Isolation of isoflavones from isoflavone-producing plants

Abstract

The application discloses a kind of isinglass material breeding method with isinglass genetic material, and relates to the field of innovation, breeding technique of isinglass germplasm resource.The method is created through cytoplasmic male sterile line isinglass and distant hybridization between isinglass, through sexual hybridization, selfing, purification, directional breeding and other means, and the isinglass genetic gene of isinglass new material is created, the hybrid vigor of isinglass is effectively utilized, the genetic basis of isinglass breeding is widened, and the quality of isinglass vegetable is further improved, and it has important significance for understanding isinglass homology of medicine and food material basis and quality control.

Description

Technical Field

[0001] This invention relates to the field of vegetable breeding technology, and more specifically, to a method for breeding vegetable materials with Isatis indigotica genetic material. Background Technology

[0002] Chinese cabbage, also known as non-heading cabbage or rapeseed (Brassica napus L.), is a plant belonging to the Brassicaceae family and the Brassica genus. It is an annual or biennial herb with a taproot system and an erect, dark green stem resembling that of a cabbage. Chinese cabbage is a low-fat vegetable with a crisp and tender texture, containing various nutrients, rich in vitamin C and dietary fiber, making it highly nutritious and delicious. While Chinese cabbage has abundant germplasm resources and diverse ecological types, research on its breeding and selection is relatively lagging. Inconsistent yields and quality among different germplasms, coupled with a chaotic distribution of germplasm resources in production, result in unstable quality and yields in the market, hindering the improvement and development of edible quality and planting efficiency.

[0003] Isatis indigotica Fortune, a biennial herb belonging to the Brassicaceae family and the Isatis genus, is the dried root of which is known as Banlangen, usually referring to Northern Isatis indigotica. It has the effects of clearing heat and detoxifying, cooling blood and eliminating spots, and relieving sore throat and pain. However, it has a bitter taste and unpleasant mouthfeel.

[0004] Currently, the research team at Huazhong Agricultural University has created new rapeseed materials carrying different chromosomes from woad (Isatis tinctoria). They have also introduced genes related to the G monomer addition line, an antiviral active ingredient from woad, into rapeseed, resulting in new hybrid varieties with broad-spectrum antiviral effects, including resistance to COVID-19, anti-inflammation, and immunomodulation. Since bok choy relies on seed propagation, creating hybrid varieties and utilizing their hybrid vigor is a highly effective breeding method to improve the quality and economic benefits of bok choy cultivation.

[0005] Chinese cabbage and woad belong to different genera of the Brassicaceae family, and their hybrid vigor is more obvious. Although distant hybridization is difficult, hybrid varieties can be obtained through effective methods.

[0006] In view of this, the present invention is proposed. Summary of the Invention

[0007] The purpose of this invention is to provide a method for breeding Chinese cabbage materials containing Isatis indigotica genetic material, thereby creating Chinese cabbage with Isatis indigotica genes through sexual hybridization, self-pollination, and other means. The method provided by this invention broadens the research on the genetic basis of Chinese cabbage breeding, which is beneficial to further improving the quality of this important vegetable. It is also of great significance for understanding the medicinal and edible homology of Chinese cabbage and its quality control.

[0008] This invention is implemented as follows:

[0009] In a first aspect, the present invention provides a method for breeding Chinese cabbage materials with Isatis indigotica genetic material, which includes the following steps:

[0010] Using a cytoplasmic male sterile line of Chinese cabbage as the female parent and isatis tinctoria as the male parent, F1 generation seeds were produced by hybridization. Based on the F1 generation seeds and seedlings, botanical differences from the cytoplasmic male sterile line of Chinese cabbage were obtained for use in screening true hybrids.

[0011] Using the maintainer line corresponding to the cytoplasmic male sterile line of Chinese cabbage corresponding to the F1 generation sterile seeds as the female parent and Isatis indigotica as the male parent, bud-stage hybridization was carried out to produce F1 generation fertile seeds; true hybrids were screened from the F1 generation fertile seeds.

