0079] Fig.15 Screening of the single complemented strain ΔugdΔarnA+CarnA;

[0080] Note: M: Marker; 1: arnA gene;

[0081] Fig.16 Genetic stability test of single complemented strain ΔugdΔarnA+CarnA;

[0082] Note: M: Marker; 1, 2 & 3: PCR products of single complemented strain ΔugdΔarnA+CarnA; 4, 5 & 6: PCR products of wild strain;

[0083] Fig.17 Growth curves of each strain;

[0084] Fig.18 Polymyxin B susceptibility test results;

[0085] Fig.19 Comparison of the diameters of the inhibition zones of polymyxin B against various strains;

[0086] Fig. 20 Results of environmental stress tests for each strain;

[0087] Fig.21 Zebrafish challenged with virus (top) and control zebrafish (bottom);

[0088] Note: abdominal cavity is swollen and congested (arrow);

[0089] Fig. 22 The median lethal dose of Aeromonas dhaka to zebrafish;

[0090] Fig.23 Zebrafish survival curves in the immune protection assay. DETAILED DESCRIPTION

[0091] The present invention is further described below in conjunction with specific embodiments, but the embodiments are only used to illustrate the present invention and do not constitute any limitation to the protection scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention can be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the protection scope of the present invention.

[0092] Example 1 Construction of Aeromonas dakar single deletion mutant ΔarnA or double deletion mutant ΔugdΔarnA

[0093] 1 Experimental Materials

[0094] 1.1 Strains

[0095] The wild strain of A.Dhakensis C160501 was isolated from farmed Siamese crocodiles in Hainan Province, as recorded in the literature (Pu, W., G.Guo, N.Yang, Q.Li, F.Yin, P.Wang, J.Zheng, and J.Zeng. "Three Species of Aeromonas (A.Dhakensis, A.Hydrophila and A.Jandaei)Isolated from Freshwater Crocodiles (Crocodylus Siamensis) with Pneumonia and Septicemia." Lett Appl Microbiol 68, no.3(2019):212-18.) and isolated and preserved in this laboratory.

[0096] 1.2 Experimental animals

[0097] The zebrafish used in this study were purchased from an aquarium in Haikou. The zebrafish are silver in color, about 2.9±0.17cm in length, and weigh about 0.25±0.05g. The zebrafish were kept in an aquarium at room temperature. The aquarium kept the water flowing and clean, and supplied oxygen and feed through a device. The zebrafish were acclimated for at least two weeks to ensure that they were healthy and disease-free before the relevant experiments were carried out.

[0098] 2 Experimental methods

[0099] 2.1 Activation, cultivation and preservation of strains

[0100] The wild strain of Aeromonas dakar C160501, mutant strain Δugd, Escherichia coli WM3064, and plasmids pRE112 and pBBR1MCS-2 in this laboratory are all stored in an ultra-low temperature refrigerator at -80°C. When in use, take the bacterial tube out of the ultra-low temperature refrigerator, place it on ice to melt, and use a clean and sterile inoculation loop to streak and separate on the LB solid medium under suitable conditions in the ultra-clean workbench, and culture it in an incubator overnight. After several subcultures, the bacteria are revitalized, and the bacteria are identified by resistance screening, housekeeping gene sequencing, etc. After confirming that the strain or plasmid is correct, pick a single colony and inoculate it into 5mL of liquid LB medium, and use it after constant temperature culture at 180rpm in a shaker overnight.

[0101] For strains that need to be preserved, after culturing in liquid culture medium, take an appropriate amount of bacterial liquid and mix it with an equal amount of sterilized 30% propylene glycol solution in an ultra-clean workbench, then divide it into 2 mL plastic cryopreservation tubes, mark them, and place them in a -80℃ ultra-low temperature refrigerator for proper storage.

[0102] 2.2 Experimental Primers

[0103] Primers were designed on Snapgene software based on the results of whole genome sequencing of Aeromonas dakar C160501 and verified by Primer-BLAST on the NCBI website. Primers were synthesized by the Primer Synthesis Department of Qingke Biological in Haikou. The primers used in this study are shown in Table 1.

[0104] Table 1 Primers used in this experiment

[0105]

[0106]

[0107] 1) The restriction sites of Xba I and Hind III-HF are underlined.

[0108] 2.3 Construction of deletion and complementation strains

[0109] 2.3.1 Construction of the ΔarnA deletion mutant of Aeromonas dakar

[0110] 2.3.1.1 Extraction of the Aeromonas dakar genome

[0111] The wild strain of Aeromonas dakar C160501 was taken out from the -80℃ ultra-low temperature freezer, inoculated on LB medium with an ampicillin (Ampicillin, Amp) content of 50μg / mL (the amount of ampicillin used in this study was this concentration) for activation, and cultured overnight in a 30℃ constant temperature incubator. Pick a single colony and streak it on an LB solid plate, and subculture it three times to restore the activity of the bacteria. Pick a single colony of Aeromonas dakar C160501 after activation in a fresh LB liquid medium, expand it in a 30℃ shaker at 180rpm overnight for the extraction of the bacterial genome. Use a bacterial genome extraction kit to extract the genome, and refer to the instructions provided by the manufacturer.

[0112] 2.3.1.2 Amplification of upstream and downstream homology arms of the arnA target gene

[0113] The genome of Aeromonas dakar C160501 was used as a template, and the specific amplification primers arnA-UF / R and arnA-DF / R of the upstream and downstream homologous arms of the arnA gene were used to amplify the upstream and downstream homologous arms of the arnA gene, respectively. The overlap fragments used for subsequent homologous arm fusion and seamless cloning were designed in the primers arnA-UF / R and arnA-DF / R, which can be added to the appropriate positions at both ends of the homologous arms through PCR amplification.

[0114] 2.3.1.3 Recovery of PCR products

[0115] According to the instructions provided by the manufacturer, the PCR product was recovered and purified using the gel recovery method.

[0116] 2.3.1.4 Homology arm fusion

[0117] The purified upstream and downstream homology arm fragments of the arnA gene were fused.

[0118] In step 2.3.2, the overlap required for homology arm fusion has been added to the 3' end of the upstream homology arm and the 5' end of the downstream homology arm through PCR amplification. The upstream and downstream homology arms can be fused by overlapping extension PCR. After the overlapping extension PCR is completed, 1 μL of primers arnA-UF and arnA-DR are added to the reaction product, and 2 μL of 2×RapidTaqMasterMix is ​​added to amplify the resulting fusion fragment. The homology arm fusion fragment is named UDarnA.

[0119] 2.3.1.5 Linearization of plasmid pRE112

[0120] The extracted plasmid pRE112 was linearized for subsequent seamless cloning.

