KASP molecular marker primer set, kit and application thereof for identifying the fruiting nature of Osmanthus fragrans

Abstract

The present invention discloses a KASP molecular marker primer set, a kit and an application thereof for identifying the fruiting property of sweet osmanthus, and relates to the technical field of sweet osmanthus molecular markers. The SNP site is located at the 6301644bp of chromosome 3 of sweet osmanthus, and the polymorphism is G / A. Based on the SNP site, the present invention also designs a primer combination for KASP detection, which can be directly used for the identification of the fruiting ability and corresponding genotype of sweet osmanthus, and then relies on the molecular marker for assisted breeding. Therefore, the KASP marker provided by the present invention can detect the fruiting condition of sweet osmanthus in a high-throughput, efficient and low-cost manner during the seedling stage, and has a good application prospect in variety classification and molecular assisted breeding.

Description

Technical Field

[0001] The invention relates to the technical field of sweet osmanthus molecular markers, and in particular to a KASP molecular marker primer set for identifying the fruitfulness of sweet osmanthus, a kit and applications thereof. Background Art

[0002] Osmanthus fragrans is one of the ten famous traditional flowers in China. In the long process of artificial introduction and domestication, through the accumulation of intraspecific variation and hybridization with closely related species of Osmanthus fragrans, rich intraspecific variation and variety resources have been formed. Osmanthus fragrans has a typical androdioecious system, that is, it has both male and hermaphroditic plants. The pistil of male osmanthus fragrans is degenerate, and it rarely or never produces fruit, while the pistil of hermaphroditic osmanthus fragrans develops normally, and the ovary swells into a spherical or oval shape, and can produce fruit ( Figure 1 As shown). The development of pistils and whether or not they bear fruit are stable traits of osmanthus varieties, and are of great value in variety classification and industrial application. Infertile varieties have a large number of petals and peduncles that fall off at the end of flowering, and are suitable as flowering trees, providing fresh flower raw materials for the development of osmanthus food, spices, medicines and other products; normal osmanthus varieties have fewer petals that fall off, and are usually used for sowing propagation, hybrid breeding, etc. in the industry.

[0003] Therefore, developing molecular markers associated with the fruiting traits of osmanthus and high-throughput identification of the fruiting conditions of varieties during the seedling stage can provide effective technical support for the classification of osmanthus varieties and molecular-assisted breeding, and has important application value in production.

[0004] Most of the molecular markers developed in the early stage of osmanthus variety research were amplified in non-coding regions or randomly amplified in the genome. The polymorphic sites obtained are usually far from the genetic distance of the target traits, which limits the application of these markers in the location of important trait genes, map-based cloning and molecular marker-assisted breeding. The widespread application of next-generation sequencing technology has promoted the development of marker technology, making third-generation molecular markers such as single nucleotide polymorphism (SNP) gradually occupy a mainstream position. SNP markers have the advantages of high density, rich sources of variation, and high correlation with functional genes and even plant phenotypes. KASP-SNP markers are a type of SNP marker used in plant genetic breeding after transformation from KASP (Kompetitive Allele Specific PCR, competitive allele-specific PCR) technology. KASP technology mainly determines the genotype of the target site by reading the terminal fluorescence signal. The principle is to use Touch-down PCR combined with a fluorescence quenching probe based on the specific matching of the primer terminal base to emit a fluorescence signal to type SNPs and detect the insertion and deletion of InDels. Because KASP-SNP markers have the characteristics of high throughput, low cost and high accuracy, they have gradually become a commonly used marker type in molecular marker-assisted breeding.

[0005] In 2018, the chromosome-level whole genome draft of Osmanthus fragrans was officially released. This achievement provides an important platform for the large-scale development of Osmanthus fragrans-specific SNP markers and their application in breeding practice and new variety identification. In recent years, genome-wide association study (GWAS) has been applied to ornamental flowers such as plum blossoms, roses, and lotus, becoming an important analytical method for discovering complex trait loci. At present, there is no technical solution for studying the fruiting traits of Osmanthus fragrans using GWAS.

