Alkbh5 as a marker and therapeutic target for metabolic diseases
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- HARBIN INST OF TECH
- Filing Date
- 2023-10-08
- Publication Date
- 2026-06-12
AI Technical Summary
Existing drugs cannot simultaneously and effectively lower blood sugar, blood lipids, and alleviate metabolic fatty liver. There is a lack of drugs for treating metabolic fatty liver and liver cancer. It is necessary to find drug targets that can be applied to hyperglycemia, hyperlipidemia, and liver cancer at the same time.
Targeting liver-specific inhibition of ALKBH5, reducing ALKBH5 expression through GalNac-coupled modification of siRNA or other methods, inhibiting liver ALKBH5 by liver-specific gene knockout or siRNA, and designing drug delivery pathways to reduce ALKBH5 expression.
It achieves simultaneous reduction of blood sugar and blood lipids and alleviates metabolic fatty liver, with safety, durability and reliability. Targeting ALKBH5 is safe and can effectively prevent or treat metabolic diseases.
Smart Images

Figure CN117385019B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a method for preventing or treating metabolic diseases (including type 2 diabetes, hyperlipidemia, metabolic fatty liver, and liver cancer), the method comprising inhibiting hepatic ALKBH5. This invention also relates to pharmaceuticals for the prevention and treatment of metabolic diseases. Background Technology
[0002] Metabolic diseases include obesity, hyperglycemia (type 2 diabetes), impaired glucose tolerance, hyperlipidemia, and metabolic fatty liver disease, among which metabolic fatty liver promotes the development of liver cancer. Metabolic diseases are one of the major threats to human health. The incidence of metabolic diseases in the adult population of my country has exceeded 50% and continues to increase; therefore, the prevention and treatment of metabolic diseases has become a major strategic need for my country.
[0003] Metformin is currently the most widely used hypoglycemic drug, but it cannot lower blood lipids or alleviate non-alcoholic fatty liver disease (NAFLD). GLP-1 agonists such as liraglutide can promote insulin secretion and suppress appetite, thereby controlling blood sugar and weight, and are used for blood sugar and weight management in patients with type 2 diabetes and obesity. Lipid-lowering drugs are mostly statins and PCSK inhibitors, but statins and PCSK inhibitors cannot lower blood sugar or alleviate NAFLD. Currently, there are no effective drugs for treating metabolic fatty liver disease, let alone drugs that simultaneously lower blood sugar, lower blood lipids, and treat both metabolic fatty liver disease and liver cancer. Therefore, new strategies are needed to develop new drugs to prevent or alleviate the development and treatment of metabolic diseases.
[0004] Finding drug targets that can be applied to hyperglycemia, hyperlipidemia, metabolic fatty liver, and liver cancer simultaneously is key to solving this problem; that is, finding the key driving molecules in the development of metabolic diseases.
[0005] Human ALKBH5 is a 2-oxoglutarate (2OG) and ferrous iron-dependent nucleic acid oxygenase (NAOX), an m6A RNA-modified demethylase with a full length of 394 amino acids. It contains the active site motif HXDXnH for Fe(II) binding (including residues His204, Asp206, and His266), RXXnR for 2OG binding and substrate recognition, and an additional loop (βIV–V) which is thought to have single-stranded RNA selectivity (Xu, Chao et al. J Biol Chem. 2014; 289(25):17299-17311). The conserved DSBH core fold of ALKBH5 consists of eight antiparallel β-strands βI–VIII (β6–13), forming two β-sheets: the main β-sheet (strands β6, 8, 11, and 13) and the secondary β-sheet (strands β7, 9, 10, and 12). The other three β-chains, β1, β2, and β3, extend the main β-sheet. Three helices, α1, α2, and α3, are located on either side of the DSBH. The DSBH acts as a scaffold for three Fe(II)-linked residues, His204, Asp206, and His266, which constitute the highly conserved HXDXnH motif coordinating metal ion; the 2OG binding site is located in a cavity surrounded by the β-sheets of the two DSBHs, the more open end of which allows for interaction between the substrate and the active site; m 6 The A base may be in a pocket containing Arg130 and Tyr139, and His204 (His205Ala in mice) is essential for the demethylase activity of ALKBH5 (Zheng, Guanqun et al. Mol Cell. 2013; 49(1):18-29; Aik, WeiShen et al. Nucleic Acids Res. 2014; 42(7):4741-4754.). ALKBH5 is widely distributed in multiple tissues, with high expression in the liver, testes, lungs, spleen, and kidneys. Systemic knockout of ALKBH5 mice can survive, but these mice have sperm development problems (Zheng, Guanqun et al. Mol Cell. 2013; 49(1):18-29). The mechanism of action of ALKBH5 in hepatic glucose and lipid metabolism homeostasis and metabolic diseases is unclear. It is also unclear whether ALKBH5 is a key driver molecule for metabolic diseases, and it is even more unclear whether targeting hepatic ALKBH5 can prevent or treat metabolic diseases. Summary of the Invention
[0006] Through in-depth research, the inventors sought key driver molecules for metabolic diseases by analyzing changes in metabolic state caused by different dietary habits, identifying the RNA-binding protein ALKBH5 as a key driver molecule. By utilizing liver-specific gene knockout or GalNac-coupled siRNA modification to inhibit liver ALKBH5, a novel method for the prevention or treatment of metabolic diseases was established. The inventors have established a method for the prevention or treatment of metabolic diseases—inhibiting liver ALKBH5.
[0007] Specifically, the inventors discovered that ALKBH5 is abnormally overexpressed in the livers of mice and humans with metabolic diseases. Hepatic-specific knockout of ALKBH5 in mice can resist the pathogenesis of metabolic diseases, including lowering blood glucose, lowering blood lipids, alleviating metabolic fatty liver, and preventing liver cancer. These data suggest that hepatic ALKBH5 is a key driver molecule of metabolic diseases, and inhibiting hepatic ALKBH5 can prevent or alleviate the occurrence of metabolic diseases. We designed GalNac (N-acetylgalactosamine)-conjugated siRNA to target ALKBH5 in the liver of db / db mice, and found that type 2 diabetes, hyperlipidemia, and metabolic fatty liver were significantly alleviated in db / db mice.
[0008] Therefore, according to one aspect of the invention, the use of a reagent (alone) for detecting ALKBH5 expression levels in the preparation of diagnostic agents or diagnostic kits for metabolic diseases is provided.
[0009] In one embodiment, the reagent is a specific probe of the ALKBH5 gene, a gene chip, PCR primers, or an antibody or Western blotting reagent for detecting the ALKBH5 protein.
[0010] In one embodiment, the metabolic disease is selected from obesity, hyperglycemia (type 2 diabetes), impaired glucose tolerance, hyperlipidemia, metabolic fatty liver, liver cancer (hepatocellular carcinoma) or a combination thereof, preferably the combination of hyperglycemia (type 2 diabetes), hyperlipidemia and metabolic fatty liver, and / or the reagent detects the ALKBH5 expression level in the liver of the subject.
[0011] According to another aspect of the invention, the use of an agent that reduces or inhibits ALKBH5 expression (as the sole active ingredient or in combination with other active pharmaceutical ingredients for treating metabolic diseases) in the preparation of a medicament for the prevention or treatment of metabolic diseases is provided.
[0012] In one implementation, the reagent for reducing or inhibiting ALKBH5 expression is selected from the group consisting of: gapmer, antisense RNA, siRNA, esiRNA, shRNA, miRNA, RNA aptamer, TALEN, CRISPR, zinc finger nuclease, small molecule compound, ALKBH5 specific antibody, and (liver) ALKBH5 knockout or knockdown reagent.
[0013] In one embodiment, the metabolic disease is selected from obesity, hyperglycemia (type 2 diabetes), impaired glucose tolerance, hyperlipidemia, metabolic fatty liver, liver cancer (hepatocellular carcinoma), or a combination thereof, preferably the combination of hyperglycemia (type 2 diabetes), hyperlipidemia, and metabolic fatty liver.
[0014] In one embodiment, the reagent reduces or inhibits the expression level of ALKBH5 in the liver of the subject.
[0015] In one embodiment, the reagent is an N-acetylgalactosamine (GalNAc)-conjugated modified siRNA, preferably GalNAc-siAlkbh5, whose sense strand and antisense strand (5'→3') are cc-acccAgCUAugcuucagauL (SEQ ID NO:1) and aU-cugAagCauagCuGggugg-ua (SEQ ID NO:2), respectively, wherein uppercase letters indicate 2-deoxy-2-fluoro(2-F) modification, lowercase letters indicate 2-O-methyl(2-OMe) modification, - indicates PS (phosphorothiote) linkage, and L indicates GalNAc linkage.
[0016] In one implementation, the subject is a mammal, preferably a human.
[0017] According to another aspect of the present invention, a method for screening drugs for the prevention or treatment of metabolic diseases is provided, the method comprising the following steps:
[0018] 1) Determine the expression level of ALKBH5 in cells that overexpress ALKBH5;
[0019] 2) Contact the candidate compound with the cells from step 1);
[0020] 3) Determine the expression level of ALKBH5 in cells after step 2); and
[0021] 4) Compare the expression levels of ALKBH5 determined in steps 1) and 3), wherein a decreased expression level of ALKBH5 indicates that the candidate compound has the potential to prevent or treat metabolic diseases.
[0022] Preferably, the cells are liver cells, more preferably liver cells from subjects with metabolic diseases, and even more preferably, the metabolic diseases are selected from obesity, hyperglycemia (type 2 diabetes), impaired glucose tolerance, hyperlipidemia, metabolic fatty liver, and liver cancer (hepatocellular carcinoma). Preferably, the combination is a combination of hyperglycemia (type 2 diabetes), hyperlipidemia, and metabolic fatty liver. More preferably, the subjects are mammals, and most preferably, humans.
[0023] According to another aspect of the invention, a method for evaluating the efficacy of an agent in treating and / or preventing metabolic diseases is provided, wherein the method includes testing whether the agent can reduce the expression of ALKBH5 in liver cell samples from a subject with a metabolic disease; if it can reduce the expression, the agent is deemed suitable for treating and / or preventing the metabolic disease. In a preferred embodiment, the metabolic disease is selected from obesity, hyperglycemia (type 2 diabetes), impaired glucose tolerance, hyperlipidemia, metabolic fatty liver, and liver cancer (hepatocellular carcinoma), preferably a combination of hyperglycemia (type 2 diabetes), hyperlipidemia, and metabolic fatty liver, more preferably the subject is a mammal, and most preferably a human.
[0024] The present invention has the following advantages: 1) Targeting a single molecule ALKBH5 can prevent or treat metabolic diseases, that is, simultaneously lower blood sugar, lower blood lipids and alleviate metabolic fatty liver; 2) The delivery route (GalNac coupled with modified siRNA) has been used clinically and has safety, durability and reliability; 3) Inhibiting liver ALKBH5 is safe.