[0121] 2.3.1.6 Construction of recombinant plasmid pRE112-UDarnA

[0122] Using a seamless cloning kit and referring to the instructions provided by the manufacturer, the insert fragment UDarnA was ligated into the linearized vector pRE112 to construct the recombinant plasmid pRE112-UDarnA.

[0123] 2.3.1.7 Screening and verification of recombinant plasmid pRE112-UDarnA

[0124] The plasmid pRE112-UDarnA was PCR amplified using primers arnA-UF and arnA-DR, and an appropriate amount of PCR product was taken for agarose electrophoresis. After the target band was observed in the product, the remaining PCR product was sent to Hainan Nanshan Biotechnology Company for sequencing, and the sequencing results were compared and verified on the NCBI website; after sequencing verification, the culture medium of the strain whose amplification product matched the UDarnA sequence was mixed with an equal volume of 30% glycerol solution, divided into bacterial storage tubes, and stored in an ultra-low temperature refrigerator.

[0125] 2.3.1.8 Construction of the ΔarnA deletion mutant of Aeromonas dakar

[0126] The obtained Escherichia coli WM3064 containing the recombinant plasmid pRE112-UDarnA was co-cultured with the wild strain of Aeromonas dakarense C160501. During this period, the conjugation transfer occurred, and the recombinant plasmid was transferred from the Escherichia coli cells to the Aeromonas dakarense cells. The specific steps are as follows:

[0127] (1) The donor bacteria (Escherichia coli WM3064 containing the recombinant plasmid pRE112-UDarnA) were streaked on LB solid medium containing Cm and DAP, and the recipient bacteria (Aeromonas dakar C160501 wild strain) were streaked on LB solid medium containing Amp;

[0128] (2) Pick single colonies of donor bacteria and recipient bacteria on the plate, inoculate them into LB liquid culture medium supplemented with the required components, and culture them overnight in a shaker at 180 rpm;

[0129] (3) The donor bacteria and recipient bacteria were transferred into fresh LB liquid medium supplemented with the required components at a ratio of 1%, and cultured in a shaker at 180 rpm until the logarithmic growth phase (OD 600 About 0.3-0.5);

[0130] (4) Take 1 mL of bacterial suspension of the donor bacteria and the recipient bacteria in the logarithmic growth phase and place them in centrifuge tubes respectively. Centrifuge at 6000 rpm for 10 min. After the centrifugation, discard the supernatant.

[0131] (5) Resuspend the donor bacteria and recipient bacteria in 1 mL of fresh LB liquid medium, transfer an appropriate amount of donor bacteria and recipient bacteria to a new centrifuge tube in a volume ratio of 7:1, mix thoroughly, take 100 μL of the mixture and spread it on an LB solid plate without antibiotics and containing DAP, and culture it in a constant temperature incubator at 37°C for 24 h;

[0132] (6) Add an appropriate amount of fresh LB liquid medium to the plate after the previous step of culture, scrape the bacteria with a sterile spreader and collect them in a centrifuge tube, mix them well, dilute them appropriately with LB liquid medium, take an appropriate amount of the dilution and spread it on the LB solid plate containing Amp and Cm, and culture in a 37°C incubator for 24 h;

[0133] (7) Pick a single colony on the plate and use primer pRE112-F 0 / pRE112-R 0 Colony PCR was performed, and the PCR products were sequenced and verified to screen for Aeromonas dakaensis containing the recombinant plasmid.

[0134] Subsequently, in the Dhaka Aeromonas cells containing the recombinant plasmid, the UDarnA fragment on the plasmid will undergo homologous recombination with the upstream and downstream homologous arms of the arnA gene on the genome, thereby knocking out the arnA gene from the wild strain. Then, by utilizing the characteristics of the suicide plasmid containing the SacB gene, screening was performed on a plate added with sucrose to obtain the deletion mutant ΔarnA of Dhaka Aeromonas C160501. The specific steps are as follows:

[0135] (1) Aeromonas dakar containing the recombinant plasmid was inoculated into 5 mL of liquid LB medium and cultured in a shaker at 30°C and 180 rpm for 12 h. The culture was then subcultured once and repeated three times.

[0136] (2) The culture fluid after subculture was diluted 100-fold with LB liquid medium, spread on LB plates containing Amp and 20% sucrose (w / v), and cultured in a 30°C incubator for 24 h;

[0137] (3) Number the single colonies on the plate, and use a sterile inoculation loop to streak each single colony on LB solid medium containing Amp and Cm and Amp and 20% sucrose, respectively, and culture in a 30°C incubator overnight;

[0138] (4) Single colonies that did not grow on plates containing Amp and Cm but grew on plates containing Amp and 20% sucrose were selected and verified by colony PCR using primers arnA-F0 / arnA-R0;

[0139] (5) The single colony verified as a positive clone was inoculated into LB liquid culture medium and cultured, and DNA was extracted. PCR amplification was performed using specific primers arnA-F / arnA-R and arnA-F0 / arnA-R0, respectively. The PCR products were sequenced. The strain with no bands in arnA-F / arnA-R amplification and the correct result of arnA-F0 / arnA-R0 amplification product was sequenced, that is, the deletion mutant ΔarnA, which was stored in an ultra-low temperature refrigerator.

[0140] The mutant strain ΔarnA was subcultured. The subculture was performed every 8 hours. After more than 30 consecutive subcultures, the genome was extracted. According to the whole genome sequencing results of Aeromonas dakar C160501, specific primers arnA-F for detecting the deletion of arnA gene were designed at appropriate positions on both sides of the arnA gene. 0 / arnA-R 0 PCR amplification was performed to detect the genetic stability of the deletion strain.

[0141] 2.3.2 Construction of the Δugd deletion mutant of Aeromonas dakar

[0142] 2.3.2.1 Extraction of the genome of Aeromonas dakar C160501

[0143] Same as 2.3.1.1.

[0144] 2.3.2.2 Amplification of upstream and downstream homology arms of ugd gene

[0145] The upstream and downstream primers Up-F / R and Down-F / R of the ugd gene were used, and the genome of Aeromonas dakar C160501 was used as a template. After mixing with other PCR components, the upstream and downstream homologous arms of the ugd gene were amplified respectively.

[0146] 2.3.2.3 Recovery of PCR amplified fragments

[0147] Purify and recover the PCR product according to the instructions of the FastPure Gel DNA Extraction Mini Kit.

[0148] 2.3.2.4 Fusion of upstream and downstream homology arms of ugd gene

[0149] After completing the PCR amplification of the upstream and downstream homology arms of the ugd gene and the purification and recovery of the products, the fusion PCR method is used to make the upstream and downstream homology arms perform base complementary pairing through the common 15bp sequence and then amplify the fusion fragment. After the PCR amplification of the upstream and downstream homology arm fusion fragments is completed, the PCR product is gel recovered.