[0012] In the breeding process, this method helps to initially eliminate self-pollinated plants of Chinese cabbage by screening F1 generation sterile seeds with excellent botanical traits, reducing the workload of breeding and significantly improving the work results. It also allows for early prediction of the combining ability of cytoplasmic male sterile lines of Chinese cabbage and prevents self-pollination depression of maintainer lines.

[0013] This method effectively utilizes the heterosis of Chinese cabbage to create new hybrid varieties of Chinese cabbage, which is of great significance for understanding the material basis of Chinese cabbage as both food and medicine and for quality control.

[0014] In one implementation, in order to more efficiently and quickly screen true hybrids from botanical traits, F1 generation sterile seeds and seedlings are observed, and differences in botanical traits from the cytoplasmic male sterile line of Chinese cabbage are marked for use in screening true hybrids.

[0015] In a preferred embodiment of the present invention, superior botanical traits refer to at least one of the following: high fruit set rate, high seed purity, and high uniformity. The maintainer line is obtained through screening using the following method:

[0016] Using a cytoplasmic male-sterile line of Chinese cabbage as the female parent, several fertile Chinese cabbage varieties from the line intended to be used as one of the parents are selected and crossed in pairs. The combination with a sterility rate of 100% or close to 100% in the F1 generation is selected; its female parent is the sterile line, and its male parent is the corresponding maintainer line. The maintainer line is then self-crossed and used as a recurrent parent to backcross with the sterile line until the maintainer line (temporary male parent) exhibits traits identical to the cytoplasmic male-sterile line of Chinese cabbage. At this point, the temporary male parent can also be called the maintainer line of the cytoplasmic male-sterile line.

[0017] In a preferred embodiment of the present invention, a combination in which the F1 sterility rate reaches 100% is preferred.

[0018] In a preferred embodiment of the present invention, the above-mentioned breeding method specifically includes: firstly, using a cytoplasmic male-sterile line of Chinese cabbage to cross with Isatis indigotica, screening for materials that can be crossbred with Isatis indigotica to obtain hybrid seeds; using a cytoplasmic male-sterile line of Chinese cabbage to cross with Isatis indigotica to obtain the botanical traits of true hybrids and seedlings, so that the corresponding maintainer line can be crossbred with Isatis indigotica to screen out true hybrids from a large number of self-pollinated varieties; using the maintainer line of the cytoplasmic male-sterile line of Chinese cabbage corresponding to the F1 generation seeds with excellent botanical traits as the female parent and Isatis indigotica as the male parent, harvesting only the seeds from Chinese cabbage; firstly, hybridizing and then separating and purifying, with the separation and purification time being synchronized to perform self-pollination on the true hybrids.

[0019] After self-pollinating the true hybrids, vegetable materials with Isatis indigotica genetic material were identified through field observation and molecular marker screening.

[0020] In a preferred embodiment of the present invention, the time for self-pollination of true hybrids to obtain various isolated materials and further screening out vegetable materials with Isatis indigotica genetic material is 5-6 years (i.e., the time for isolation and purification).

[0021] In a preferred embodiment of the present invention, the method for screening true hybrids from fertile F1 generation seeds includes at least one of the following breeding methods:

[0022] (1) Screening of fertile F1 generation seeds based on seed morphology;

[0023] (2) Screening was conducted based on the agronomic traits of F1 generation fertile seedlings;

[0024] (3) Screening based on the chromosome karyotype of fertile F1 generation materials;

[0025] (4) Molecular marker screening of F1 fertile materials was performed using Isatis indigotica characteristic primers;

[0026] (5) Screening was performed based on the HPLC fingerprint of fertile F1 seeds and their plants.

[0027] F1 fertile material refers to F1 fertile seeds and / or seedlings produced after sowing F1 fertile seeds.

[0028] In a preferred embodiment of the present invention, the seed morphology is selected from at least one of the following seed morphologies:

[0029] Seed size, shape, and color.

[0030] In a preferred embodiment of the present invention, fertile F1 generation seeds with a more square and granular shape compared to cabbage seeds are selected.