[0025] This invention provides a novel method for the prevention or treatment of metabolic diseases. Compared with existing hypoglycemic and lipid-lowering drugs, inhibiting hepatic ALKBH5 has the advantages of simultaneously lowering blood sugar and lipids, alleviating metabolic fatty liver, having a safe and long-lasting delivery route, and having a safe target itself. It can be used for the prevention or treatment of metabolic diseases. Attached Figure Description
[0026] Figure 1 ALKBH5 is abnormally highly expressed in the liver of HFD-induced obese mice;
[0027] Figure 2 ALKBH5 is abnormally highly expressed in the liver of db / db mice;
[0028] Figure 3 ALKBH5 is abnormally highly expressed in the livers of human diabetic patients;
[0029] Figure 4 ALKBH5-HKO mice were successfully constructed;
[0030] Figure 5Compared with control mice, ALKBH5-HKO mice had lower blood glucose levels and were resistant to HFD-induced hyperglycemia.
[0031] Figure 6 Compared with control mice, ALKBH5-HKO mice showed significantly improved glucose tolerance levels;
[0032] Figure 7 Compared with control mice, ALKBH5-HKO mice showed a significant reduction in lactate-induced glucose production;
[0033] Figure 8 Compared with control mice, ALKBH5-HKO mice showed significantly reduced glucagon sensitivity;
[0034] Figure 9 ALKBH5-HKO reduces the glucagon signaling pathway;
[0035] Figure 10 This further illustrates that ALKBH5-HKO reduces the glucagon signaling pathway, and the reduction in the glucagon signaling pathway is the reason why ALKBH5-HKO mice have lower blood glucose and are able to resist HFD-induced hyperglycemia.
[0036] Figure 11 Compared with control mice, serum TG levels were significantly reduced in both normally fed and HFD-fed ALKBH5-HKO mice.
[0037] Figure 12 Compared with control mice, ALKBH5-HKO mice did not show significant changes in serum total cholesterol levels under normal feeding conditions, but under HFD feeding conditions, ALKBH5-HKO mice showed significantly reduced serum total cholesterol levels.
[0038] Figure 13 Compared with control mice, ALKBH5-HKO mice did not show significant changes in serum low-density lipoprotein cholesterol levels under normal feeding conditions, but under HFD feeding conditions, ALKBH5-HKO mice showed significantly reduced serum low-density lipoprotein cholesterol levels.
[0039] Figure 14 Under normal feeding conditions, there was no significant difference in serum ALT levels between ALKBH5-HKO mice and control mice. However, under HFD feeding conditions, serum ALT levels in ALKBH5-HKO mice were significantly lower than those in control mice.
[0040] Figure 15 ALKBH5-HKO mice are resistant to HFD-induced fatty liver;
[0041] Figure 16ALKBH5-HKO mice were able to resist HFD-induced hepatic lipid accumulation;
[0042] Figure 17 In a DEN-induced liver cancer model, it was associated with ALKBH5. flox / flox Compared to mice, ALKBH5-HKO mice showed a significant reduction in liver weight.
[0043] Figure 18 DEN-induced ALKBH5 flox / flox The liver cancers in mice were larger and more numerous, while the DEN-induced ALKBH5-HKO liver cancers were smaller and fewer, and the livers were more normal.
[0044] Figure 19 ALKBH5 induced by DEN flox / flox Compared with mouse liver cancer, DEN-induced ALKBH5-HKO mice showed a significantly reduced number of liver tumors.
[0045] Figure 20 ALKBH5 induced by DEN flox / flox Compared with mouse liver cancer, the size of liver tumors induced by DEN in ALKBH5-HKO mice was significantly reduced.
[0046] Figure 21 ALKBH5 induced by DEN flox / flox Compared with mouse liver cancer, DEN-induced ALKBH5-HKO mouse liver cancer showed significantly reduced Ki-67 positive signal and significantly weakened cell proliferation ability.
[0047] Figure 22 ALKBH5 induced by DEN flox / flox Compared with mouse liver cancer, DEN-induced ALKBH5-HKO mice with liver cancer showed significantly lower TG content in their livers.
[0048] Figure 23 ALKBH5-HKO mice reduced mTORC1 activity by decreasing EGFR and its phosphorylated form, promoted liver autophagy, reduced lipid droplet accumulation, and decreased lipid synthesis;
[0049] Figure 24 .ALKBH5-HKO reduces the EGFR / PI3K / mTORC1 signaling pathway;
[0050] Figure 25 GalNAc-siAlkbh5 can significantly knock down ALKBH5 in the liver of db / db BKS mice;
[0051] Figure 26Compared with control GalNAc-siCon db / db BKS mice, GalNAc-siAlkbh5 db / db BKS mice showed significantly lower fasting blood glucose levels;
[0052] Figure 27 Compared with control GalNAc-siCon db / db BKS mice, GalNAc-siAlkbh5 db / db BKS mice showed significantly improved glucose tolerance;
[0053] Figure 28 Compared with control GalNAc-siCon db / db BKS mice, GalNAc-siAlkbh5 db / db BKS mice showed a significant reduction in lactate-induced glucose production.
[0054] Figure 29 Compared with control GalNAc-siCon db / db BKS mice, GalNAc-siAlkbh5db / db BKS mice showed significantly reduced glucagon sensitivity;
[0055] Figure 30 The reduction of the GCGR signaling pathway is an important reason why GalNAc-siAlkbh5 lowers blood glucose;
[0056] Figure 31 The reduction of the GCGR / cAMP signaling pathway is an important reason why GalNAc-siAlkbh5 lowers blood glucose;
[0057] Figure 32 Compared with control GalNAc-siCon db / db BKS mice, GalNAc-siAlkbh5 db / db BKS mice showed significantly lower serum triglyceride levels.
[0058] Figure 33 Compared with control GalNAc-siCon db / db BKS mice, GalNAc-siAlkbh5 db / db BKS mice showed significantly lower serum total cholesterol levels.
[0059] Figure 34 Compared with control GalNAc-siCon db / db BKS mice, GalNAc-siAlkbh5 db / db BKS mice showed significantly lower serum low-density lipoprotein cholesterol levels.
[0060] Figure 35 Compared with control GalNAc-siCon db / db BKS mice, serum ALT levels in GalNAc-siAlkbh5 db / db BKS mice were significantly reduced.
[0061] Figure 36 Compared with control GalNAc-siCon db / db BKS mice, GalNAc-siAlkbh5 db / db BKS mice showed a significant decrease in liver TG.
[0062] Figure 37 Compared with control GalNAc-siCon db / db BKS mice, GalNAc-siAlkbh5 db / db BKS mice showed a significant reduction in liver lipid droplets;
[0063] Figure 38 Decreased EGFR / AKT / mTORC1 signaling pathway, weakened lipid synthesis, and increased autophagy are important reasons why GalNAc-siAlkbh5 reduces fatty liver and blood lipids;
[0064] Figure 39 The reduction of EGFR / PI3K / mTORC1 signaling pathways is an important reason why GalNAc-siAlkbh5 reduces fatty liver and blood lipids. Detailed Implementation
[0065] Unless otherwise stated, the terms used herein have their general technical meanings as understood by those skilled in the art. For definitions and terms in this field, those skilled in the art are particularly recommended to refer to Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor, Plainsview, New York (1989); and Ausubel et al., Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999).
[0066] The term "ALKBH5 (Alkylation Repair Homolog Protein 5)" refers to a 2-oxoglutarate (2OG) and ferrous iron-dependent nucleic acid oxygenase (NAOX), which is an m6A RNA-modified demethylase.
[0067] The expression of ALKBH5 refers to its expression at three levels: DNA level, RNA level, and protein level.
[0068] The term "overexpression" refers to the inappropriate "shutdown" or high-rate transcription of a gene when the strict control of gene expression (transcription) is disrupted. High-rate transcription results in the production of large amounts of mRNA. For the overexpression of ALKBH5 in this invention, it means that its DNA, RNA, or protein expression level is at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 200%, or 300% higher than that of the control (normal or healthy tissue / cells), or even 4, 5, 6, 7, 8, 9, or 10 times higher than the ALKBH5 expression level in the control.
[0069] The techniques and reagents used to detect gene expression levels are well known to those skilled in the art. In this invention, the reagent is preferably selected from specific probes of the ALKBH5 gene (preferably nucleic acid probes with detection markers, typically complementary to the target gene), gene chips, or PCR primers for PCR-specific amplification reactions.
[0070] The techniques and reagents used to detect protein expression levels are well known to those skilled in the art. In this invention, the reagent is preferably selected from antibodies or Western blotting reagents used to detect ALKBH5 protein.
[0071] The term "reducing or inhibiting ALKBH5 expression" refers to reducing the expression level of ALKBH5 DNA, RNA, or protein to less than 80%, 70%, 60%, 50%, 40%, 30%, 20%, 15%, or 10% of its original expression level, for example, less than 5%, less than 2%, less than 1%, or even 0%. In one embodiment, ALKBH5 expression can be reduced or inhibited by gene knockout or knockdown.
[0072] The term "knockout" refers to a genetic engineering technique in which an exogenous mutated gene is used to replace an endogenous normal homologous gene through homologous recombination, thereby inactivating the endogenous gene and causing it to exhibit mutant traits.
[0073] The term "knockdown" refers to the process of inhibiting gene expression by degrading mRNA containing homologous target genes. It utilizes double-stranded small RNAs to efficiently and specifically degrade intracellular homologous mRNAs, thereby blocking the expression of target genes and causing cells to exhibit a target gene deletion phenotype. Unlike gene knockout, which permanently silences the expression of the target gene, it achieves this effect by degrading mRNA containing homologous target genes.
[0074] Gene knockout or knockdown techniques are well-known in the art, including but not limited to retroviral gene transfer that induces mutations such as point mutations, insertions, deletions, frameshifts, or missense mutations. Another way to knock out genes is using zinc finger nucleases. Zinc finger nucleases (ZFNs) are artificial restriction enzymes created by fusing a zinc finger DNA-binding domain with a DNA-cutting domain. The zinc finger domain can be modified to target specific DNA sequences, allowing zinc finger nucleases to target unique sequences within complex genomes. Other genome-customized technologies that can be used to knock out genes include TAL effector nucleases (TALENs). Another technology is the CRISPR / Cas genome editing system, which can be used to achieve RNA-guided genome modification.
[0075] Techniques to achieve "reduction or inhibition of ALKBH5 expression" may also include the use of gapmers, antisense RNA, siRNA, esiRNA, shRNA, miRNA, RNA aptamers, or ALKBH5-specific antibodies.
[0076] "Antisense RNA" refers to an RNA molecule that is complementary to mRNA, and also includes RNA molecules that are complementary to other RNAs. Since ribosomes cannot translate double-stranded RNA, the specific complementary binding of antisense RNA to mRNA inhibits its translation. Antisense constructs can be delivered, for example, as expression plasmids, wherein when expressed in cells, the plasmid produces RNA complementary to at least one unique portion of the ALKBH5 cell (preferably hepatocytes).