[0006] In view of this, the present invention is proposed. Summary of the invention

[0007] The purpose of the present invention is to provide a KASP molecular marker primer set, a kit and an application thereof for identifying the fruitfulness of sweet osmanthus to solve the above technical problems.

[0008] The present invention is achieved in that:

[0009] In a first aspect, the present invention provides an application of a SNP site in identifying the fruitfulness of osmanthus fragrans or assisted breeding of osmanthus fragrans, wherein the SNP site is located at 6301644 bp of chromosome 3 of osmanthus fragrans, and the polymorphism is G / A.

[0010] Based on the previous germplasm resource survey, the germplasm resources of the sweet osmanthus producing areas across the country were sorted out, and a total of 123 germplasm resources were collected. The genome was resequenced, and the fruit setting of 92 of them was determined. The genomic data was used for genome-wide association analysis with the fruit setting of sweet osmanthus, and a SNP was detected at the 6301644bp position of chromosome 3, and the polymorphism was G / A.

[0011] By detecting the genotyping of this position in the osmanthus varieties, the fruit set traits of osmanthus can be identified, and germplasm materials that meet expectations in terms of fruit set can be screened.

[0012] In an optional embodiment, the SNP site is located at base 6301644 of chromosome 3 of the Osmanthus fragrans genome PRJNA529305.

[0013] The CDS sequence of the gene found according to the SNP position is shown in SEQ ID NO.4.

[0014] In a preferred embodiment of the present invention, the polymorphic site of the SNP is located at the 262 bp of the nucleotide sequence shown in SEQ ID NO.4.

[0015] In a second aspect, the present invention provides a KASP molecular marker primer set for identifying the fruitfulness of Osmanthus fragrans, comprising: a forward primer 1 as shown in SEQ ID NO.1, a forward primer 2 as shown in SEQ ID NO.2, and a reverse primer as shown in SEQ ID NO.3.

[0016] The sequence shown in SEQ ID NO.1 is: GCGAGTATACATGGATGCCACG;

[0017] The sequence shown in SEQ ID NO.2 is: GCGAGTATACATGGATGCCACA;

[0018] The sequence shown in SEQ ID NO.3 is:

[0019] CGTTAGCTTCATAACCGAAATACTTAATTG.

[0020] In a preferred embodiment of the present invention, the 5' end of forward primer 1 is also connected to excitation fluorescent group 1 or excitation fluorescent label sequence 1; the 5' end of forward primer 2 is also connected to excitation fluorescent group 2 or excitation fluorescent label sequence 2; and the excitation fluorescent group 1 and the excitation fluorescent group 2 are different, and the excitation fluorescent label sequence 1 and the excitation fluorescent label sequence 2 are different.

[0021] After the 5' end of forward primer 1 or forward primer 2 is connected to the excitation fluorescent label sequence, it is convenient for the probe with fluorescent group in the reaction system to bind to the amplification template in the second round of PCR (that is, the PCR process after the first round of touchdown PCR). At this time, the originally complementary probes are separated from each other and then generate fluorescent signals. Finally, SNP typing is performed by reading the fluorescent signal at the mid-end point at a temperature below 40 degrees.

[0022] For accurate typing, the excitation fluorescent group 1 and the excitation fluorescent group 2 are set to be different, and the excitation fluorescent label sequence 1 is different from the excitation fluorescent label sequence 2. Those skilled in the art can select a suitable excitation fluorescent group or excitation fluorescent label sequence according to the needs of the detection.

[0023] In a preferred embodiment of the present invention, the excitation fluorescent group 1 is selected from any one of FAM, HEX, TET, VIC, JOE, Cy3, Cy3.5, NED, TAMRA, ROX, Texas Red, Cy5, Cy5.5 and Quasar670, and the excitation fluorescent group 2 is selected from any one of FAM, HEX, TET, VIC, JOE, Cy3, Cy3.5, NED, TAMRA, ROX, Texas Red, Cy5, Cy5.5 and Quasar670.