[0031] In a preferred embodiment of the present invention, molecular marker screening of F1 fertile materials using Isatis indigotica characteristic primers refers to: amplifying F1 fertile seeds and / or their plants using SSR molecular marker primers, and detecting whether they simultaneously exhibit differential bands from Isatis indigotica and Chinese cabbage. Detection methods include, but are not limited to, polyacrylamide gel electrophoresis.

[0032] The HPLC fingerprint was constructed from SSR molecular markers that distinguish between Isatis tinctoria and Chinese cabbage, or SNP markers from Chinese cabbage germplasm that are characteristic of Isatis tinctoria.

[0033] In a preferred embodiment of the present invention, screening is performed based on at least one of the following agronomic traits of the fertile F1 seed progeny: leaf trait, plant type, plant height, number of tillers on flowering branches, and petiole shape.

[0034] In one alternative embodiment, the leaf characteristics are selected from at least one of leaf shape, leaf color, petiole, leaf area, leaf thickness, leaf length, wax powder, and leaf width.

[0035] In one embodiment, fertile F1 generation seed progeny with leaf shape similar to woad and leaf color between bok choy and woad are selected. In another embodiment, fertile F1 generation seed progeny with petioles similar to bok choy are selected.

[0036] Those skilled in the art can screen based on the presence or absence of wax powder.

[0037] The present invention has the following beneficial effects:

[0038] In the breeding process, this invention helps to initially eliminate seeds with poor botanical traits by screening F1 generation sterile seeds with excellent botanical traits, reducing the workload of breeding, significantly improving the work efficiency, and predicting the combining ability of cytoplasmic male sterile lines of Chinese cabbage in the early stage, thus preventing self-pollination depression of maintainer lines.

[0039] This method involves distant hybridization between a cytoplasmic male-sterile line of Chinese cabbage and the genus Isatis, followed by sexual hybridization and self-pollination to create a new hybrid Chinese cabbage variety with Isatis genetic material. This effectively utilizes the heterosis of Chinese cabbage, broadens the research on the genetic basis of Chinese cabbage breeding, and is conducive to further improving the quality of this important vegetable. It is also of great significance for understanding the material basis of Chinese cabbage as both food and medicine and for quality control. Attached Figure Description

[0040] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0041] Figure 1 Images showing the morphological results of seeds of Chinese cabbage, woad, and their offspring;

[0042] Figure 2 Images showing the morphological observation results of leaves of Chinese cabbage, woad and their offspring;

[0043] Figure 3 The image shows the polyacrylamide gel electrophoresis results of the F1 generation true hybrids.

[0044] Figure 4 A field demonstration of a hybrid of woad and bok choy;

[0045] Figure 5 This is a technology roadmap. Detailed Implementation

[0046] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0047] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0048] Example 1

[0049] This embodiment provides a method for breeding Chinese cabbage materials with Isatis indigotica genetic material, and the technical roadmap is as follows: Figure 5 As shown, it includes the following steps:

[0050] (1) Using the cytoplasmic male sterile line of Chinese cabbage 01-3 (i.e. Jinsong 6) as the female parent and Isatis indigotica s-6 (i.e. Banlangen) as the male parent, distant hybridization was carried out to obtain F1 generation sterile seeds. The F1 seeds and plants were subjected to botanical morphological identification and trait evaluation, and DNA-level molecular identification was also performed.

[0051] (2) Preparation of maintainer lines for cytoplasmic male sterile line materials of Chinese cabbage.

[0052] Using a cytoplasmic male-sterile line of *Boletus edulis* as the female parent, several fertile *Boletus edulis* varieties selected as one of the parents were paired and crossed. The combination with a 100% sterility rate in the F1 generation was selected, with the female parent being the sterile line and the male parent being the corresponding maintainer line. The maintainer line was then self-crossed and backcrossed with the sterile line as a recurrent parent, repeated five times until the maintainer line exhibited traits identical to the *Boletus edulis* cytoplasmic male-sterile line.

[0053] (3) Using the inbred line s-6 of Isatis indigotica as the male parent, it was hybridized with the maintainer line B-01-3 of the cytoplasmic male sterile line material 01-3 of Chinese cabbage (i.e., Jinsong 9), and the fertile F1 generation seeds were identified and screened.