[0077] Another specific form of the antisense RNA strategy is the gapmer. A gapmer is a chimeric antisense oligonucleotide containing a central block of a deoxynucleotide monomer long enough to induce RNase H cleavage. The design and synthesis of gapmers are well known to those skilled in the art and can be performed by commercial companies (e.g., Exiqon, Isispharmaceuticals).
[0078] Small interfering RNA (siRNA), sometimes called short interfering RNA or silent RNA, is a class of double-stranded RNA molecules approximately 20-25 base pairs in length that function through the RNA interference (RNAi) pathway. It interferes with the post-transcriptional degradation of mRNA in specific genes expressing complementary nucleotide sequences, thereby preventing translation. The siRNA of this invention can target any segment of approximately 19 to 25 consecutive nucleotides in the ALKBH5 gene target sequence, examples of which are provided in this application. Techniques for selecting target sequences for siRNA are well known in the art. GalNAc-conjugated modified siRNA has been widely used clinically and has proven to be a safe and effective method for inhibiting liver targets. Preferably, this invention uses GalNac (N-acetylgalactosamine)-conjugated modified siRNA.
[0079] Short hairpin RNA (shRNA) is an RNA sequence consisting of two short inverted repeat sequences that can silence gene expression via RNA interference (RNAi).
[0080] The full English name of "esiRNA" is Endoribonuclease-prepared siRNAs. It is a mixture of siRNAs produced by cutting long double-stranded RNA (dsRNA) with RNase III (a ribonuclease) in E. coli. The length is between 18-25 bp and it can be used to efficiently knock out the expression level of target genes.
[0081] This invention is based on the unexpected discovery that ALKBH5 can be used as a biomarker and therapeutic target for metabolic diseases. Therefore, this invention provides the use of reagents for detecting ALKBH5 expression levels in the preparation of diagnostic agents or kits for metabolic diseases. This invention also provides the use of reagents that reduce or inhibit ALKBH5 expression in the preparation of medicaments for treating metabolic diseases. Furthermore, this invention provides a method for screening medicaments for treating metabolic diseases, the method comprising the step of determining whether candidate compounds can reduce or inhibit ALKBH5 expression in hepatocytes.
[0082] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments, but this does not limit the scope of the invention. All chemical substances used in the following reactions are commercially available products unless otherwise specified.
[0083] Unpaired Student's t-test was used for statistical analysis in this invention. Statistical calculations were performed using Microsoft Excel. A p-value was considered significant when p < 0.05.
[0084] Example 1: Expression of ALKBH5 in the liver of HFD-induced obese mice.
[0085] Twelve male mice (C57BL / 6J, Beijing Vital River Laboratory Animal Technology Co., Ltd., 42.33±5.355g) that were fed a normal diet (maintenance diet MD17121 for rats and mice, Jiangsu Medison) for 8 weeks and then switched to a high-fat HFD diet (PD6001, Changzhou Shuyi Shuer Biotechnology Co., Ltd.) for 8 weeks, and eight male mice (C57BL / 6J, Beijing Vital River Laboratory Animal Technology Co., Ltd., 32.125±2.775g) that were fed a normal diet for 16 weeks were starved for 20 hours, sacrificed, and their livers were collected. ALKBH5 expression was detected by Western Blot.
[0086] [Materials and Methods]:
[0087] Male mice fed with HFD for 8 weeks and mice of the same age fed with normal diet were compared.
[0088] The detailed method for Western blotting is as follows:
[0089] 1) Preliminary preparations
[0090] Protein gel preparation: Prepare the separating gel according to the required concentration, add 1 ml of 20% ethanol solution, let it stand at room temperature until solidified, pour off the ethanol, wipe dry, pour in the stacking gel, and insert the comb as required for the experiment.
[0091] Electrophoresis buffer preparation: 200ml 5X Tris / Gly, 800ml dH2O, 10ml 10% SDS, store at room temperature for later use.
[0092] Preparation of transfer buffer: 200ml 5X Tris / Gly, 200ml methanol, 600ml dH2O, pre-cooled at 4℃, ready for use.
[0093] Blocking solution preparation: Add 5g of skim milk powder to 95ml of PBST, mix well, and store at 4℃ for later use.
[0094] Protein sample preparation: Take liver tissue, add 10 times the volume of RIPA Buffer, grind, lyse on ice for 30 min, vote once every 10 min, centrifuge at 12000 rpm for 10 min at 4℃, transfer the supernatant to a new EP tube, add Loading Buffer, boil at 100℃ for 5 min.
[0095] 2) Electrophoresis
[0096] Add the marker and sample slowly and evenly to the loading wells, and perform electrophoresis at a constant voltage of 100V. The electrophoresis time is determined according to the molecular weight of the target protein.
[0097] 3) Transfer membrane
[0098] Clamp the transfer clamp in the following order: black side - sponge pad - filter paper - protein gel - NC membrane - filter paper - sponge pad - white side. Be careful to remove air bubbles between each layer. Transfer the membrane at a constant voltage of 100V. The transfer time depends on the molecular weight of the target protein.
[0099] 4) Closed
[0100] The NC membrane was immersed in the blocking solution and sealed at room temperature for 1 hour on a horizontal shaker at 10 rpm / min.
[0101] 5) Primary antibody
[0102] Discard the blocking buffer, wash the blocking buffer with PBST, dilute the primary antibody (anti-ALKBH5, Proteintech, 1:5000) with antibody dilution buffer (PBST solution containing 3% BSA), add the primary antibody, incubate overnight at 4°C on a horizontal shaker at 10 rpm / min, recover, wash the membrane 3 times with PBST for 10 min each time.
[0103] 6) Secondary Antibody
[0104] The secondary antibody (horseradish enzyme-labeled goat anti-mouse IgG (H+L), Zhongshan Jinqiao, 1:5000 dilution) was diluted with blocking buffer, and the secondary antibody was incubated at room temperature for 1 hour on a horizontal shaker at 10 rpm / min. The membrane was washed 3 times with PBST for 10 min each time.
[0105] 7) Color development
[0106] Developer solution was uniformly dropped onto the NC membrane, and development was performed using a chemiluminescence imaging system.
[0107] [Results are available] Figure 1 ]
[0108] [Results]: ALKBH5 was abnormally highly expressed in the liver of HFD-induced obese mice compared with mice fed a normal diet.
[0109] Example 2: Expression of ALKBH5 in the liver of db / db mice.
[0110] Ten 8-week-old male db / db (diabetic) mice and ten 8-week-old control wild-type male mice were purchased from Changzhou Cavens Laboratory Animal Co., Ltd. After being starved for 20 hours, they were sacrificed, their livers were collected, and ALKBH5 expression was detected by Western blotting.
[0111] [Materials and Methods]:
[0112] Liver of db / db mice and control wild-type mice.
[0113] For details on the Western Blot method, please refer to Example 1.
[0114] [Results are available] Figure 2 ]:
[0115] [Results]: ALKBH5 was abnormally highly expressed in the liver of db / db mice compared with wild-type mice.
[0116] Example 3: Expression of ALKBH5 in the liver of a human diabetic patient.
[0117] Seven groups of liver tissues were collected from human patients with liver cancer and diabetes and control patients with liver cancer, all from Harbin Medical University. ALKBH5 expression was detected by Western blotting.
[0118] [Materials and Methods]:
[0119] For details on the Western Blot method, please refer to Example 1.
[0120] [Results are available] Figure 3 ]:
[0121] [Results]: ALKBH5 was abnormally overexpressed in the livers of human diabetic patients.
[0122] Example 4: Construction of ALKBH5-HKO mice.
[0123] [Materials and Methods]:
[0124] ALKBH5 flox / flox Mice (commercially purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) and Alb-Cre mice (commercially purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) were crossed. For example... Figure 4 As shown in Figure A, the addition of the LoxP sequence (ATAACTTCGTATA-GCATACAT-TATACGAAGTTAT) (SEQ ID NO:3) to both ends of the wild-type mouse Alkbh5 sequence (NC_000077.7) using CRISPR / CAS9 technology does not affect the expression of ALKBH5 under normal circumstances, thus resulting in ALKBH5. flox / flox Mice. When ALKBH5 flox / flox When mice are crossed with Alb-Cre mice (mice that specifically express Cre enzyme in the liver), the Cre enzyme can remove the LoxP site, resulting in the specific knockout of ALKBH5 in the liver, i.e., ALKBH5-HKO mice.
[0125] The specific hybridization strategy is: ALKBH5 flox / flox Mice and Alb-Cre + / - Mouse hybridization yielded ALKBH5. flox / - Alb-Cre + / - Mice, the mice were associated with ALKBH5flox / flox Backcrossing mice yielded ALKBH5. flox / flox Alb-Cre + / - The mice are specifically ALKBH5-HKO mice. ALKBH5-HKO mice and ALKBH5... flox / flox Mouse hybridization can produce equal amounts of ALKBH5-HKO mice and ALKBH5 mice. flox / flox Mice (control mice).
[0126] Genetic identification methods are as follows:
[0127] ALKBH5-HKO mice (genotype: ALKBH5) flox / flox Alb-Cre + / - ): ALKBH5 primer PCR reaction yielded a single 411bp band, and Alb-cre primer PCR yielded a single 250bp band.
[0128] ALKBH5 flox / flox Mice (genotype: ALKBH5) flox / flox Alb-Cre - / - ): PCR reaction with ALKBH5 primers yielded a single 411bp band, while PCR with Alb-cre primers did not yield a single 250bp band.
[0129] ALKBH5 flox / - Alb-Cre + / - Mouse: PCR reaction with ALKBH5 primers yielded two bands of 307bp and 411bp, while PCR with Alb-cre primers yielded a single band of 250bp.
[0130] The primers for ALKBH5 mouse gene identification are:
[0131] ALKBH5-F:ACCTGGAGTCCCATAAGATTCATCC(SEQ ID NO:4)
[0132] ALKBH5-R:TTCAGGTCAGTTGGGATTACCAGG(SEQ ID NO:5)
[0133] The primers for Alb-cre mouse gene identification are:
[0134] Cre-F:GCATAACCAGTGAAACAGCATTGCTG(SEQ ID NO:6)
[0135] Cre-R:GGACATGTTCAGGGATCGCCAGGCG (SEQ ID NO:7)
[0136] Genetic identification results as follows Figure 4 As shown in B: ALKBH5 - / - The mouse showed a single 307bp band, with no cre band or ALKBH5. flox / - Mice showed two bands at 307bp and 411bp, as well as a single cre band; ALKBH5-HKO mice showed a single band at 411bp and a single cre band.
[0137] The ALKBH5-HKO mice were validated using Western blotting. The Western blotting method is detailed in Example 1 (hereinafter the same). The results are as follows: Figure 4 As shown in C.
[0138] [Results are available] Figure 4 ]:
[0139] [Results]: The ALKBH5-HKO mouse was successfully constructed.
[0140] Example 5: Effect of ALKBH5-HKO on blood glucose in mice.
[0141] The ALKBH5-HKO male rats and control ALKBH5 rats obtained in Example 4 were fed with normal diet (maintenance diet MD17121 for rats and mice, Jiangsu Medison). flox / flox Seven male rats were starved for 6 hours (8:00-14:00) after reaching 8 weeks of age, and their blood glucose levels were measured.