[0150] 2.3.2.5 Construction of Δugd-pK18mobsacB knockout plasmid

[0151] The upstream and downstream homology arm fusion fragment gel recovery products were double-digested with the pK18mobsacB plasmid using restriction endonucleases EcoR I and HindIII, reacted in a constant temperature water bath at 37°C for 30 minutes, and then subjected to gel electrophoresis. The gel containing the target fragment was cut out in a gel imager and then subjected to gel recovery.

[0152] 2.3.2.6 Ligation reaction

[0153] The double-digested plasmid and the purified and recovered fusion fragment were connected using T4 DNA ligase. The plasmid and fusion fragment were added in a 1:4 molar ratio, and then other components were added and mixed, and then centrifuged briefly, and reacted in a 22°C water bath for 120 minutes.

[0154] 2.3.2.7 Transformation of Δugd-pK18mobsacB recombinant plasmid

[0155] ① Take out the Δasd E. coli competent cells from the -80℃ ultra-low temperature freezer and immediately place them on ice for 5 minutes.

[0156] ② Use a pipette to draw up 10 μL of ligation solution and 100 μL of competent cells, mix gently, and immediately place on ice for 30 minutes.

[0157] ③ Place the mixed solution from the previous step in a 42℃ constant temperature water bath, heat shock for 45 seconds and immediately take it out and place it on ice for 5 minutes.

[0158] ④ Add 900 μL of LB liquid culture medium containing 50 μg / mL DAP to the centrifuge tube and culture at 37°C, 180 rpm for 60 minutes.

[0159] ⑤ In the clean bench, spread the bacterial solution on the LB solid plate containing kanamycin and DAP, and culture it in a constant temperature incubator at 37°C for 12 hours.

[0160] 2.3.2.8 Verification of Δugd-pK18mobsacB recombinant plasmid

[0161] In the clean bench, use an inoculation loop to pick up a single colony on the transformation plate and dissolve it in PCR containing 6 mL of sterile deionized water. Take out 3 μL and heat it in a microwave oven for 3 minutes. Use the fusion fragment amplification primers Up-F / Down-R to perform colony PCR. After the PCR amplification is completed, perform gel electrophoresis to detect whether the target band is contained to screen positive clones.

[0162] The positive clones screened by colony PCR were inoculated into LB liquid culture medium containing kanamycin and DAP, cultured overnight in a constant temperature shaking incubator at 37°C, 180rpm and the recombinant plasmid was extracted. The extracted recombinant plasmid was double-enzyme digestion verified, and the enzyme digestion products were detected by gel electrophoresis. After verifying that the bands were correct, the enzyme digestion products were purified and recovered and sent for sequencing. After the sequencing was correct, the strain containing the recombinant plasmid was preserved.

[0163] 2.3.2.9 Construction of ugd gene deletion mutant

[0164] Joint transfer:

[0165] ① Take out Aeromonas dakar C160501 and Δasd Escherichia coli containing the recombinant plasmid from the -80℃ ultra-low temperature freezer, use an inoculation loop to streak on the LB solid plate and the LB solid plate containing 50μg / mL DAP in the clean bench, culture at 37℃ overnight, pick a single colony and inoculate it into LB liquid culture medium, and culture it in a constant temperature shaking incubator at 37℃, 180rpm overnight.

[0166] ② Use a pipette to transfer 1 mL of Aeromonas dakar and Escherichia coli culture medium into 50 mL of LB liquid medium, and culture in a constant temperature shaking incubator at 37°C and 180 rpm until OD 600 The value is between 0.4 and 0.6.

[0167] ③ In the clean bench, pipette 2 mL of bacterial solution into sterile centrifuge tubes, centrifuge at 6000 rpm for 10 minutes, discard the supernatant and save the bacterial pellet.

[0168] ④Add fresh culture medium again and repeat the previous step to wash the bacteria.

[0169] ⑤ After thoroughly mixing Δasd Escherichia coli and Aeromonas dakar in ratios of 3:1, 5:1 and 7:1, use a spreader to apply it on an LB solid plate without antibiotics in an ultra-clean workbench, and culture it in a constant temperature incubator at 37°C for 12 to 16 hours.

[0170] ⑥ Scrape the bacteria off the plate in a clean bench, make 10-fold gradient dilutions with clean culture medium, spread on a solid LB plate containing kanamycin (50 μg / mL) and without DAP, and culture overnight in a constant temperature incubator at 37°C.

[0171] ⑦ Extract single colonies on the plate, use PK18-F / PK18-R primers designed according to the recombinant plasmid sequence as a template for colony PCR, detect positive clones, and after verifying that the bands are correct, purify and recover the PCR products and send them for sequencing. After the sequencing results are correct, store the positive clones in a -80℃ ultra-low temperature refrigerator.

[0172] Screening of mutant strains:

[0173] ① Take out the Dhaka Aeromonas strain containing the recombinant plasmid Δugd-pK18mobsacB from the -80℃ ultra-low temperature freezer, use an inoculation loop to streak on the LB solid plate in the clean bench, culture at 37℃ overnight, pick a single colony and inoculate it into LB liquid culture medium, and culture it in a constant temperature shaking incubator at 37℃, 180rpm overnight.

[0174] ② Use fresh LB liquid medium to make serial 10-fold gradient dilutions, use a spreader to spread on LB solid plates (20% sucrose), and culture in a constant temperature incubator at 37°C overnight.

[0175] ③ In the clean bench, pick a single colony on the plate as a template, and use the primers Δugd-F / Δugd-R designed for the gene sequences outside the upstream and downstream homologous arms of the ugd gene to perform colony PCR to screen positive clones.

[0176] ④ After the colony PCR verification is correct, the remaining bacterial liquid is inoculated into LB liquid culture medium, the PCR product is purified and recovered and sent for sequencing. After the sequencing results are correct, the positive clone strains are stored in a -80℃ ultra-low temperature refrigerator.

[0177] 2.3.3 Construction of the complemented strain of Aeromonas dakar ΔarnA+CarnA

[0178] (1) Amplification of the arnA gene insert

[0179] The genome of the wild strain of Aeromonas dakar C160501 was used as a template and the arnA gene was amplified using primers C-arnA-F / C-arnA-R.

[0180] (2) Extraction of plasmid pBBR1MCS-2

[0181] Escherichia coli containing plasmid pBBR1MCS-2 was activated and plasmid pBBR1MCS-2 was extracted. The antibiotic used was kanamycin (Kanamycin, Kan), and the content in the culture medium was 50 μg / mL (the dosage of kanamycin used in this study was this concentration).