[0024] In an optional embodiment, the excitation fluorescence label sequence 1 is selected from any one of the fluorescence label sequences of FAM, HEX, TET, VIC, JOE, Cy3, Cy3.5, NED, TAMRA, ROX, Texas Red, Cy5, Cy5.5 and Quasar670.

[0025] The excitation fluorescent label sequence 2 is selected from any one of the fluorescent label sequences of FAM, HEX, TET, VIC, JOE, Cy3, Cy3.5, NED, TAMRA, ROX, Texas Red, Cy5, Cy5.5 and Quasar670.

[0026] In an optional embodiment, the sequence of the excitation fluorescence tag sequence 1 is shown as SEQ ID NO.7, and the sequence of the excitation fluorescence tag sequence 2 is shown as SEQ ID NO.8.

[0027] The sequence shown in SEQ ID NO.7 is: GAAGGTGACCAAGTTCATGCT; the sequence shown in SEQ ID NO.8 is: GAAGGTCGGAGTCAACGGATT.

[0028] In an optional embodiment, a cluster diagram is drawn according to the peak values ​​of two different fluorescences connected to forward primer 1 and forward primer 2 to determine the genotype of the sample to be tested; if the genotype of the sample to be tested is G / G or G / A, the pistil of the sweet-scented osmanthus variety is degenerated or completely aborted and does not bear fruit; if the genotype of the site is A / A, the pistil of the sweet-scented osmanthus variety develops normally and can bear fruit.

[0029] In a third aspect, the present invention provides a reagent or kit for identifying the fruit-bearing property of Osmanthus fragrans, which comprises the above-mentioned KASP molecular marker primer set.

[0030] In an optional embodiment, the reagent or kit further comprises a KASP reaction premix, wherein the KASP reaction premix comprises a reference fluorescent probe, a reference quenching probe, Taq polymerase, free nucleotides and Mg 2+ The reference fluorescent probe is complementary to the reference quenching probe, and the reference fluorescent probe includes multiple types, one of which is consistent with the excitation fluorescent label sequence 1, and one of which is consistent with the excitation fluorescent label sequence 2.

[0031] The KASP reaction premix solution may be a commercially available KASP Master Mix, such as KASP Master Mix purchased from Guangzhou Good Biotechnology Co., Ltd.

[0032] The form of the reagent includes but is not limited to solid, liquid or semi-solid.

[0033] In a fourth aspect, the present invention also provides the use of a KASP molecular marker primer set in preparing a reagent or a kit for identifying the fruit setting of sweet osmanthus.

[0034] In a fifth aspect, the present invention also provides a method for identifying the fruitfulness of sweet osmanthus, comprising the following steps:

[0035] The above KASP molecular marker primer set or the above reagent or kit is used to perform PCR amplification on the genomic DNA of the sample to be tested to obtain an amplified product; the amplified product is subjected to KASP genotyping detection, and when the KASP genotyping detection result is AA type, the osmanthus fruiting trait is identified as fruiting; when the KASP genotyping detection result is GA or GG type, the osmanthus fruiting trait is identified as 98.7% infertile. The remaining 1.3% of individual osmanthus varieties have a genotype of GA or GG at the SNP site, but are actually fruiting varieties.

[0036] In an optional embodiment, according to the difference in fluorescence signals of KASP amplification products, the fluorescence data is read and analyzed using an ABIQuantStudio 5 machine to identify the genotype of the sweet osmanthus to be tested.

[0037] The identified osmanthus genotypes include GG, AA and GA, among which GG and GA are infertile osmanthus, and AA is a fruitful osmanthus.

[0038] When the 5' end of forward primer 1 is labeled with a FAM fluorescent signal tag, and the 5' end of forward primer 2 is labeled with a HEX fluorescent signal tag, the genotyping effect diagram is obtained according to the fluorescent color classification, so as to identify the genotype of Osmanthus fragrans. A total of three genotypes can be detected, namely heterozygous GA, homozygous GG, and AA, among which the heterozygous GA is green (mixed with blue and red fluorescence), the homozygous GG is blue, and the AA is red.