[0142] The ALKBH5-HKO mice and control ALKBH5 mice obtained in Example 4 were fed a normal diet (maintenance diet MD17121 for rats and mice, Jiangsu Medison). flox / flox Mice were fed HFD diet (PD6001, Changzhou Shuyishuer Biotechnology Co., Ltd.) for 12 weeks after 6 weeks, and starved for 6 hours (8:00-14:00) to measure blood glucose.
[0143] [Materials and Methods]:
[0144] ALKBH5-HKO mice fed with normal diet and control ALKBH5 mice flox / flox Mice, ALKBH5-HKO mice fed with HFD diet and control ALKBH5 mice flox / flox Mice.
[0145] Blood glucose meter (ONETOUCH UltraEasy, Johnson & Johnson) and blood glucose test strips (ONETOUCH Ultra, Johnson & Johnson).
[0146] [Results are available] Figure 5 ]:
[0147] [Results]: Compared with control mice, ALKBH5-HKO mice had lower blood glucose levels and were resistant to HFD-induced hyperglycemia.
[0148] Example 6: Effect of ALKBH5-HKO on glucose tolerance in mice.
[0149] Seven male ALKBH5-HKO rats and a control ALKBH5 rat were fed according to the feeding method described in Example 5. flox / flox Eight male ALKBH5-HKO males aged 8 weeks were fed HFD diet, along with control ALKBH5 males. flox / flox Twelve male rats were used for 12 weeks, and after being starved for 6 hours (8:00 am to 2:00 pm), a glucose tolerance test was conducted.
[0150] [Materials and Methods]:
[0151] ALKBH5-HKO mice fed with normal diet and control ALKBH5 mice flox / flox Mice, ALKBH5-HKO mice fed with HFD diet and control ALKBH5 mice flox / flox Mice.
[0152] Blood glucose meter (ONETOUCH UltraEasy, Johnson & Johnson) and blood glucose test strips (ONETOUCH Ultra, Johnson & Johnson).
[0153] Glucose (G116302, aladdin), sodium chloride injection (Harbin Sanlian Pharmaceutical Co., Ltd.), and sterile syringe (1mL, Jiangsu Zhiyu Medical Equipment Co., Ltd.).
[0154] The detailed procedure for the glucose tolerance test is as follows:
[0155] 1) Blood glucose test at 0:00
[0156] After the mice were starved for 6 hours, the tip of their tails was gently cut off, and a drop of blood was squeezed out. The blood glucose level and weight were then measured and recorded using a blood glucose meter.
[0157] 2) Tolerance test
[0158] Prepare a 0.1 g / ml glucose solution using physiological saline and inject it into the mice according to their body weight. The injection dose is 1 g / kg (e.g., 200 μL for a 20 g mouse). Measure and record the blood glucose levels at 15 min, 30 min, 60 min, and 120 min after injection.
[0159] [Results are available] Figure 6 ]:
[0160] [Results]: Under normal and high-fat diets, ALKBH5-HKO mice showed significantly improved glucose tolerance levels compared to control mice.
[0161] Example 7: Effect of ALKBH5-HKO on lactate tolerance in mice.
[0162] Seven male ALKBH5-HKO rats and a control ALKBH5 rat were fed according to the feeding method described in Example 5. flox / flox Eight male ALKBH5-HKO males aged 8 weeks were fed HFD diet, along with control ALKBH5 males. flox / flox Twelve male rats were used for 12 weeks, starved for 6 hours (8:00-14:00) to conduct a lactate tolerance test.
[0163] [Materials and Methods]:
[0164] ALKBH5-HKO mice fed with normal diet and control ALKBH5 mice flox / flox Mice, ALKBH5-HKO mice fed with HFD diet and control ALKBH5 mice flox / flox Mice.
[0165] Blood glucose meter (ONETOUCH UltraEasy, Johnson & Johnson) and blood glucose test strips (ONETOUCH Ultra, Johnson & Johnson).
[0166] Sodium lactate (71718, Sigma), sodium chloride injection (Harbin Sanlian Pharmaceutical Co., Ltd.), and sterile syringe (1mL, Jiangsu Zhiyu Medical Equipment Co., Ltd.).
[0167] The detailed method for the lactate tolerance test is as follows:
[0168] 1) Blood glucose test at 0:00
[0169] After the mice were starved for 6 hours, the tip of their tails was gently cut off, and a drop of blood was squeezed out. The blood glucose level and weight were then measured and recorded using a blood glucose meter.
[0170] 3) Tolerance test
[0171] Prepare a 0.1 g / ml sodium lactate solution using physiological saline and inject it into mice at a dose of 1 g / kg (e.g., 200 μL for a 20 g mouse). Measure and record blood glucose levels at 15 min, 30 min, 60 min, and 120 min after injection.
[0172] [Results are available] Figure 7 ]:
[0173] [Results]: Under normal and high-fat diets, ALKBH5-HKO mice showed significantly reduced lactate-induced glucose production compared to control mice.
[0174] Example 8: Effect of ALKBH5-HKO on glucagon tolerance in mice.
[0175] Seven male ALKBH5-HKO rats and a control ALKBH5 rat were fed according to the feeding method described in Example 5. flox / flox Eight male ALKBH5-HKO males aged 8 weeks were fed HFD diet, along with control ALKBH5 males. flox / flox Twelve male rats were used for 12 weeks, starved for 6 hours (8:00-14:00) to conduct a glucagon tolerance test.
[0176] [Materials and Methods]:
[0177] ALKBH5-HKO mice fed with normal diet and control ALKBH5 mice flox / flox Mice, ALKBH5-HKO mice fed with HFD diet and control ALKBH5 mice flox / flox Mice.
[0178] Blood glucose meter (ONETOUCH UltraEasy, Johnson & Johnson) and blood glucose test strips (ONETOUCH Ultra, Johnson & Johnson).
[0179] Glucagon (GP21258, GLPBIO), sodium chloride injection (Harbin Sanlian Pharmaceutical Co., Ltd.), and sterile syringe (1mL, Jiangsu Zhiyu Medical Equipment Co., Ltd.).
[0180] The detailed procedure for the glucagon tolerance test is as follows:
[0181] 1) Blood glucose test at 0:00
[0182] After the mice were starved for 6 hours, the tip of their tails was gently cut off, and a drop of blood was squeezed out. The blood glucose level and weight were then measured and recorded using a blood glucose meter.
[0183] 4) Tolerance test
[0184] Prepare a 1 μg / ml glucagon solution using physiological saline and inject it into mice at a dose of 10 μg / kg (e.g., 200 μL for a 20g mouse). Measure and record blood glucose levels at 15 min, 30 min, 60 min, and 120 min after injection.
[0185] [Results are available] Figure 8 ]:
[0186] [Results]: Under normal and high-fat diets, ALKBH5-HKO mice showed significantly reduced glucagon sensitivity compared to control mice.
[0187] Example 9: Effects of ALKBH5-HKO on the GCGR / PKA / CREB signaling pathway in mice.
[0188] ALKBH5-HKO male rats and control ALKBH5 rats were fed according to the feeding method described in Example 5. flox / flox Seven male rats, aged 8 weeks, were sacrificed, and their livers were collected for Western blotting.
[0189] [Materials and Methods]:
[0190] ALKBH5-HKO mice fed with normal diet and control ALKBH5 mice flox / flox Mice, ALKBH5-HKO mice fed with HFD diet and control ALKBH5 mice flox / flox Mice.
[0191] Western blotting was used to detect the expression of glucagon receptor (GCGR) (GCGR, Proteintech, 26784-1-AP), PKA substrate phosphorylation level (Phospho-(Ser / Thr)PKA Substrate, CST, 9621), cAMP response element binding protein (CREB, Proteintech, 12208-1-AP) and its phosphorylated form p-CREB (Phospho-CREB(Ser133), CST, 9198), with detailed methods described in Example 1.
[0192] [Results are available] Figure 9 ]:
[0193] [Results]: In both normally fed and HFD-fed ALKBH5-HKO mice, the levels of hepatic GCGR, p-PKA Sub, and p-CREB were significantly reduced. This indicates that ALKBH5-HKO reduces the glucagon signaling pathway.
[0194] Example 10: Effect of ALKBH5-HKO on cAMP in mice.
[0195] ALKBH5-HKO male rats and control ALKBH5 rats were fed according to the feeding method described in Example 5. flox / flox Seven male rats aged 8 weeks were sacrificed, their livers were collected, and cAMP levels were measured.
[0196] [Materials and Methods]:
[0197] ALKBH5-HKO mice fed with normal diet and control ALKBH5 mice flox / flox Mice, ALKBH5-HKO mice fed with HFD diet and control ALKBH5 mice flox / flox Mice.
[0198] The detection method for the cAMP ELISA kit (581001, Cayman) is as follows: Allow the kit to return to room temperature.
[0199] 1) Prepare buffer solution
[0200] ELISA Buffer: Add 10 mL of ELISA Buffer (10X) to 90 mL of ddH2O, mix well, and store at 4°C for later use.
[0201] Wash Buffer: Add 2.5 mL of Wash Buffer to 997 mL of ddH2O, add 0.5 mL of polysorbate, mix well, and store at 4 °C for later use.
[0202] cAMP AchE Tracer: Take cAMP AchE Tracer, add 30 mL ELISA Buffer and 300 μL of tracer, store at 4 °C for later use.
[0203] cAMP ELISA Antiserum: Take cAMP ELISA Antiserum, add 30 mL ELISA Buffer and 300 μL tracer, store at 4℃ for later use.
[0204] Ellman's Reagent: Dissolve one tube of Ellman's Reagent in 50 mL of ddH2O. Prepare fresh each time and protect from light.
[0205] 2) Sample preparation
[0206] Take 20 mg of liver sample, add 200 μL of 0.1 M HCl, grind, lyse on ice for 10 min, add 400 μL of ELISA Buffer, votex, centrifuge at 1000 g for 10 min at 4 °C, transfer the supernatant to a new EP tube, place in an ice box for later use.
[0207] 3) Testing
[0208] Prepare the required number of microplates and set up wells for Blk, TA, NSB, B0, Standard, and Sample. Add the following volumes in sequence:
[0209] Blk: Blank
[0210] TA: Blank
[0211] NSB: 100μL ELISA Buffer, 50μL Tracer
[0212] B0: 50μL ELISA Buffer, 50μL Tracer, 50μL Antiserum
[0213] Standard: 50μL Standard, 50μL Tracer, 50μL Antiserum
[0214] Sample: 50μL Sample, 50μL Tracer, 50μL Antiserum
[0215] Cover with sealing film and incubate in a humidified box at 4°C for 18 hours.
[0216] Shake the orifice plate sample dry and pat it dry on a clean paper towel.
[0217] Add 200 μL of Wash Buffer to each well, gently shake, shake off the liquid and pat dry on a paper towel. Repeat 5 times.