[0054] In this embodiment, 10-mesh and 18-mesh sieves were used to screen seeds, and seeds that were more square and granular than those of leafy greens were selected as materials for further breeding. Results are referenced below. Figure 1 As shown, morphological observations of seeds of Chinese cabbage, woad and their offspring showed that the F1 generation combined the traits of the parents.

[0055] (4) Plant the selected F1 generation fertile seeds and further identify, identify and screen the plants.

[0056] Leaf morphological observation results refer to Figure 2 As shown, the F1 generation of fertile seed offspring has leaves similar in shape to woad, with a leaf color between that of bok choy and woad. The petioles are similar to those of bok choy.

[0057] DNA molecular marker analysis was performed on the selected plants to verify the identification of true hybrids.

[0058] Specifically, SSR marker primers were used to amplify the DNA from Isatis indigotica seed source by PCR, and the results were detected by polyacrylamide gel electrophoresis. The differential bands were statistically analyzed.

[0059] SSR-labeled primers and amplification system, and the amplification procedure are as follows:

[0060] Isatis centromere primer amplification system: 10× buffer 1μl, MgCl2 0.8μl, Taq enzyme 0.3μl, dNTP 0.2μl, Cen1F / Ce 0.5μl / 0.5μl, DNA 2μl, ddH2O 4.9μl, total 10μl.

[0061] The primers CEN1R (5′→3′: AGAGCACTTTAATGTGTACCT) and CEN1F (5′→3′: Creation and cytological analysis of Brassica napus-Isatis oleracea disomic addition line CATGCTTCGCGTTCTATCTTT) were existing primers in the laboratory. The amplification program was: 94℃ for 5 min, 35 cycles (94℃ for 30 s, 54℃ for 30 s, 72℃ for 45 s), and extension at 72℃ for 10 min.

[0062] SSR amplification system: 10× buffer 1μl, MgCl2 0.8μl, Taq enzyme 0.2μl, dNTP 0.1μl, PF / PR 1μl, DNA 2μl, ddH2O 4.9μl, total 10μl.

[0063] The SSR markers were designed by Huang Luqi's team at the Chinese Academy of Traditional Chinese Medicine based on the genomic DNA sequence of Isatis indigotica, and some specific SSR primers were selected in conjunction with previous laboratory research. SSR14 primer information: forward primer (5'-3'): TCTCGACCGATATTCAACCTCATAA, reverse primer (5'-3'): GGATCTACCGCCATTGA TAAAGGT.

[0064] The amplification program was as follows: 94℃ for 5 min, 1 cycle; 94℃ for 30 s, 55~60℃ for 30 s (10 cycles, with the annealing temperature decreasing by 0.7℃ per cycle), 72℃ for 45 s, 30 cycles; extension at 72℃ for 10 min.

[0065] Results reference Figure 3 As shown, Figure 3 The data shows that specific bands from both Isatis tinctoria and Chinese cabbage germplasm were observed in the F1 generation from 6 to 24, indicating that some markers detected recombination between the Isatis tinctoria genome fragment and the Chinese cabbage genome, confirming that the F1 generation is a true hybrid. M: Marker; B: Chinese cabbage; S: Isatis tinctoria; 1-24: F1 generation hybrids.

[0066] (5) After self-pollination, the true hybrids obtained in (3) were separated to obtain different generations. Seed identification, plant identification and molecular marker identification were performed on the seeds of each generation. At the same time, the target traits were separated, purified and bred to obtain a Chinese cabbage with the characteristics of woad.

[0067] Field conditions of hybridization between woad and bok choy (refer to...) Figure 4 As shown, the plants are: Isatis tinctoria (small plant on the left), multiple cytoplasmic male sterile lines of Chinese cabbage in the middle, and tall plants on the right, which are Chinese cabbage plants with Isatis tinctoria characteristics grown from F1 seeds.