[0039] Since the 5' end of forward primer 1 carries a FAM fluorescent signal label; the 5' end of forward primer 2 carries a HEX fluorescent signal label, if the detected material is a homozygous genotype, only one of the corresponding forward primers will be selected for amplification and combined with the common reverse primer during amplification (for example, the homozygous GG type can combine with F-FAM and the common reverse primer to produce blue fluorescence). Based on the difference in fluorescence, it can be distinguished whether the tested material is AA type or GG type. If the detected material is a heterozygous GA type, the two primers will combine during amplification to produce red and blue fluorescent signals (displayed in green), which are different from those of the homozygous genotype material, thereby distinguishing the heterozygous genotype.

[0040] If base G is detected at the SNP site, it is the allele type connected to the FAM fluorescent label sequence, and the fluorescent signal is displayed in blue, then the sweet-scented osmanthus to be tested is determined to be the homozygous genotype GG; if base A is detected, it is the allele type connected to the HEX fluorescent label sequence, and the fluorescent signal is displayed in red, then the sweet-scented osmanthus to be tested is determined to be the homozygous genotype AA; if bases G and A are detected at the same time, it is an intermediate type connected to the FAM fluorescent label sequence and the HEX fluorescent label sequence at the same time, and the fluorescent signal is displayed in green, then the sweet-scented osmanthus to be tested is determined to be the heterozygous genotype GA.

[0041] In a preferred embodiment of the present invention, the reaction system used for PCR amplification includes, in 10 μL, 10-100 ng of genomic DNA of the sample to be tested, 0.05-1.0 μL of KASP molecular marker primer set, 5 μL of KASP reaction premix and the balance of water; the procedure of the PCR amplification reaction is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 10-20 s, annealing at 61°C-55°C for 40s-60s, for a total of 10 cycles, with a decrease of 0.6°C in each cycle; denaturation at 95°C for 15s-20s, annealing at 55°C for 40-60s, for a total of 33-42 cycles; and fluorescence reading at 30-40°C for 30-40s.

[0042] In an optional embodiment, the molar ratio of forward primer 1, forward primer 2 and reverse primer in the KASP molecular marker primer set is 1:1:2.

[0043] In a sixth aspect, the present invention also provides the use of a KASP molecular marker primer set or the above reagent or kit in early identification of osmanthus fruit-bearing ability or osmanthus assisted breeding.

[0044] The KASP molecular marker primer set provided by the present invention can be used to select the desired sweet osmanthus varieties, and the SNP molecular marker has reliability and availability. Experiments have shown that the KASP molecular marker obtained by the present invention can be used to quickly and accurately identify the genotyping of the site of sweet osmanthus, helping to select germplasm materials with expected fruitfulness.

[0045] The present invention has the following beneficial effects:

[0046] 1) The present invention provides a significant locus related to the fruit-setting trait of sweet osmanthus, which is located at the 6301644bp base of chromosome 3. A primer combination for KASP detection is designed through a single base difference in the molecular marker, which can be directly used for the identification of sweet osmanthus fruit-setting ability and corresponding genotype, and then the molecular marker is relied on for auxiliary breeding to accelerate breeding efficiency.

[0047] 2) This marker can be used to predict the fruiting situation in the reproductive period in advance during the seedling stage of Osmanthus fragrans, quickly screen out target plants, and improve the efficiency and accuracy of selecting plants with different fertility in the industry.