[0218] Add 200 μL of Ellman's Reagent to each well, and 5 μL of Tracer to each TA well.
[0219] Cover with a sealing film to protect from light, and develop the color on a horizontal shaker at 10 rpm / min. Read the absorbance values at 405 / 420 nm at any time. The B0 absorbance value is acceptable if it is within the range of 0.3-1. If it is greater than 1.5, the color development should be repeated.
[0220] A standard curve was plotted using the standard, the sample values were substituted, and the protein concentration of the sample was determined by the BCA method. The ratio is the cAMP content.
[0221] [Results are available] Figure 10 ]:
[0222] [Results]: In both normally fed and HFD-fed ALKBH5-HKO mice, liver cAMP levels were significantly reduced. This further indicates that ALKBH5-HKO reduces the glucagon signaling pathway, which is the reason why ALKBH5-HKO mice exhibit lower blood glucose levels and are able to resist HFD-induced hyperglycemia.
[0223] Example 11: Effect of ALKBH5-HKO on serum triglyceride levels in mice.
[0224] ALKBH5-HKO mice and control ALKBH5 mice were fed according to the feeding method described in Example 5. flox / floxMice were euthanized, blood was collected, centrifuged at 4000 rpm / min at 4℃ for 10 min, the supernatant (i.e., serum) was transferred, and stored at -80℃ for later use.
[0225] [Materials and Methods]:
[0226] ALKBH5-HKO mice fed with normal diet and control ALKBH5 mice flox / flox Mice, ALKBH5-HKO mice fed with HFD diet and control ALKBH5 mice flox / flox Mice.
[0227] The triglyceride (TG) test kit (F001-1-1, Nanjing Jiancheng) was used, and the test was performed strictly in accordance with the method listed in the kit instructions.
[0228] Remove the serum from the -80℃ freezer, thaw it on ice, mix with votex, incubate briefly, and place in an ice box for later use.
[0229] TG determination: Add 2.5 μL dH2O, standard, and serum to be tested to a 96-well plate, add 250 μL of detection solution, gently shake to mix, react at 37℃ for 10 min, and read the absorbance at 510 nm.
[0230] Calculation method: Standard, measure the absorbance of serum - dH2O, and record it as Δ. 标准品 and △ 血清 , △ 血清 / △ 标准品 *The concentration of the standard is the serum TG level.
[0231] [Results are available] Figure 11 ]:
[0232] [Results]: Compared with control mice, serum TG levels were significantly reduced in both normally fed and HFD-fed ALKBH5-HKO mice.
[0233] Example 12: Effect of ALKBH5-HKO on total cholesterol content in mouse serum.
[0234] ALKBH5-HKO mice and control ALKBH5 mice were fed according to the feeding method described in Example 5. flox / flox Mice. Serum was prepared according to the method in Example 11.
[0235] [Materials and Methods]:
[0236] ALKBH5-HKO mice fed with normal diet and control ALKBH5 mice flox / flox Mice, ALKBH5-HKO mice fed with HFD diet and control ALKBH5 mice flox / flox Mice.
[0237] The total cholesterol (T-CHO) test kit (A111-1-1, Nanjing Jiancheng) was used, and the test was performed strictly in accordance with the method listed in the kit instructions.
[0238] T-CHO assay: Add 2.5 μL dH2O, standard, and serum to be tested to a 96-well plate, add 250 μL of detection solution, gently shake to mix, react at 37℃ for 10 min, and read the absorbance value at 500 nm.
[0239] Calculation method: Standard, measure the absorbance of serum - dH2O, and record it as Δ. 标准品 and △ 血清 , △ 血清 / △ 标准品 *The concentration of the standard is the serum T-CHO level.
[0240] [Results are available] Figure 12 ]:
[0241] [Results]: Compared with control mice, the serum total cholesterol level of ALKBH5-HKO mice did not change significantly under normal feeding conditions, but the serum total cholesterol level of ALKBH5-HKO mice was significantly reduced under HFD feeding conditions.
[0242] Example 13: Effect of ALKBH5-HKO on serum low-density lipoprotein cholesterol levels in mice.
[0243] ALKBH5-HKO mice and control ALKBH5 mice were fed according to the feeding method described in Example 5. flox / flox Mice. Serum was prepared according to the method in Example 11.
[0244] [Materials and Methods]:
[0245] ALKBH5-HKO mice fed with normal diet and control ALKBH5 mice flox / flox Mice, ALKBH5-HKO mice fed with HFD diet and control ALKBH5 mice flox / flox Mice.
[0246] Low-density lipoprotein cholesterol (LDL-C) assay kit (A113-1-1, Nanjing Jiancheng) was used. The test was performed strictly in accordance with the method listed in the kit instructions.
[0247] LDL-C assay: Add 2.5 μL of dH2O, standard, and serum to be tested to a 96-well plate, respectively. Add 180 μL of reagent kit test solution one, gently shake to mix, incubate at 37℃ for 5 min, and read the absorbance at 546 nm, which is recorded as A1. Add 60 μL of reagent kit test solution two, gently shake to mix, incubate at 37℃ for 5 min, and read the absorbance at 546 nm, which is recorded as A2.
[0248] Calculation method: △A=A2-A1, where the absorbance of the standard sample and the absorbance of the measured serum are subtracted from the absorbance of dH2O and denoted as △A. 标准品 and △A 血清 , △A 血清 / △A 标准品 *The concentration of the standard is the serum LDL-C level.
[0249] [Results are available] Figure 13 ]:
[0250] [Results]: Compared with control mice, the serum low-density lipoprotein cholesterol level of ALKBH5-HKO mice did not change significantly under normal feeding conditions, but the serum low-density lipoprotein cholesterol level of ALKBH5-HKO mice was significantly reduced under HFD feeding conditions.
[0251] Example 14: Effect of ALKBH5-HKO on serum ALT in mice.
[0252] ALKBH5-HKO mice and control ALKBH5 mice were fed according to the feeding method described in Example 5. flox / flox Mice. Serum was prepared according to the method in Example 11.
[0253] [Materials and Methods]:
[0254] ALKBH5-HKO mice fed with normal diet and control ALKBH5 mice flox / flox Mice, ALKBH5-HKO mice fed with HFD diet and control ALKBH5 mice flox / flox Mice.
[0255] GPT(ALT) reagent kit (C009-2-1, Nanjing Jiancheng).
[0256] Remove serum from the -80°C freezer, thaw on ice, mix with Votex, briefly incubate, and place in an ice box for later use. Allow the kit to return to room temperature and preheat the matrix solution to 37°C.
[0257] Control wells: Add 10 μL of matrix solution to the 96-well plate.
[0258] Experimental wells: Add 10 μL of matrix solution to the 96-well plate, then add 2.5 μL of serum and mix thoroughly by pipetting.
[0259] Incubate at 37°C for 30 minutes.
[0260] Add 10 μL of phenylhydrazine solution to the control well and the experimental well respectively, and gently shake to mix. Add 2.5 μL of serum corresponding to the experimental well to the control well and mix by pipetting.
[0261] Incubate at 37℃ for 20 minutes.
[0262] Add 100 μL of 0.4 M NaOH to the control well and experimental well respectively, gently shake to mix, let stand at room temperature for 15 min, and read the absorbance value at 510 nm.
[0263] Calculation method: △ 测定值 = Absorbance of experimental well - Absorbance of control well, Δ 测定值 Substituting this into the standard curve yields the serum ALT (alanine aminotransferase) level.
[0264] [Results are available] Figure 14 ]:
[0265] [Results]: Under normal feeding conditions, there was no significant difference in serum ALT levels between ALKBH5-HKO mice and control mice. However, under HFD feeding conditions, serum ALT levels in ALKBH5-HKO mice were significantly lower than those in control mice.
[0266] Example 15: Effect of ALKBH5-HKO on TG in mouse liver.
[0267] ALKBH5-HKO mice and control ALKBH5 mice were fed according to the feeding method described in Example 5. flox / flox Mice were sacrificed, their livers were collected, and changes in liver triglycerides (TG) were detected.
[0268] [Materials and Methods]:
[0269] ALKBH5-HKO mice fed with normal diet and control ALKBH5 mice flox / flox Mice, ALKBH5-HKO mice fed with HFD diet and control ALKBH5 mice flox / flox Mice.
[0270] The detailed method for liver TG (triglycerides) testing is as follows:
[0271] 1) TG separation
[0272] Take 60 mg of liver tissue, add 1.5 mL of 1% acetic acid, and homogenize.
[0273] Transfer 200 μL of homogenate to a new EP tube and add 800 μL of chloroform / methanol (2:1) mixture.
[0274] Centrifuge 4-6 times, 30 seconds each time, let stand at room temperature for 5 minutes, then centrifuge at 10000g at room temperature for 10 minutes.
[0275] Transfer the lower layer of organic solution from the EP tube to a new EP tube, place it in a fume hood, and let it dry overnight.
[0276] 2) Lipid breakdown
[0277] Add 200 μL of 3M KOH to the dry EP tube and resuspend. Incubate at 70°C for 1 hour.
[0278] Cool to room temperature, add 600 μL of 1M MgCl2, votex, incubate on ice for 10 min, centrifuge at 12000 rpm for 10 min, transfer the supernatant to a new EP tube for later use.
[0279] 3) TG detection
[0280] Add 40 mL of ddH2O to the glycerol reagent (F6428, Sigma), gently invert to mix, protect from light, aliquot and store at -20°C for later use.
[0281] Add 8 μL of ddH2O, 4 μL of ddH2O + 4 μL of standard, 8 μL of standard, and 8 μL of test sample to a 96-well plate, respectively. Add 80 μL of glycerol reagent, gently shake to mix, incubate at room temperature for 15 min, and read the absorbance at 540 nm.
[0282] A standard curve was constructed with the absorbance value of the standard at 540 nm as the X-axis and the glycerol concentration as the Y-axis. The glycerol concentration was obtained by substituting the absorbance value of the sample at 540 nm into the standard curve.
[0283] 4) Calculation
[0284] The calculation formula is: (0.07687 * glycerol concentration) / liver weight, which gives the liver TG level (mg / g).
[0285] [Results are available] Figure 15 ]:
[0286] [Results]: Under normal feeding conditions, there was no significant difference in liver TG levels between ALKBH5-HKO mice and control mice. However, under HFD-induced feeding conditions, liver TG levels in ALKBH5-HKO mice were significantly lower than in control mice. This indicates that ALKBH5-HKO mice are resistant to HFD-induced fatty liver.
[0287] Example 16: Effect of ALKBH5-HKO on lipid accumulation in mouse liver.
[0288] ALKBH5-HKO mice and control ALKBH5 mice obtained in Example 4 were fed with normal diet. flox / flox Mice were fed HFD diet for 12 weeks after 6 weeks, starved for 20 hours, sacrificed, and their livers were collected, fixed in 4% paraformaldehyde solution for 4 hours, stained with H&E, and photographed.
[0289] [Materials and Methods]:
[0290] ALKBH5-HKO mice fed with HFD diet and control ALKBH5 mice flox / flox Mice.