[0182] (3) Double restriction enzyme digestion of arnA gene insert and plasmid pBBR1MCS-2

[0183] After analyzing the sequence using snapgene software, restriction endonucleases HindIII-HF and Xba I were selected to perform double digestion on the vector and insert fragment. The digestion was carried out in a constant temperature water bath at 37°C overnight, and then electrophoresis was performed to recover the target fragment and determine the DNA concentration.

[0184] (4) Ligation of enzyme-cut fragments

[0185] Use T4 ligase to connect the purified double-digested fragments. Connect overnight in a 16°C constant temperature water bath, then heat at 65°C for 15 minutes to inactivate the ligase, and store in a refrigerator at -20°C for later use.

[0186] (5) Construction of complementing plasmid and screening of complementing strains

[0187] The ligation solution obtained in the previous step was transferred into competent cells, and the antibiotic used was kanamycin. The single colony obtained on the plate was cloned using primers pBBR-F 0 / pBBR-R 0 Screen positive clones containing arnA gene.

[0188] Using Escherichia coli WM3064 containing the complementing plasmid as the donor bacterium and Aeromonas dakar C160501 mutant strain ΔarnA as the recipient bacterium, refer to the method of the first step reaction in 2.3.8 (the antibiotic used is replaced by kanamycin) to perform conjugation transfer, and the expression plasmid pBBR-arnA is transferred to the deletion strain to construct a complementing strain, and positive clones are screened with the help of specific primers arnA-F / arnA-R, and the PCR products are sequenced. The strain with the correct sequencing result is the complementing strain ΔarnA+CarnA, which is stored in an ultra-low temperature refrigerator.

[0189] 2.3.4 Construction of the double deletion strain ΔugdΔarnA of Aeromonas dakar

[0190] The obtained Escherichia coli WM3064 containing the recombinant plasmid pRE112-UDarnA was used as the donor bacteria, and the Δugd deletion strain of Aeromonas dakar preserved in the laboratory was used as the recipient bacteria. The double deletion strain ΔugdΔarnA was constructed according to the method in 2.3.3, and the specific primers ugd-F / ugd-R, ugd-F 0 / ugd-R 0 , arnA-F / arnA-R and arnA-F 0 / arnA-R 0 The double deletion strains were checked, and the strains with correct sequencing results were stored in an ultra-low temperature freezer.

[0191] 2.3.5 Construction of the single complemented strain of Aeromonas dakar ΔugdΔarnA+CarnA

[0192] The obtained Escherichia coli WM3064 containing the expression plasmid pBBR-arnA was used as the donor strain, and the constructed double-deletion strain ΔugdΔarnA was used as the recipient strain. Referring to the method of constructing the complemented strain ΔarnA+CarnA by conjugation transfer in 2.3.3(5), the arnA gene was complemented to the double-deletion strain, and the strain was screened on a plate containing Kan and Amp. The single complemented strain ΔugdΔarnA+CarnA was verified using specific primers arnA-F / arnA-R, and the strain with the correct sequencing results was stored in an ultra-low temperature refrigerator.

[0193] 2.4 Phenotypic experiments and virulence analysis

[0194] 2.4.1 Growth rate determination

[0195] The wild-type strain, the ΔarnA deletion strain, the complemented strain ΔarnA+CarnA, the double-deletion strain ΔugdΔarnA and the single-complemented strain ΔugdΔarnA+CarnA of Aeromonas dakar C160501 were activated and cultured, and appropriate amounts of each bacterial solution were added to 50 mL of liquid LB medium (loaded in sterile triangular flasks of the same specifications) so that the initial OD of the bacterial solution in each flask was 600 The readings were the same. The cells were cultured at 30°C in a constant temperature shaker at 180 rpm for 24 h. An appropriate amount of bacterial solution from each bottle was taken every hour to measure the OD 600 The readings were recorded, the experiment was repeated three times, and the obtained data were plotted into a growth curve.

[0196] 2.4.2 Polymyxin susceptibility test

[0197] (1) Polymyxin B susceptibility test

[0198] The wild strain, ΔarnA deletion strain, ΔarnA complemented strain, ΔarnA+CarnA, double deletion strain ΔugdΔarnA and single complemented strain ΔugdΔarnA+CarnA of Aeromonas dakar C160501 were activated and cultured, and the concentration of each bacterial culture solution was calculated by colony counting method after appropriate dilution of each bacterial solution.

[0199] Use fresh LB liquid medium to dilute the concentration of each bacterial solution to 1.5×10 8 CFU / mL, take 100 μL of the dilution and evenly spread it on 20 mL / plate of MH agar solid culture medium, gently stick the polymyxin B drug-susceptibility paper on the culture medium, culture at 30℃ in the incubator for 18 h, measure and record the diameter of the inhibition zone, and repeat it three times.

[0200] (2) Polymyxin E susceptibility test

[0201] Since CLSI no longer provides the breakpoints for determining bacterial resistance to polymyxin E by the disc diffusion method, the broth dilution method was used to detect the resistance of each strain to polymyxin E. The test was repeated three times. The specific steps are as follows:

[0202] ① Weigh MH broth (cation adjustment) and dissolve it in deionized water to prepare MH liquid culture medium and sterilize it for later use; dissolve colistin sulfate powder in sterile water to prepare polymyxin E antibiotic solution with a concentration of 256 μg / mL for later use; activate and culture the wild strain, deletion strain ΔarnA, complementation strain ΔarnA+CarnA, double deletion strain ΔugdΔarnA and single complementation strain ΔugdΔarnA+CarnA of Aeromonas dhaka C160501, take each bacterial solution and dilute it appropriately, calculate the concentration of each strain culture solution by colony counting method, and then use fresh MH liquid culture medium to uniformly dilute the concentration of each bacterial solution to 1×10 6 CFU / mL for future use;

[0203] ② Set the first ten wells in each row of the 96-well plate as the experimental group, and the last two wells as the control groups SterileControl (SC, containing only culture medium) and Growth Control (GC, containing bacterial solution but no antibiotics), respectively. Add 100 μL MH culture medium to all wells;

[0204] ③ Take 100 μL of antibiotics with a concentration of 256 μg / mL and add them to the wells in the first column of the experimental group, pipette and mix, take 100 μL of the mixture from this well and add it to the next well, pipette and mix; repeat this operation until the antibiotic concentration in the latter column of all experimental groups is halved compared to that in the previous column;

[0205] ④ Take the concentration of 1×10 6 100 μL of each bacterial dilution with a CFU / mL was added to the wells of the experimental group and the GC group and mixed. The final bacterial concentration in each well was 5×10 5 CFU / mL, the final concentrations of antibiotics were 64 μg / mL, 32 μg / mL, …, 0.125 μg / mL, and each well of the SC group was supplemented with 100 μL of sterile MH liquid culture medium;

[0206] ⑤ Place the 96-well plate in a 30°C constant temperature incubator for 18 hours, and measure the OD of each well with an enzyme-labeled instrument. 600 reading.