[0048] 3) The present invention has important significance in the theoretical research of osmanthus variety classification and male-dioecious breeding system. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0050] Figure 1 This is a schematic diagram of the development of pistils during the flowering period of Osmanthus fragrans. a: Fruit-bearing Osmanthus fragrans (bisexual flowers); b: Normally developed pistils of bisexual flowers; c: Fruit-incapable Osmanthus fragrans (male flowers); d: Degenerate pistils of male flowers;

[0051] Figure 2 This is the Manhattan diagram of the GWAS analysis of sweet osmanthus fruit setting traits in Example 1;

[0052] Figure 3 This is a schematic diagram of the sequence alignment results of the gene where the target SNP is located and LOC111403321 in Example 1;

[0053] Figure 4This is a schematic diagram of the KASP genotyping results in Example 2. DETAILED DESCRIPTION

[0054] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0055] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art to which the present disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used for the practice or testing of the preparations or unit doses herein, some methods and materials are now described. Unless otherwise stated, the techniques adopted or considered herein are standard methods. Materials, methods and examples are illustrative and non-restrictive only.

[0056] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of plant physiology, plant molecular genetics, cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry, and immunology, which are within the capabilities of a skilled artisan. This technique is fully explained in the literature, such as Molecular Cloning: A Laboratory Manual, 2nd Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, ed., 1984); Plant Physiology (Cang Jing et al., 2017); Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.); Current Protocols in Molecular Biology (FM Ausubel et al., eds., 1987); Plant Molecular Genetics (Monica A. Hughes et al.); PCR: The Polymerase Chain Reaction (Mullis et al., 1994), each of which is expressly incorporated herein by reference.

[0057] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0058] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0059] Example 1

[0060] This example develops SNP loci associated with sweet osmanthus fruit set.

[0061] In the early stage, a comprehensive survey of the germplasm resources in the main osmanthus producing areas was conducted. A total of 123 germplasms were collected for genome resequencing, and the fruiting conditions of 92 of them were determined. Based on the general linear model (GLM) in TASSEL software, the genome data was analyzed for genome-wide association with the fruiting characteristics of osmanthus fragrans. A SNP ( Figure 2 ), which is a GWAS graph obtained by using the TASSEL software calculation method.

[0062] The physical location of the target SNP site was determined based on the comparison of the standard sequence PRJNA529305 of the whole genome of Osmanthus fragrans, specifically the 6301644th base of chromosome 3, which has a G / A polymorphism. The sequence comparison result of the gene where the target SNP is located and LOC111403321 is shown in the figure. Figure 3 shown.

[0063] Example 2

[0064] This embodiment provides a KASP molecular marker primer set for identifying the fruit-bearing property of Osmanthus fragrans.

[0065] According to the SNP site obtained in Example 1, the upstream 100bp sequence (SEQ ID NO.5) and the downstream 100bp sequence (SEQ ID NO.6) of the SNP at the 6,301,644bp position on chromosome 3 of the Osmanthus fragrans reference genome (PRJNA529305) were searched, and the LGC company was given a unique set of KASP marker primers designed, consisting of two forward primers and one reverse primer. The primer nucleotide sequences are shown in Table 1, wherein the forward primer 1 is added with a FAM fluorescent signal label to specifically recognize the G base; the forward primer 2 is added with a HEX fluorescent signal label to specifically recognize the A base. The primer combination can specifically bind to the corresponding sequences upstream and downstream of the SNP site.

[0066] Table 1 KASP-Primer primer sequence

[0067]

[0068] Example 3

[0069] This example verifies the KASP molecular marker.

[0070] The accuracy of KASP marker detection was verified using 92 osmanthus varieties with different pistil development and fruiting ability. Among them, 15 varieties could bear fruit, and 77 varieties could not (as shown in Table 2).

[0071] Extract genomic DNA from all samples to be tested. Grind all collected samples into powder and add lysis solution (0.04g PVP powder, 5μL β-ME, 1mL CTAB), place in a 65℃ water bath for 1h, add an equal volume of chloroform-isoamyl alcohol (volume ratio of 24:1) in a fume hood, centrifuge at 12000 rpm for 10min at room temperature, pipette the upper aqueous phase in the tube, add an equal volume of isopropanol (precooled at -20℃) to the extracted aqueous phase, mix well and precipitate at -20℃ overnight. Centrifuge at 12000 rpm and 4℃ for 15min, and remove the supernatant. Wash the precipitate with 700μL 70% ethanol, centrifuge at 12000 rpm for 5min, remove the supernatant, and repeat. Wash the precipitate with 700μL anhydrous ethanol, centrifuge at 12000 rpm for 5min, and remove the supernatant. After drying, use 50 μL TE buffer to completely dissolve the DNA, and use a DNA concentration detector and gel imaging instrument to detect the DNA concentration and quality.