[0291] Image taken using a research-grade inverted fluorescence microscope imager (IX71+DP74, Olympus).
[0292] [Results are available] Figure 16 ]:
[0293] [Results]: Under HFD-induced feeding conditions, the size of lipid droplets in the liver of ALKBH5-HKO mice was significantly reduced compared with that of control mice. This indicates that ALKBH5-HKO mice can resist HFD-induced hepatic lipid accumulation.
[0294] Example 17: Effect of ALKBH5-HKO on diethylnitrosamine (DEN)-induced liver cancer.
[0295] ALKBH5-HKO mice and control ALKBH5 mice obtained in Example 4 flox / flox Mice were injected with diethylnitrosamine (Sigma, 55-1-8-5, 50 mg / kg) at 14 days of age, fed with normal diet for 8 weeks, then fed with HFD diet for 45 weeks to induce liver cancer, euthanize the mice and collect the livers.
[0296] [Materials and Methods]:
[0297] Diethylnitrosamine (Sigma, 55-1-8-5)
[0298] ALKBH5-HKO mice and control ALKBH5 flox / flox mice
[0299] Electronic analytical balance (ESJ-B, Longteng Electronics)
[0300] [Results are available] Figure 17 ]:
[0301] [Results]: In the DEN-induced liver cancer model, compared with ALKBH5... flox / flox Compared to mice, ALKBH5-HKO mice showed a significant reduction in liver weight.
[0302] Example 18: Effect of ALKBH5-HKO on the morphology of diethylnitrosamine (DEN)-induced liver cancer.
[0303] DEN-induced ALKBH5-HKO and control ALKBH5 were obtained according to the method in Example 17. flox / flox Mice with liver cancer were euthanized, their livers were collected, and photographs were taken.
[0304] [Materials and Methods]:
[0305] DEN-induced ALKBH5-HKO and control ALKBH5 flox / flox Liver cancer mice
[0306] [Results are available] Figure 18 ]:
[0307] [Results]: DEN-induced ALKBH5 flox / flox The liver cancers in mice were larger and more numerous, while the DEN-induced ALKBH5-HKO liver cancers were smaller and fewer, and the livers were more normal.
[0308] Example 19: Effect of ALKBH5-HKO on the number of liver cancer tumors induced by diethylnitrosamine (DEN).
[0309] DEN-induced ALKBH5-HKO and control ALKBH5 were obtained according to the method in Example 17. flox / flox Mice with liver cancer were euthanized, their livers were collected, and photographs were taken.
[0310] [Materials and Methods]:
[0311] DEN-induced ALKBH5-HKO and control ALKBH5 flox / flox Liver cancer mice
[0312] [Results are available] Figure 19 ]:
[0313] [Results]: ALKBH5 induced by DEN flox / flox Compared to mouse liver cancer, DEN-induced ALKBH5-HKO mice showed a significantly reduced number of liver tumors.
[0314] Example 20: Effect of ALKBH5-HKO on the size of diethylnitrosamine (DEN)-induced liver cancer tumors.
[0315] DEN-induced ALKBH5-HKO and control ALKBH5 were obtained according to the method in Example 17. flox / flox Mice with liver cancer were euthanized, their livers were collected, and photographs were taken.
[0316] [Materials and Methods]:
[0317] DEN-induced ALKBH5-HKO and control ALKBH5 flox / flox Liver cancer mice
[0318] [Results are available] Figure 20 ]:
[0319] [Results]: ALKBH5 induced by DEN flox / flox Compared to mouse liver cancer, the size of liver tumors induced by DEN in ALKBH5-HKO mice was significantly reduced.
[0320] Example 21: Effect of ALKBH5-HKO on the proliferation of diethylnitrosamine (DEN)-induced hepatocellular carcinoma cells in mice.
[0321] DEN-induced ALKBH5-HKO and control ALKBH5 were obtained according to the method in Example 17. flox / flox Mice with liver cancer were sacrificed, their livers were collected, sectioned, stained with immunofluorescence, and photographed.
[0322] [Materials and Methods]:
[0323] DEN-induced ALKBH5-HKO and control ALKBH5 flox / flox Liver cancer mice
[0324] Image taken using a research-grade inverted fluorescence microscope imager (IX71+DP74, Olympus).
[0325] The Ki-67 immunofluorescence staining method is as follows:
[0326] 1) Fixed
[0327] Remove the cut glass slides from the -80℃ freezer, air dry them, fix them with 4% paraformaldehyde solution for 30 minutes, wash them with PBS buffer, and permeabilize them.
[0328] 2) Permeability
[0329] The fixed slides were immersed in permeation solution (PBS buffer containing 0.5% Triton-X100 and 0.05% SDS) and permeated at room temperature for 30 minutes. After washing with PBS buffer, the slides were blocked.
[0330] 3) Enclosed
[0331] Draw a circle around the tissue using an immunohistochemical pen, add 10 μL of blocking solution (PBS buffer containing 5% goat serum and 1% BSA) into the circle, place in a humidified chamber, and block at room temperature for 2 hours. Wash with PBS buffer and then administer primary antibody.
[0332] 4) Primary antibody
[0333] Dilute Ki-67 (1:200, CST, D385) with blocking buffer at a certain ratio, add 10 μL of the prepared primary antibody to the circle, place in a humidified chamber, incubate overnight at 4°C, and wash 3 times with PBS buffer for 5 minutes each time.
[0334] 5) Secondary Antibody
[0335] Dilute the fluorescent secondary antibody (1:200, FITC: ABclonal, AS011, DAPI: Solarbio, C0060) with blocking buffer at a certain ratio, add 10 μL of the mixed secondary antibody to the circle in the dark, place in a humidified chamber, incubate at room temperature for 1 hour, wash 3 times with PBS buffer for 5 minutes each time, and then mount the slide.
[0336] 6) Sealing
[0337] After washing the slide, spin it dry, add an anti-fluorescence quencher (BOSTER, AR1109), cover it with a coverslip, apply nail polish around the edges, let it dry, and then take a picture with an inverted fluorescence microscope.
[0338] [Results are available] Figure 21 ]:
[0339] [Results]: ALKBH5 induced by DEN flox / flox Compared with mouse liver cancer, DEN-induced ALKBH5-HKO mouse liver cancer showed significantly reduced Ki-67 positive signal and significantly weakened cell proliferation capacity.
[0340] Example 22: Effect of ALKBH5-HKO on TG in the liver of mice with diethylnitrosamine (DEN)-induced hepatocellular carcinoma.
[0341] DEN-induced ALKBH5-HKO and control ALKBH5 were obtained according to the method in Example 17. flox / flox Mice with liver cancer were euthanized, their livers were collected, and photographs were taken.
[0342] [Materials and Methods]:
[0343] DEN-induced ALKBH5-HKO and control ALKBH5 flox / flox Liver cancer mice
[0344] For details on the liver TG detection method, please refer to Example 12.
[0345] [Results are available] Figure 22 ]:
[0346] [Results]: ALKBH5 induced by DEN flox / flox Compared to mouse liver cancer, DEN-induced ALKBH5-HKO mice with liver cancer showed a significant decrease in liver TG content.
[0347] Example 23: Effects of ALKBH5-HKO on mouse liver
[0348] The impact of EGFR / PI3K / AKT / mTOR / S6k / ULK1 / LC3 / FASN / SCD1 signal path.
[0349] ALKBH5-HKO mice and control ALKBH5 mice obtained in Example 4 were fed with normal diet. flox / flox Mice were starved for 6 hours after 8 weeks (8:00-14:00) and sacrificed. Liver samples were collected, and Western blotting was used to detect the expression of proteins in the EGFR / PI3K / AKT / mTOR / S6k / ULK1 / LC3 / FASN / SCD1 signaling pathways.
[0350] [Materials and Methods]:
[0351] Normally fed ALKBH5-HKO mice and control ALKBH5 mice flox / flox Mice.
[0352] For details on the Western Blot method, please refer to Example 1.
[0353] The antibody details are as follows:
[0354] EGF Receptor (CST, 4267) and its phosphorylated form Phospho-EGF Receptor (Y1068) (CST, 3777), PI3 Kinase p55 (CST, 11889) and its phosphorylated forms Phospho-PI3 Kinase P85 (Thr458) / p55 (Tyr199) (CST, 4228), AKT (CST, 4691) and its phosphorylated forms Phospho-Akt (S473) (CST, 3787) and Phospho-Akt (T308) (CST, 4056), mTOR (CST, mT2949) and its phosphorylated form Phospho-mTOR (Ser2448) (Sigma, SAB4504476), S6K (Proteintech, 14485-1-AP) and its phosphorylated form Phospho-p70 S6 Kinase (Thr389) (CST, 9234) ULK1 (Proteintech, 20986-1-AP) and its phosphorylated forms Phospho-ULK1 (Ser757) (CST, 14202), LC3 (Proteintech, 14600-1-AP), FASN (Proteintech, 10624-2-AP), and SCD1 (ABclonal, A16429).
[0355] [Results are available] Figure 23 ]:
[0356] [Results]: In ALKBH5-HKO mice, the levels of p-EGFR, EGFR, p-PI3K-p55, pAKT(S473), pAKT(T308), p-mTOR, p-S6K, and p-ULK1 in the liver were significantly decreased, while the LC3II / LC3I ratio was significantly increased, and FASN and SCD1 were significantly decreased. ALKBH5-HKO mice reduced mTORC1 activity by decreasing EGFR and its phosphorylated forms, thus promoting hepatic autophagy, reducing lipid droplet accumulation, and decreasing lipid synthesis.
[0357] Example 24: Effect of ALKBH5-HKO on PI3K kinase activity.
[0358] ALKBH5-HKO mice and control ALKBH5 mice obtained in Example 4 were fed with normal diet. flox / flox Mice were starved for 6 hours after 8 weeks (8:00-14:00) and sacrificed. Liver was collected, and PI3-kinase activity in mouse liver was detected using a PI3-kinase activity ELISA kit.
[0359] [Materials and Methods]:
[0360] Normally fed ALKBH5-HKO mice and control ALKBH5 mice flox / flox Mice.
[0361] The PI3K kinase activity detection method using ELISA (Echelon Biosciences, K-1000s) is as follows:
[0362] 1) Buffer preparation:
[0363] KBZ Reaction Buffer: Add 4 mL of 5x KBZ Reaction Buffer to 15.76 mL of dH2O, and add 40 μL of 1M DTT and 200 μL of 10 mM ATP.
[0364] PI(4,5)P2 Substrare: Add 230 μL of dH2O to one tube of PI(4,5)P2 Substrare, mix well, and centrifuge briefly to obtain a 100 μM solution. Keep it for later use. Dilute to 10 μM with KBZ Reaction Buffer as needed before use.
[0365] Kinase Stop Solution: Add EDTA to KBZ Reaction Buffer as needed, to a final concentration of 4 mM, and set aside.
[0366] Standard Curve Buffer: On the day of the reaction, PI(4,5)P2Substrare and EDTA were added to the KBZ Reaction Buffer, with final concentrations of 2 μM and 2.4 mM, respectively.