[0207] 2.4.3 Stress resistance test

[0208] The wild-type strain, the ΔarnA deletion strain, the complemented strain ΔarnA+CarnA, the double-deletion strain ΔugdΔarnA, and the single-complemented strain ΔugdΔarnA+CarnA of Aeromonas dakar C160501 were activated and cultured, and diluted with fresh LB liquid medium so that the OD of each bacterial solution under the spectrophotometer was 600 The readings were uniformly adjusted to about 0.5, and bacterial solutions with the same concentration after dilution were used to detect the tolerance of each strain to acid, alkali and hydrogen peroxide. Each test was repeated three times.

[0209] (1) Acid resistance

[0210] Take 100 μL of each strain dilution with the same concentration and spread it on LB solid medium. Soak the sterile blank drug-sensitive paper in 1M hydrochloric acid solution, pick it up with tweezers and stick it on the plate. After incubating at 30℃ in an incubator for 12 hours, measure the diameter of the inhibition zone.

[0211] (2) Alkali resistance

[0212] Take 100 μL of each strain dilution with the same concentration and spread it on LB solid medium. Soak the sterile blank drug-sensitive paper in 1M sodium hydroxide solution, pick it up with tweezers and stick it on the plate. After incubating at 30℃ in an incubator for 12 hours, measure the diameter of the inhibition zone.

[0213] (3) H resistance 2 O 2 sex

[0214] Take 100 μL of each strain dilution with the same concentration and spread it on LB solid culture medium. After fully soaking the sterile blank drug-sensitive paper in a solution with a 1% hydrogen peroxide content, use tweezers to stick it on the plate. After culturing at 30°C in an incubator for 12 hours, measure the diameter of the inhibition zone.

[0215] 2.4.4 Zebrafish median lethal dose test

[0216] The wild-type strain, the ΔarnA deletion strain, the complemented strain ΔarnA+CarnA, the double-deletion strain ΔugdΔarnA and the single-complemented strain ΔugdΔarnA+CarnA of Aeromonas dhaka C160501 were activated and cultured, and the culture fluid of each strain was diluted and the bacterial concentration was determined by the colony counting method.

[0217] Healthy zebrafish were divided into 25 groups, 10 in each group, and 5 concentration gradients were set for each strain. After each strain was diluted with sterile PBS buffer, the zebrafish were intraperitoneally injected with a dose of 10 μL / tail (the control group was injected with an equal volume of sterile PBS buffer). After the challenge, the zebrafish were observed for one week and the number of deaths was recorded. The median lethal dose of each strain to zebrafish was calculated using the modified Koch method.

[0218] Pathological observation was performed on the dead zebrafish, and bacteria were isolated from their abdominal cavity for testing to confirm that the zebrafish died of infection caused by Aeromonas dhaka.

[0219] 2.4.5 Deletion mutant immune protection test

[0220] The deletion strain ΔarnA and the double deletion strain ΔugdΔarnA were activated and cultured, and the culture fluid of each strain was diluted and spread separately. After the bacterial concentration was determined by the colony counting method, the bacterial fluid of the two deletion strains was diluted to the same concentration with sterile PBS buffer.

[0221] Healthy zebrafish were divided into three groups, 20 in each group. The dilution was injected intraperitoneally into zebrafish at a dose of 10 μL / tail, and the control group was injected with an equal volume of sterile PBS buffer. Two weeks after the injection of the missing strain solution, each test zebrafish was injected with 10 μL of the wild strain solution to challenge the virus, and the number of deaths was recorded regularly within one week.

[0222] 2.5 Data Analysis

[0223] Statistical analysis was performed using GraphPad Prism version 8.0.2 (GraphPad Software, USA). T-TEST was used to test the p value, and a p value < 0.05 indicated that the difference was statistically significant.

[0224] 3 Experimental results and analysis

[0225] 3.1 Construction and identification of the ΔarnA deletion strain of Aeromonas dakar

[0226] 3.1.1 Amplification and fusion of upstream and downstream homology arms of arnA gene

[0227] Using specific primers arnA-UF / arnA-UR and arnA-DF / arnA-DR, the upstream and downstream homology arms of the arnA gene were amplified from the genome of Aeromonas dakar C160501, and the gel electrophoresis results of the PCR products were shown in Figure 1 As shown in (A), 780 bp of upstream homology arm and 766 bp of downstream homology arm were obtained, which was in line with expectations. By means of overlap extension PCR, the upstream and downstream homology arms of gene arnA were connected with the complementary sequences on primers arnA-DR and arnA-UR, and 1,531 bp of UDarnA upstream and downstream homology arm fragments were obtained. The electrophoresis results were shown in Figure 1 (B) The amplified fusion fragment was sequenced and compared, and the sequence was consistent with expectations, indicating that the upstream and downstream homology arm fusion fragments of the missing arnA gene were obtained.

[0228] 3.1.2 Construction of recombinant plasmid pRE112-UDarnA

[0229] In the PCR amplification of 3.1.1, the base fragments carried by the primers arnA-UF / arnA-DR that are complementary to the two ends of the linearized plasmid are added to the two ends of the fusion homology arm UDarnA fragment, so that the fragment UDarnA can be connected to the plasmid pRE112 by seamless cloning to obtain the recombinant plasmid pRE112-UDarnA. The recombinant plasmid was extracted and used as a template for PCR amplification using primers arnA-UF / arnA-DR, and a product of about 1,500 bp was obtained ( Figure 2 ) and sequencing. After comparison, the sequence was consistent with the expectation, indicating that the recombinant plasmid pRE112-UDarnA was successfully constructed.

[0230] 3.1.3 Construction and screening of ΔarnA deletion strain

[0231] The donor bacteria (Escherichia coli WM3064 containing the recombinant plasmid) and the recipient bacteria (Aeromonas dakar wild strain) were conjugated and transferred, and screened on the resistance plate containing Amp and Cm. Single colonies were picked and cloned with specific primers pRE112-F 0 / pRE112-R 0 Detection, a 2,079 bp PCR product was obtained ( Figure 3 ), the sequencing results were consistent with expectations, indicating that the recombinant plasmid containing the UDarnA fragment had been successfully transferred into Aeromonas dakar. The positive clones of homologous recombination were screened on a plate containing Amp and 20% sucrose, and the primers arnA-F 0 / arnA-R 0 When a single colony was detected, a band of 1,900 bp was obtained, while the band amplified by the same primers in the wild strain genome was 3,892 bp; when primers arnA-F / arnA-R were used for amplification, no band was produced in the single colony on the plate, but a band of 1,992 bp was obtained in the wild strain genome ( Figure 4 ), and the sequencing results of the PCR products were consistent with expectations, indicating that the deletion strain ΔarnA of Aeromonas dakar C160501 was successfully constructed.