[0072] KASP primer genotype detection was performed using the KASP molecular marker primer set provided in Example 2. A 10 μL PCR reaction system was used, including 5 μL KASP Master mixture (KASP premix, purchased from Guangzhou Good Biotechnology Co., Ltd.), 0.09 μL KASP Primer mix (Primer_Allele FAM, Primer_Allele HEX, Primer_Common, the mixing molar ratio of the three primers was 1:1:2) and 4.91 μL DNA (100 ng / μL), and PCR analysis was performed according to the instructions of a real-time fluorescence quantitative PCR instrument (ABIQuant Studio 5).

[0073] The PCR reaction program was as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s; annealing and extension at 55°C-61°C for 60 s, 10 cycles (0.6°C reduction per cycle); denaturation at 95°C for 15 s, annealing and extension at 55°C for 60 s, for a total of 36 cycles.

[0074] KASP genotyping results Figure 4 As shown in Figure 2, three genotypes were detected, namely GG, GA and AA. Figure 4 It can be seen that the genotype is determined by detecting two fluorescence intensities in the KASP product. Each dot in the figure represents a material to be tested. All materials are divided into blue, green and red areas, where blue dots represent homozygous genotype GG, red dots represent homozygous genotype AA, and green dots represent heterozygous genotype GA. The test results show that there are 16 GG genotype varieties, 62 GA genotype varieties, and 14 GG genotype varieties in the tested materials. The statistical summary results of genotype and sweet osmanthus fruiting are shown in Table 2.

[0075] Table 2 Names, genotypes, fruiting conditions and fluorescence signal values ​​of Osmanthus fragrans varieties used to detect KASP markers

[0076]

[0077]

[0078]

[0079] The KASP genotyping results of 92 osmanthus varieties were compared with the corresponding fruit setting conditions to determine the identification accuracy of KASP molecular markers. The accuracy rate refers to the number of consistent genotyping results and fruit setting conditions divided by 92.

[0080] As shown in Table 2, when the detected genotype of the SNP site was AA, 100% were fruit-bearing varieties; when the detected genotype was GG or GA, 98.72% were non-fruit-bearing varieties.

[0081] Therefore, by using the KASP molecular marker primer set to perform KASP molecular marker typing, it is possible to accurately predict whether the sweet osmanthus is a male plant or a hermaphroditic plant. The present invention provides a reliable basis for the prediction and selection of the fruit-bearing ability of sweet osmanthus in the same period, and also lays a foundation for the development of molecular assisted breeding technology of sweet osmanthus.

[0082] Example 4

[0083] Compared with Example 2, the difference is that the excitation fluorescence tag sequence at the 5' end of forward primer 1 is GAAGGTGACCAAGTTCATGCT (VIC), and the excitation fluorescence tag sequence at the 5' end of forward primer 2 is CGCCAGGGTTTTCCCAGTCACGAC (ROX).

[0084] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A KASP molecular marker primer set for identifying the fruitfulness of Osmanthus fragrans, characterized in that: It includes: The forward primer 1 is shown as SEQ ID NO.1, the forward primer 2 is shown as SEQ ID NO.2 and the reverse primer is shown as SEQ ID NO.

3.

2. The KASP molecular marker primer set according to claim 1, characterized in that: The 5' end of the forward primer 1 is also connected to an excitation fluorescent group 1 or an excitation fluorescent label sequence 1; the 5' end of the forward primer 2 is also connected to an excitation fluorescent group 2 or an excitation fluorescent label sequence 2; and the excitation fluorescent group 1 and the excitation fluorescent group 2 are different, and the excitation fluorescent label sequence 1 and the excitation fluorescent label sequence 2 are different.