[0367] PI(3,4,5)P3 Standard: On the day of the reaction, add 250 μL of dH2O to a tube of PI(3,4,5)P3 Standard, mix well, and centrifuge briefly to obtain a 3.6 μM PI(3,4,5)P3 Standard solution for later use.
[0368] PI(3,4,5)P3 Detector: On the day of reaction, dilute PI(3,4,5)P3 Detector as needed using Detection Buffer at a ratio of 1:800.
[0369] TBS-T Buffer: Add one 20mL bottle of 10x TBS-T Buffer to 180mL dH2O and set aside.
[0370] Secondary Detector: On the day of reaction, dilute the Secondary Detector as needed using TBS-T Buffer at a ratio of 1:800 and set aside.
[0371] 2) Sample preparation:
[0372] Take 20 mg of liver tissue, add 200 μL of Lysis Buffer, grind, lyse on ice for 20 min, centrifuge at 10000 g for 10 min at 4 °C, transfer the supernatant to a new EP tube, determine the protein concentration by BSA method, take 20 μg of protein to a new EP tube, add KBZ Reaction Buffer to 30 μl, and place on ice for later use.
[0373] 3) Kinase reaction:
[0374] Add 30 μl of 10 μM PI(4,5)P2 Substrare to the sample in step 2) and react at 37 °C for 2 h. Add 90 μl of Kinase Stop Solution to the reaction solution, mix well, and set aside.
[0375] 4) ELISA:
[0376] Take 90 μl of 3.6 μM PI(3,4,5)P3 Standard solution and add 210 μl of Standard Curve Buffer. Mix well and use this as a reference to dilute three times in sequence to obtain standard solutions of 360 nm, 120 nm, 40 nm, 13.3 nm and 4.4 nm for later use.
[0377] Transfer 60 μl of the reacted sample and standard to 3), and add 60 μl of PI(3,4,5)P3 Detector to it. Incubate at room temperature for 60 min.
[0378] Transfer 100 μl of the reaction solution to an ELISA plate and incubate at room temperature for 60 min.
[0379] Discard the solution, shake off the remaining liquid, add 200 μl of TBS-T solution to each well, and repeat 3 times.
[0380] Add 100 μl of Secondary Detector to each well and react at room temperature for 30 min.
[0381] Discard the solution, shake off the remaining liquid, add 200 μl of TBS-T solution to each well, and repeat 3 times.
[0382] Add 100 μl of TMB solution to each well and react at room temperature in the dark for 30 min. If the reaction is weak, the time can be extended appropriately.
[0383] Add 50 μl of stop solution to each well and immediately read the absorbance at 450 nm.
[0384] 5) Calculation:
[0385] The standard curve is calculated by using the absorbance values of the standard, and the PI3-kinase activity is obtained by substituting the absorbance values of the sample.
[0386] [Results are available] Figure 24 ]:
[0387] [Results]: Compared with control mice, ALKBH5-HKO mice showed significantly reduced liver PI3K kinase activity. PI3K directly affects mTORC1 activity, indicating that ALKBH5-HKO reduces the EGFR / PI3K / mTORC1 signaling pathway.
[0388] Example 25: GalNAc-siAlkbh5 targets Alkbh5 in the liver of db / db BKS mice.
[0389] [Materials and Methods]:
[0390] GalNAc-conjugated modified siRNAs have been widely used in clinical practice and have been proven to be a safe and effective method for inhibiting liver targets. GalNAc-conjugated siRNAs can promote hepatocyte uptake by interacting with ASGPR specifically expressed in hepatocytes, achieving hepatocyte-specific delivery. In addition, different modifications at different positions of the siRNA can stabilize the siRNA and significantly improve the persistence of silencing, as detailed in the published literature (Brown, Christopher R etal. Nucleic Acids Res. 2020; 48(21):11827-11844.). We designed an siRNA targeting Alkbh5, made different modifications at different positions, and conjugated it with N-acetylgalactosamine (GalNAc). The sense and antisense strands of GalNAc-siAlkbh5 are cc-acccAgCUAugcuucagauL (SEQ ID NO:1) and
[0391] aU-cugAagCauagCuGggugg-ua (SEQ ID NO:2); the sense and antisense strands of GalNAc-siCon are uu-cuccGaACGagucacguuuL (SEQ ID NO:8) and aC-gugAcuCguucGgGgaa-uu (SEQ ID NO:9), respectively. Uppercase letters indicate 2-deoxy-2-fluoro (2-F) modification, lowercase letters indicate 2-O-methyl (2-OMe) modification, - indicates PS linkage, and L indicates GalNAc linkage.
[0392] db / db BKS mice exhibit metabolic diseases such as obesity, type 2 diabetes, hyperlipidemia, and metabolic fatty liver. To determine whether hepatic ALKBH5 could serve as a drug target for metabolic diseases, we conducted a siRNA targeting study in the db / db BKS metabolic disease model. Eight-week-old db / db BKS mice were injected intravenously with GalNAc-siAlkbh5 RNA (1 mg / kg body weight) to knock down Alkbh5 expression in the liver, designated as GalNAc-siAlkbh5 mice. Control db / db BKS mice were injected with GalNAc-siCon RNA (1 mg / kg body weight), designated as GalNAc-siCon mice. Two weeks after injection, the knockdown of ALKBH5 in the liver of GalNAc-siAlkbh5 mice was detected by Western Blot. The Western Blot method is detailed in Example 1.
[0393] [Results are available] Figure 25 ]:
[0394] [Results]: GalNAc-siAlkbh5 can significantly knock down ALKBH5 in the liver of db / db BKS mice.
[0395] Example 26: Effect of GalNAc-siAlkbh5 on blood glucose in db / db BKS mice.
[0396] GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCon db / dbBKS mice were prepared according to Example 25. After one week of injection, the mice were starved for 14 hours (18:00-08:00) and blood glucose was measured.
[0397] [Materials and Methods]:
[0398] Normally fed GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCon db / db BKS mice.
[0399] Blood glucose meter (ONETOUCH UltraEasy, Johnson & Johnson) and blood glucose test strips (ONETOUCH Ultra, Johnson & Johnson)
[0400] [Results are available] Figure 26 ]:
[0401] [Results]: Compared with the control GalNAc-siCon db / db BKS mice, GalNAc-siAlkbh5db / db BKS mice showed significantly lower fasting blood glucose levels.
[0402] Example 27: Effect of GalNAc-siAlkbh5 on glucose tolerance in db / db BKS mice.
[0403] GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCon db / dbBKS mice were prepared according to Example 25. After one week of injection, the mice were starved for 15 hours (17:00-08:00) and then subjected to a glucose tolerance test.
[0404] [Materials and Methods]:
[0405] Normally fed GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCon db / db BKS mice.
[0406] Blood glucose meter (ONETOUCH UltraEasy, Johnson & Johnson) and blood glucose test strips (ONETOUCH Ultra, Johnson & Johnson).
[0407] Glucose (G116302, aladdin), sodium chloride injection (Harbin Sanlian Pharmaceutical Co., Ltd.), and sterile syringe (1mL, Jiangsu Zhiyu Medical Equipment Co., Ltd.).
[0408] The detailed procedure for the glucose tolerance test is as follows:
[0409] 1) Blood glucose test at 0:00
[0410] After the mice were starved for 15 hours, the tip of their tails was gently cut off, and a drop of blood was squeezed out. The blood glucose level and weight were then measured and recorded using a blood glucose meter.
[0411] 5) Tolerance test
[0412] Prepare a 0.05 g / ml glucose solution using physiological saline and inject it into mice at a dose of 0.5 g / kg (e.g., 200 μL for a 20 g mouse). Measure and record blood glucose levels at 15 min, 30 min, 60 min, and 120 min after injection. [Results are shown in...] Figure 27 ]:
[0413] [Results]: Compared with the control GalNAc-siCon db / db BKS mice, the glucose tolerance of GalNAc-siAlkbh5db / db BKS mice was significantly improved.
[0414] Example 28: Effect of GalNAc-siAlkbh5 on lactate tolerance in db / db BKS mice.
[0415] GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCon db / dbBKS mice were prepared according to Example 25. After one week of injection, the mice were starved for 15 hours (17:00-08:00) to conduct lactate tolerance tests.
[0416] [Materials and Methods]:
[0417] Normally fed GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCon db / db BKS mice.
[0418] Blood glucose meter (ONETOUCH UltraEasy, Johnson & Johnson) and blood glucose test strips (ONETOUCH Ultra, Johnson & Johnson).
[0419] Sodium lactate (71718, Sigma), sodium chloride injection (Harbin Sanlian Pharmaceutical Co., Ltd.), and sterile syringe (1mL, Jiangsu Zhiyu Medical Equipment Co., Ltd.).
[0420] 1) Blood glucose test at 0:00
[0421] After the mice were starved for 15 hours, the tip of their tails was gently cut off, and a drop of blood was squeezed out. The blood glucose level and weight were then measured and recorded using a blood glucose meter.
[0422] 6) Tolerance test
[0423] Prepare a 0.05 g / ml sodium lactate solution using physiological saline and inject it into mice at a dose of 0.5 g / kg (e.g., 200 μL for a 20 g mouse). Measure and record blood glucose levels at 15 min, 30 min, 60 min, and 120 min after injection.
[0424] [Results are available] Figure 28 ]:
[0425] [Results]: Compared with control GalNAc-siCon db / db BKS mice, GalNAc-siAlkbh5db / db BKS mice showed a significant reduction in lactate-induced glucose production.
[0426] Example 29: Effect of GalNAc-siAlkbh5 on glucagon tolerance in db / db BKS mice.
[0427] GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCon db / dbBKS mice were prepared according to Example 25. After one week of injection, the mice were starved for 6 hours (8:00-14:00) to perform glucagon tolerance tests.
[0428] [Materials and Methods]:
[0429] Normally fed GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCon db / db BKS mice.
[0430] Blood glucose meter (ONETOUCH UltraEasy, Johnson & Johnson) and blood glucose test strips (ONETOUCH Ultra, Johnson & Johnson).
[0431] Glucagon (GP21258, GLPBIO), sodium chloride injection (Harbin Sanlian Pharmaceutical Co., Ltd.), and sterile syringe (1mL, Jiangsu Zhiyu Medical Equipment Co., Ltd.).
[0432] The detailed procedure for the glucagon tolerance test is as follows:
[0433] 1) Blood glucose test at 0:00
[0434] After the mice were starved for 6 hours, the tip of their tails was gently cut off, and a drop of blood was squeezed out. The blood glucose level and weight were then measured and recorded using a blood glucose meter.
[0435] 7) Tolerance test
[0436] Prepare a 0.6 μg / ml glucagon solution using physiological saline and inject it into mice at a dose of 6 μg / kg (e.g., 200 μL for a 20g mouse). Measure and record blood glucose levels at 15 min, 30 min, 60 min, and 120 min after injection. [Results are shown in...] Figure 29 ]:
[0437] [Results]: Compared with the control GalNAc-siCon db / db BKS mice, the glucagon sensitivity of GalNAc-siAlkbh5db / db BKS mice was significantly reduced.