[0232] 3.1.4 Genetic stability test of deletion strains

[0233] The deletion strain ΔarnA was subcultured for more than 30 times, and the genome of the deletion strain was extracted as a template. No band was amplified using primers arnA-F / arnA-R. 0 / arnA-R 0 Amplified 1,900 bp band ( Figure 5), and the sequencing results of the PCR products were consistent with expectations, indicating that the deletion strain ΔarnA had good genetic stability.

[0234] 3.2 Identification of ugd gene deletion mutants

[0235] 3.2.1 Identification of Aeromonas dhaka containing recombinant plasmids

[0236] The Δasd Escherichia coli containing the Δugd-pK18mobsacB plasmid was mixed with Aeromonas dakar for conjugation transfer. The recombinant plasmid contained a kanamycin resistance marker and the Δasd Escherichia coli could not grow in a medium without DAP for preliminary screening. The primers pK18-F / pK18-R designed with the pK18mobsacB plasmid sequence were used for colony PCR verification to verify the Aeromonas dakar containing the recombinant plasmid. The size of the PCR amplified fragment was 1422 bp ( Figure 6 ) and verify that the result is correct.

[0237] 3.2.2 Identification of ugd gene knockout strains

[0238] The Dhaka Aeromonas containing the recombinant plasmid that was verified by colony PCR was expanded in LB liquid medium and coated on LB solid plates containing 20% ​​sucrose in a clean bench for negative screening. Single colonies on the sucrose plate were picked and colony PCR was performed using primers Δugd-F / Δugd-R designed based on the genome sequence outside the homology arm of the ugd gene. The size of the fragment amplified using the genome of Dhaka Aeromonas C160501 as a template was 3437bp, the amplified fragment of the ugd gene deletion strain was 2090bp, and the size of the ugd gene fragment was 1347bp ( Figure 7 ), the verification result was correct, and the construction of the Δugd mutant strain was completed.

[0239] 3.3 Construction and identification of the complemented strain ΔarnA+CarnA

[0240] 3.3.1 Amplification and double restriction enzyme digestion of the complemented fragment

[0241] Using the genome of Aeromonas dakar C160501 as a template, primers C-arnA-F / C-arnA-R were used to amplify the complemented fragment of the arnA gene, and the PCR product size was 2,009 bp ( Figure 8 ). The purified arnA gene complementation fragment was double-digested with restriction endonucleases Hind III-HF and Xba I.

[0242] 3.3.2 Extraction and double restriction enzyme digestion of plasmid pBBR1MCS-2

[0243] Plasmid pBBR1MCS-2 was extracted and double-digested with restriction endonucleases Hind III-HF and Xba I ( Fig. 9 ).

[0244] 3.3.3 Construction of recombinant expression plasmid pBBR-arnA

[0245] After the double-digested insert and vector were purified, they were ligated with T4 ligase and transferred into competent cells to construct the recombinant expression plasmid pBBR-arnA. 0 / pBBR-R 0 PCR detection was performed and a band of 2,358 bp was obtained ( Fig.10 ), and the sequencing results of the PCR products were consistent with expectations, indicating that the arnA gene had been successfully linked to the appropriate position in the plasmid, and the recombinant expression plasmid pBBR-arnA was constructed.

[0246] 3.3.4 Screening of complemented strain ΔarnA+CarnA

[0247] Escherichia coli containing the recombinant expression plasmid pBBR-arnA was conjugated with the ΔarnA deletion strain of Aeromonas dakar, and pBBR-arnA was transferred from WM3064 into the mutant strain ΔarnA, and screened on plates containing Kan and Amp resistance. PCR detection of single colonies using primers arnA-F / arnA-R obtained a 1,992 bp band. The sequencing results of the PCR product were consistent with expectations, indicating that the complementation strain ΔarnA+CarnA of Aeromonas dakar C160501 was successfully constructed ( Fig.11 ).

[0248] 3.3.5 Genetic stability test of complement strains

[0249] The complemented strain ΔarnA+CarnA was subcultured for more than 30 times, and the complemented strain was used as a template and the primers arnA-F / arnA-R were used to detect the 1,992 bp band ( Fig.12 ), and the sequencing results of the PCR products were consistent with expectations, indicating that the complemented strain ΔarnA+CarnA had good genetic stability.

[0250] 3.4 Construction of the double deletion strain ΔugdΔarnA

[0251] 3.4.1 Construction and screening of double deletion strains

[0252] The donor Escherichia coli WM3064 containing the recombinant plasmid was conjugated with the recipient Aeromonas dakar C160501 deletion strain Δugd, and screened on a resistant plate containing Amp and Cm. A single colony was picked and cloned with specific primers pRE112-F 0 / pRE112-R 0 PCR detection and sequencing were performed, and the results were consistent with expectations, and the deletion strain Δugd containing the recombinant plasmid was obtained. The positive clones of homologous recombination were screened on a plate containing Amp and 20% sucrose, and the single colonies on the plate were PCR-PCR-PCR-encoded with primers arnA-F 0 / arnA-R 0 and ugd-F 0 / ugd-R 0 PCR detection was performed, and bands of 1,900 bp and 1,000 bp were obtained, respectively, while bands of 3,892 bp and 2,347 bp were obtained in the wild strain genome by PCR amplification; PCR amplification was performed using primers arnA-F / arnA-R and ugd-F / ugd-R, respectively, and no bands were found in the single colony products on the plate, while bands of 1,992 bp and 1,347 bp were obtained in the wild strain ( Fig.13 ), and the sequencing results of the PCR products were consistent with expectations, indicating that the double deletion strain ΔugdΔarnA of Aeromonas dakar C160501 was obtained.

[0253] 3.4.2 Genetic stability test of double deletion strains

[0254] The double deletion strain ΔugdΔarnA was subcultured for more than 30 times, and the genome of the double deletion strain was extracted as a template. No bands were amplified by PCR detection using primers arnA-F / arnA-R and ugd-F / ugd-R. 0 / arnA-R 0 and ugd-F 0 / ugd-R 0 The amplified bands were 1,900 bp and 1,000 bp respectively ( Fig.14 ), and the sequencing results of the PCR products were consistent with expectations, indicating that the double deletion strain ΔugdΔarnA had good genetic stability.