3. The KASP molecular marker primer set according to claim 2, characterized in that: The excitation fluorescent group 1 is selected from any one of FAM, HEX, TET, VIC, JOE, Cy3, Cy3.5, NED, TAMRA, ROX, Texas Red, Cy5, Cy5.5 and Quasar670, and the excitation fluorescent group 2 is selected from any one of FAM, HEX, TET, VIC, JOE, Cy3, Cy3.5, NED, TAMRA, ROX, Texas Red, Cy5, Cy5.5 and Quasar670.

4. The KASP molecular marker primer set according to claim 2, characterized in that: The excitation fluorescent label sequence 1 is selected from any one of FAM, HEX, TET, VIC, JOE, Cy3, Cy3.5, NED, TAMRA, ROX, Texas Red, Cy5, Cy5.5 and Quasar670; The excitation fluorescence label sequence 2 is selected from any one of FAM, HEX, TET, VIC, JOE, Cy3, Cy3.5, NED, TAMRA, ROX, Texas Red, Cy5, Cy5.5 and Quasar670.

5. The KASP molecular marker primer set according to claim 4, characterized in that: The sequence of the excitation fluorescence label sequence 1 is shown as SEQ ID NO.7, and the sequence of the excitation fluorescence label sequence 2 is shown as SEQ ID NO.

8.

6. A reagent or kit for identifying the fruitfulness of osmanthus fragrans, characterized in that: It comprises the KASP molecular marker primer set according to any one of claims 1 to 5.

7. The reagent or kit for identifying the fruitfulness of sweet osmanthus according to claim 6, characterized in that: The reagent or kit also includes a KASP reaction premix, which includes a reference fluorescent probe, a reference quenching probe, Taq polymerase, free nucleotides and Mg 2+ The reference fluorescent probe is complementary to the reference quenching probe, and the reference fluorescent probe includes multiple types, one of which is consistent with the excitation fluorescent label sequence 1, and one of which is consistent with the excitation fluorescent label sequence 2.

8. Use of the KASP molecular marker primer set according to any one of claims 1 to 5 in preparing a reagent or a kit for identifying the fruitfulness of Osmanthus fragrans.

9. A method for identifying the fruitfulness of osmanthus fragrans, characterized in that: It includes the following steps: The genomic DNA of the sample to be tested is amplified by PCR using the KASP molecular marker primer set described in any one of claims 1 to 5 or the reagent or kit described in any one of claims 6 to 7 to obtain an amplified product; the amplified product is subjected to KASP genotyping detection, and when the KASP genotyping detection result is AA type, the fruit-bearing trait of the sweet osmanthus is identified as fruit-bearing; when the KASP genotyping detection result is GA or GG type, the fruit-bearing trait of the sweet osmanthus is identified as 98.7% non-fruit-bearing.

10. The method according to claim 9, characterized in that The reaction system used for the PCR amplification includes, in 10 μL, 10-100 ng of genomic DNA of the sample to be tested, 0.05-1.0 μL of KASP molecular marker primer set, 5 μL of KASP reaction premix and the balance of water; the procedure of the PCR amplification reaction is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 10-20 s, annealing at 61°C-55°C for 40s-60s, for a total of 10 cycles, with a decrease of 0.6°C in each cycle; denaturation at 95°C for 15s-20s, annealing at 55°C for 40-60s, for a total of 33-42 cycles; and fluorescence reading at 30-40°C for 30-40s.

11. The method according to claim 10, characterized in that The molar ratio of the forward primer 1, the forward primer 2 and the reverse primer in the KASP molecular marker primer set is 1:1:

2.

12. Use of the KASP molecular marker primer set according to any one of claims 1 to 5 or the reagent or kit according to any one of claims 6 to 7 in early identification of sweet osmanthus fruit-bearing ability or sweet osmanthus fruit-bearing auxiliary breeding.

Images