[0438] Example 30: Effects of GalNAc-siAlkbh5 on the GCGR / PKA / CREB signaling pathway in db / db BKS mice.
[0439] GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCondb / db BKS mice were obtained according to the method in Example 25. After being starved for 20 hours, they were sacrificed, and their livers were collected. Western blotting was used to detect changes in the GCGR / PKA / CREB signaling pathway.
[0440] [Materials and Methods]:
[0441] Normally fed GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCon db / db BKS mice.
[0442] Western blotting was used to detect the expression of GCGR, p-PKA Sub, p-CREB, and CREB. The method is detailed in Example 1.
[0443] [Results are available] Figure 30 ]:
[0444] [Results]: Compared with control GalNAc-siCon db / db BKS mice, the levels of liver GCGR, p-PKA Sub, and p-CREB in GalNAc-siAlkbh5 db / db BKS mice were significantly reduced. This indicates that the reduction of the GCGR signaling pathway is an important reason for the hypoglycemic effect of GalNAc-siAlkbh5.
[0445] Example 31: Effect of GalNAc-siAlkbh5 on cAMP in db / db BKS mice.
[0446] GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCondb / db BKS mice were obtained according to the method in Example 25. After being starved for 20 hours, they were sacrificed, their livers were collected, and detected using a cAMP ELISA kit.
[0447] [Materials and Methods]:
[0448] Normally fed GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCon db / db BKS mice.
[0449] For details on the detection method of the cAMP ELISA kit, please refer to Example 10.
[0450] [Results are available] Figure 31 ]:
[0451] [Results]: Compared with control GalNAc-siCon db / db BKS mice, the liver cAMP content of GalNAc-siAlkbh5 db / db BKS mice was significantly reduced. This indicates that the reduction of the GCGR / cAMP signaling pathway is an important reason for the hypoglycemic effect of GalNAc-siAlkbh5.
[0452] Example 32: Effect of GalNAc-siAlkbh5 on serum triglyceride levels in db / db BKS mice.
[0453] GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCondb / db BKS mice were obtained according to the method in Example 25. After starvation for 20 hours, the mice were sacrificed, blood was collected, centrifuged at 4000 rpm / min and 4℃ for 10 min, and the supernatant, i.e., serum, was transferred and stored at -80℃ for later use.
[0454] [Materials and Methods]:
[0455] Normally fed GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCon db / db BKS mice.
[0456] Triglyceride (TG) test kit (F001-1-1, Nanjing Jiancheng), the detection method is detailed in Example 11.
[0457] [Results are available] Figure 32 ]:
[0458] [Results]: Compared with the control GalNAc-siCon db / db BKS mice, the serum triglyceride content of GalNAc-siAlkbh5 db / db BKS mice was significantly reduced.
[0459] Example 33: Effect of GalNAc-siAlkbh5 on serum total cholesterol content in db / db BKS mice.
[0460] GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCondb / db BKS mice were obtained according to the method in Example 29. Serum was collected for later use.
[0461] [Materials and Methods]:
[0462] Normally fed GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCon db / db BKS mice.
[0463] Total cholesterol (T-CHO) test kit (A111-1-1, Nanjing Jiancheng), the detection method is detailed in Example 12.
[0464] [Results are available] Figure 33 ]:
[0465] [Results]: Compared with the control GalNAc-siCon db / db BKS mice, the serum total cholesterol content of GalNAc-siAlkbh5 db / db BKS mice was significantly reduced.
[0466] Example 34: Effect of GalNAc-siAlkbh5 on serum low-density lipoprotein cholesterol levels in db / db BKS mice.
[0467] GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCondb / db BKS mice were obtained according to the method in Example 29. Serum was collected for later use.
[0468] [Materials and Methods]:
[0469] Normally fed GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCon db / db BKS mice.
[0470] Low-density lipoprotein cholesterol (LDL-C) assay kit (A113-1-1, Nanjing Jiancheng), the detection method is detailed in Example 13.
[0471] [Results are available] Figure 34 ]:
[0472] [Results]: Compared with the control GalNAc-siCon db / db BKS mice, the serum low-density lipoprotein cholesterol content of GalNAc-siAlkbh5 db / db BKS mice was significantly reduced.
[0473] Example 35: Effect of GalNAc-siAlkbh5 on serum ALT in db / db BKS mice.
[0474] GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCondb / db BKS mice were obtained according to the method in Example 29. Serum was collected for later use.
[0475] [Materials and Methods]:
[0476] Normally fed GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCon db / db BKS mice.
[0477] GPT reagent kit (C009-2-1, Nanjing Jiancheng), the detection method is detailed in Example 14.
[0478] [Results are available] Figure 35 ]:
[0479] [Results]: Compared with the control GalNAc-siCon db / db BKS mice, the serum ALT levels of GalNAc-siAlkbh5 db / db BKS mice were significantly reduced.
[0480] Example 36: Effect of GalNAc-siAlkbh5 on liver TG in db / db BKS mice.
[0481] GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCondb / db BKS mice were obtained according to the method in Example 25. After being starved for 20 hours, the mice were sacrificed, their livers were collected, and changes in liver TG were detected.
[0482] [Materials and Methods]:
[0483] Normally fed GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCon db / db BKS mice.
[0484] Glycerol reagent (F6428, Sigma), liver TG detection method is detailed in Example 15.
[0485] [Results are available] Figure 36 ]:
[0486] [Results]: Compared with the control GalNAc-siCon db / db BKS mice, the liver TG of GalNAc-siAlkbh5 db / db BKS mice was significantly reduced.
[0487] Example 37: Effect of GalNAc-siAlkbh5 on lipid droplet accumulation in the liver of db / db BKS mice.
[0488] GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCondb / db BKS mice were obtained according to the method in Example 25. After being starved for 20 hours, they were sacrificed, their livers were collected, fixed in 4% paraformaldehyde solution for 4 hours, stained with hematoxylin and eosin (HE), and photographed.
[0489] [Materials and Methods]:
[0490] Normally fed GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCon db / db BKS mice.
[0491] Image taken using a research-grade inverted fluorescence microscope imager (IX71+DP74, Olympus).
[0492] [Results are available] Figure 37 ]:
[0493] [Results]: Compared with the control GalNAc-siCon db / db BKS mice, the number of lipid droplets in the liver of GalNAc-siAlkbh5 db / db BKS mice was significantly reduced.
[0494] Example 38: Effects of GalNAc-siAlkbh5 on the liver of db / db BKS mice
[0495] The impact of EGFR / PI3K / AKT / mTOR / S6k / ULK1 / LC3 / FASN / SCD1 signal path.
[0496] GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCondb / db BKS mice were obtained according to the method in Example 25. After being starved for 20 hours, they were sacrificed, and their livers were collected. The expression of proteins related to the EGFR / PI3K / AKT / mTOR / S6k / ULK1 / LC3 / FASN / SCD1 signaling pathways was detected by Western Blot.
[0497] [Materials and Methods]:
[0498] Normally fed GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCon db / db BKS mice.
[0499] For details on the Western Blot method, please refer to Example 1.
[0500] [Results are available] Figure 38 ]:
[0501] [Results]: Compared with control GalNAc-siCon db / db BKS mice, GalNAc-siAlkbh5 db / db BKS mice showed significantly decreased levels of p-EGFR, EGFR, p-PI3K-p55, pAKT(S473), pAKT(T308), p-mTOR, p-S6K, and p-ULK1 in the liver, significantly increased LC3II / LC3I, and significantly decreased FASN and SCD1. This indicates that decreased EGFR / AKT / mTORC1 signaling pathway, weakened lipid synthesis, and increased autophagy are important reasons why GalNAc-siAlkbh5 reduces fatty liver and blood lipids.
[0502] Example 39: Effect of GalNAc-siAlkbh5 on PI3K kinase activity in db / db BKS mice.
[0503] GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCondb / db BKS mice were obtained according to the method in Example 25. After being starved for 20 hours, the mice were sacrificed, and their livers were collected. The liver PI3K kinase activity was detected by a PI3K kinase activity ELISA kit.
[0504] [Materials and Methods]:
[0505] Normally fed GalNAc-siAlkbh5 db / db BKS mice and their control GalNAc-siCon db / db BKS mice.
[0506] For details of the ELISA detection method for PI3K kinase activity, please refer to Example 22.
[0507] [Results are available] Figure 39 ]:
[0508] [Results]: Compared with control GalNAc-siCon db / db BKS mice, GalNAc-siAlkbh5 db / db BKS mice showed significantly reduced liver PI3K kinase activity. This indicates that the reduction of the EGFR / PI3K / mTORC1 signaling pathway is an important reason why GalNAc-siAlkbh5 reduces fatty liver and blood lipids.
[0509] Those skilled in the art should understand that although the present invention has been specifically described with reference to the above embodiments, the present invention is not limited to these specific embodiments. Based on the methods and technical solutions taught in this invention, those skilled in the art can make appropriate modifications or improvements without departing from the spirit of the present invention, and the equivalent embodiments obtained therefrom are all within the scope of the present invention.
Claims
1. The use of reagents for detecting ALKBH5 expression levels in the preparation of diagnostic agents or diagnostic kits for metabolic diseases, wherein the metabolic diseases are selected from obesity, hyperglycemia, impaired glucose tolerance, hyperlipidemia, metabolic fatty liver, liver cancer, or combinations thereof.
2. The application according to claim 1, wherein the reagent is a specific probe of the ALKBH5 gene, a gene chip, PCR primers, or an antibody or Western blotting reagent for detecting ALKBH5 protein.
3. The application according to claim 1, wherein the hyperglycemia is type 2 diabetes.
4. The application according to claim 1, wherein the liver cancer is hepatocellular carcinoma.
5. The use of reagents that reduce or inhibit ALKBH5 expression in the preparation of drugs for the prevention or treatment of metabolic diseases, wherein the reagents that reduce or inhibit ALKBH5 expression are selected from the group consisting of gapmers, antisense RNA, siRNA, shRNA, TALEN, CRISPR and zinc finger nucleases, and wherein the metabolic disease is selected from obesity, hyperglycemia, impaired glucose tolerance, hyperlipidemia, metabolic fatty liver, liver cancer or a combination thereof.
6. The application according to claim 5, wherein the hyperglycemia is type 2 diabetes.
7. The application according to claim 5, wherein the liver cancer is hepatocellular carcinoma.
8. The application according to claim 5, wherein the reagent is an N-acetylgalactosamine (GalNAc)-conjugated modified siRNA.
9. The application according to claim 8, wherein the reagent is GalNAc-siAlkbh5, the sense and antisense chains of which are cc-acccAgCUAugcuucagauL and aU-cugAagCauagCuGggugg-ua, respectively, wherein uppercase letters indicate 2-deoxy-2-fluoro modification, lowercase letters indicate 2-O-methyl modification, - indicates thiophosphate linkage, and L indicates GalNAc linkage.