[0255] 3.5 Construction of the single complementation strain ΔugdΔarnA+CarnA

[0256] 3.5.1 Screening of single complementation strain ΔugdΔarnA+CarnA

[0257] E. coli containing the recombinant expression plasmid pBBR-arnA was conjugated with the double-deleted strain of Aeromonas dakar, ΔugdΔarnA. pBBR-arnA was transferred from WM3064 into ΔugdΔarnA and screened on plates containing Km and Amp resistance. Single colonies were detected by PCR using primers arnA-F / arnA-R, and a 1,992 bp band was obtained ( Fig.15), the sequencing results of the PCR products were consistent with expectations, and the single complemented strain ΔugdΔarnA+CarnA was successfully constructed.

[0258] 3.5.2 Genetic stability test of single complementation strain ΔugdΔarnA+CarnA

[0259] The single complement strain ΔugdΔarnA+CarnA was subcultured for more than 30 times, and the single complement strain was used as a template and the primers ugd-F / ugd-R and ugd-F were used. 0 / ugd-R 0 PCR detection was performed, and the electrophoresis results showed no band and a 1,000 bp band, respectively; a 1,992 bp band was amplified using primers arnA-F / arnA-R ( Fig.16 ); in comparison, the above primers were used for PCR amplification in the wild-type genome, and the resulting bands were 1,347 bp, 2,347 bp, and 1,992 bp, respectively. The PCR products were sequenced, and the results were consistent with expectations, indicating that the single complementation strain ΔugdΔarnA+CarnA has good genetic stability.

[0260] 3.6 Phenotypic experimental results and bacterial virulence analysis

[0261] 3.6.1 Growth rate

[0262] The wild-type strain, the ΔarnA deletion strain, the complemented strain ΔarnA+CarnA, the double-deletion strain ΔugdΔarnA, and the single-complemented strain ΔugdΔarnA+CarnA of Aeromonas dakar C160501 with the same initial concentration were cultured at 30°C in a shaker at 180 rpm for 24 h, and the OD of the culture fluid of each strain was measured every hour. 600 Read and record the results, and plot them into a growth curve ( Fig.17 ), according to the trend of the growth curve, it can be seen intuitively that there is no significant difference in the growth rate among the strains.

[0263] 3.6.2 Results of polymyxin susceptibility testing

[0264] (1) Drug sensitivity of Aeromonas dakar to polymyxin B

[0265] The drug sensitivity of wild-type Aeromonas dakarensis C160501, deletion strain ΔarnA, complemented strain ΔarnA+CarnA, double deletion strain ΔugdΔarnA and single complemented strain ΔugdΔarnA+CarnA to polymyxin B was determined by disk diffusion method. Fig.18 ), and the diameters of the inhibition zones are shown in Table 2.

[0266] According to the standards provided by the drug sensitivity paper supplier, the diameter of the inhibition zone is ≤8mm as resistant (R), ≥11mm as sensitive (S), and 8-11mm as intermediate (I). The results showed that the diameters of the inhibition zones of the deletion strain ΔarnA, the double deletion strain ΔugdΔarnA, the complemented strain ΔarnA+CarnA, and the single complemented strain ΔugdΔarnA+CarnA were all enlarged to varying degrees, and they were sensitive to polymyxin B ( Fig.19 ).

[0267] Table 2 Results of polymyxin B susceptibility test

[0268]

[0269] (2) Drug sensitivity of Aeromonas dakar to polymyxin E

[0270] The drug sensitivity of the wild-type Aeromonas dakar C160501 strain, the deletion strain ΔarnA, the complemented strain ΔarnA+CarnA, the double deletion strain ΔugdΔarnA and the single complemented strain ΔugdΔarnA+CarnA to polymyxin E was determined by the broth dilution method. The minimum inhibitory concentration (MIC) of each strain in the experiment is shown in Table 3.

[0271] According to the breakpoints provided by CLSI, MIC ≦ 2 μg / mL was judged as intermediate (I), MIC ≧ 4 μg / mL was judged as resistant (R), and no sensitive breakpoint was given. The MIC of the wild strain was 64 μg / mL or higher, showing resistance; while the MIC of the deletion strain ΔarnA, the double deletion strain ΔugdΔarnA, the complemented strain ΔarnA+CarnA and the single complemented strain ΔugdΔarnA+CarnA were all ≦ 2 μg / mL, showing intermediate.

[0272] Table 3 Results of polymyxin E susceptibility test

[0273]

[0274] 3.6.3 Stress resistance test

[0275] Equal concentrations and volumes of bacterial suspensions of Aeromonas dakar C160501 wild-type strain, ΔarnA deletion strain, ΔarnA complemented strain + CarnA, double deletion strain ΔugdΔarnA and single complemented strain ΔugdΔarnA + CarnA were spread on LB plates and then washed with 1 M HCl, 1 M NaOH and 1% H 2 O 2 A sterile paper sheet thoroughly soaked in the solution was pasted on a plate, and the diameter of the inhibition zone was recorded after 24 h. The results are shown in Table 4. 2 O 2Under the pressure of the solution, there was no significant difference in the diameter of the inhibition zone formed by each strain ( Fig. 20 ).

[0276] Table 4 Results of environmental stress tests for each strain

[0277]

[0278]

[0279] 3.6.4 Zebrafish median lethal dose determination

[0280] Observation of the dead zebrafish in the experiment revealed that typical symptoms of Aeromonas infection, such as abdominal swelling and congestion, were common. Fig.21 As shown, Aeromonas dakarica was isolated from the abdominal cavity of dead zebrafish; the above characteristics did not appear in healthy zebrafish, indicating that the zebrafish in the experiment died from infection caused by Aeromonas dakarica.

[0281] After gradient dilution of each bacterial solution, an equal volume of bacterial solution was injected intraperitoneally into zebrafish. The concentration of each bacterial solution and the mortality of zebrafish obtained by colony counts are shown in Table 5. Compared with the wild-type strain, the LD50 of the deletion strain ΔarnA to zebrafish increased by about 2.03 times, and the LD50 of the double deletion strain ΔugdΔarnA was 50 The LD of the complement strain ΔarnA+CarnA was increased by about 7.13 times. 50 The LD of the single complement strain ΔugdΔarnA+CarnA is roughly equal to that of the wild-type strain. 50 Improved by about 3.82 times ( Fig. 22 ).

[0282] Table 5 Median lethal dose of Aeromonas dakar challenge on zebrafish

[0283]

[0284]

[0285] 3.6.5 Immune protection test

[0286] Use 10 μL / tail volume to 3.6×10 6 The deletion strain ΔarnA and the double deletion strain ΔugdΔarnA at a concentration of CFU / mL were injected intraperitoneally into zebrafish to allow the deletion strains to stimulate the immune system of zebrafish and form a certain immune protection. The zebrafish in the control group were injected with an equal volume of sterile PBS buffer.

[0287] Two weeks later, the concentration of 2.5 × 10 8All zebrafish were challenged with wild strain of Aeromonas dakar C160501 at 100 CFU / mL, and the number of deaths in each group was recorded every 12 hours. It was found that no more zebrafish deaths occurred after 48 hours. One week after the last zebrafish death was recorded, the tracking was stopped and the relative protection rate was calculated (Table 6).

[0288] As shown in the survival curve ( Fig.23 ), the survival rates of zebrafish protected by the deletion strain ΔarnA and the double deletion strain ΔugdΔarnA were 65% and 40%, respectively, while the survival rate of zebrafish in the control group was only 5%. After calculation, the relative protection rates of the deletion strain ΔarnA and the double deletion strain ΔugdΔarnA for zebrafish were 63.16% and 36.84%, respectively.

[0289] Table 6 Immune protection ability of deletion strains on zebrafish

[0290]

Claims

1. A type of Aeromonas dakarensis ( Aeromonas dhakensis ) mutant, characterized in that The mutant strain of Aeromonas dakar is based on the wild strain of Aeromonas dakar, lacking arn Gene or ugd as well as arn The single deletion mutant strain ΔarnA or double deletion mutant strain ΔugdΔarnA of Aeromonas dakar obtained after double gene, the wild strain of Aeromonas dakar is A. dhakensis C160501.

2. A method for constructing the mutant strain of Aeromonas dakar according to claim 1, characterized in that: The following steps are involved: (1) Extraction of the Aeromonas dakar genome The genome was extracted using a bacterial genome extraction kit; (2) Amplification of upstream and downstream homology arms of the target gene Using the extracted genome of Aeromonas dakar as a template, arn Specific primers for amplification of upstream and downstream homology arms of the gene arn -UF / R and arn -DF / R, respectively amplified arn Gene upstream and downstream homology arms, primers arn -UF / R and arn - In DF / R, overlap fragments are designed for subsequent homology arm fusion and seamless cloning, which can be added to the appropriate positions at both ends of the homology arms through PCR amplification; arnA-UF: TGCCCGGCATCCAACCTACGGTCAGCATGCC arnA-UR: ATCCGCAGACCTACCTGTTGAGCTTCCT arnA-DF:GGTAGGTCTGCGGATCGACG arnA-DR:GTAATTTTTTTAAGGCCCGAGCAGGGCATC (3) Recovery of PCR products The PCR product was recovered and purified by gel recovery method; (4) Homologous arm fusion The purified arn The upstream and downstream homology arm fragments of the gene were fused and the homology arm fusion fragment was named UD arn ; (5) The extracted plasmid pRE112 was linearized and the homology arm fusion fragment UD arn Ligate into the linearized vector pRE112 to construct the recombinant plasmid pRE112-UD arn ; (6) Aeromonas dakar deletion mutant Δ arn Construction The obtained recombinant plasmid pRE112-UD arn Escherichia coli WM3064 was co-cultured with wild-type Aeromonas dakarense strains, and during this period, conjugation transfer occurred, transferring the recombinant plasmid from the Escherichia coli cells to the Aeromonas dakarense cells; (7) In Aeromonas dakar cells containing the recombinant plasmid, the UD arn fragments, will be on the genome arn Homologous recombination occurs between the upstream and downstream homologous arms of the gene, thus arn The gene was knocked out from the wild strain, and then the suicide plasmid was used to SacB The characteristics of the gene were screened on a plate supplemented with sucrose to obtain the deletion mutant strain Δ arn ; (8) Using the obtained Escherichia coli WM3064 containing the recombinant plasmid pRE112-UDarnA as the donor bacterium and the Aeromonas dakar Δugd deletion strain as the recipient bacterium, the double deletion strain ΔugdΔarnA was constructed according to the methods of steps (6) and (7).

3. The method according to claim 2, characterized in that The Aeromonas dakar Δugd deletion strain was constructed by the following method: (1) Extraction of the Aeromonas dakar genome The genome was extracted using a bacterial genome extraction kit; (2) Amplification of upstream and downstream homology arms of the target gene Using the extracted genome of Aeromonas dakar as a template, ugd The specific amplification primers Up-F / R and Down-F / R of the upstream and downstream homologous arms of the gene are used to amplify ugd Upstream and downstream homology arms of the gene; Up-F: ACGAATTCGAGCATCCGCACCTTGTCT Up-R: GCAGTTGCCGTAGATGATGTTGCGTTGCAGCAGG Down-F:ATCTACGGCAACTGCGACA Down-R:ACAAGCTTCCACTCTCTCACCTCATCGG (3) Recovery of PCR products The PCR product was recovered and purified by gel recovery method; (4) Homologous arm fusion After completing the PCR amplification of the upstream and downstream homologous arms of the ugd gene and the purification and recovery of the products, the fusion PCR method was used to make the upstream and downstream homologous arms complementary to each other through the common 15 bp sequence and then amplify the fusion fragment; (5) Using restriction endonucleases EcoR I and Hind III, the gel-recovered products of the upstream and downstream homology arm fusion fragments were double-digested with the pK18mobsacB plasmid, and then the double-digested plasmid and the purified and recovered fusion fragments were ligated using T4 DNA ligase after gel recovery. The ligated products were transformed into Δasd Escherichia coli competent cells, and Escherichia coli containing the recombinant plasmid Δugd-pK18mobsacB were screened; (6) Construction of the Δugd deletion mutant of Aeromonas dakar The obtained Δasd Escherichia coli containing the recombinant plasmid Δugd-pK18mobsacB was co-cultured with the wild-type strain of Aeromonas dakar, and during this period, the conjugation transfer occurred, transferring the recombinant plasmid from the Escherichia coli cells to the Aeromonas dakar cells; In the Aeromonas dakar cells containing the recombinant plasmid, the Δugd fragment on the plasmid will undergo homologous recombination with the upstream and downstream homologous arms of the ugd gene on the genome, thereby knocking out the ugd gene from the wild strain. Colony PCR is performed using primers designed with the gene sequences outside the upstream and downstream homologous arms of the ugd gene to screen positive clones, thereby obtaining the Aeromonas dakar Δugd deletion strain.

4. Use of the Aeromonas dakar mutant strain according to claim 1 in the preparation of a medicament for preventing diseases caused by Aeromonas dakar infection.

Images