[0068] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A method for breeding Chinese cabbage materials with Isatis indigotica genetic material, characterized in that, It includes the following steps: Using a cytoplasmic male sterile line of Chinese cabbage as the female parent and isatis tinctoria as the male parent, F1 generation seeds were produced by hybridization. Based on the F1 generation seeds and seedlings, botanical differences from the cytoplasmic male sterile line of Chinese cabbage were obtained for use in screening true hybrids. Using the maintainer line of the aforementioned cytoplasmic male sterile line of Chinese cabbage corresponding to the F1 generation seeds with excellent botanical traits as the female parent and Isatis indigotica as the male parent, bud-stage hybridization was carried out to produce fertile F1 generation seeds; true hybrids were screened from the fertile F1 generation seeds. The retention system was obtained through screening using the following method: Using a cytoplasmic male sterile line of Chinese cabbage as the female parent, several inbred lines of Chinese cabbage selected as one of the parents were used as temporary male parents and crossed with the female parent in pairs. The combination in which the sterility rate of F1 plants reached 100% was selected. The female parent was the sterile line and the male parent was the corresponding maintainer line. Then the maintainer line was self-crossed and backcrossed with the sterile line as the recurrent parent until the traits of the Chinese cabbage cytoplasmic male sterile line were consistent with the temporary male parent.

2. The method for breeding Chinese cabbage materials with Isatis indigotica genetic material according to claim 1, characterized in that, The breeding method includes: first, using a cytoplasmic male sterile line of Chinese cabbage to cross with Isatis indigotica, screening for materials that produce hybrid seeds through crossbreeding with Isatis indigotica; using a cytoplasmic male sterile line of Chinese cabbage to cross with Isatis indigotica to obtain true hybrids and seedlings with botanical traits; using the maintainer line of the cytoplasmic male sterile line of Chinese cabbage corresponding to the F1 generation seeds with superior botanical traits as the female parent and Isatis indigotica as the male parent, harvesting only the seeds from Chinese cabbage; first, hybridizing and then separating and purifying, with the separation and purification occurring simultaneously, and then performing self-pollination on the true hybrids.

3. The method for breeding Chinese cabbage materials with Isatis indigotica genetic material according to claim 2, characterized in that, After self-pollination of the true hybrids, vegetable materials with Isatis indigotica genetic material were identified through field observation and molecular marker screening.

4. The method for breeding Chinese cabbage materials with Isatis indigotica genetic material according to claim 1, characterized in that, Methods for selecting true hybrids from fertile F1 generation seeds include at least one of the following breeding methods: (1) Screening of fertile F1 generation seeds based on seed morphology; (2) Screening was conducted based on the agronomic traits of F1 generation fertile seedlings; (3) Screening based on the karyotype of fertile F1 generation materials; (4) Molecular marker screening of F1 fertile materials was performed using Isatis indigotica characteristic primers; (5) Screening was performed based on the HPLC fingerprint of fertile F1 seeds and their plants.

5. The method for breeding Chinese cabbage materials with Isatis indigotica genetic material according to claim 4, characterized in that, The morphology of the seed is selected from at least one of the following seed morphologies: Particle size, shape, and color.

6. The method for breeding Chinese cabbage materials with Isatis indigotica genetic material according to claim 5, characterized in that, F1 generation fertile seeds were selected that were square in shape and granular in form, compared to cabbage seeds.

7. The method for breeding Chinese cabbage materials with Isatis indigotica genetic material according to claim 4, characterized in that, The HPLC fingerprint was constructed using SSR molecular markers for distinguishing between Isatis tinctoria and Chinese cabbage, or SNP markers from Chinese cabbage germplasm that are characteristic of Isatis tinctoria.

8. The method for breeding Chinese cabbage materials with Isatis indigotica genetic material according to claim 4, characterized in that, Screening is conducted based on at least one of the following agronomic traits of F1 generation fertile seedlings: leaf trait, plant type, plant height, number of flowering branch tillers, and petiole shape.

9. The method for breeding Chinese cabbage materials with Isatis indigotica genetic material according to claim 8, characterized in that, The leaf characteristics are selected from at least one of leaf shape, leaf color, leaf area, leaf thickness, leaf length, wax powder, and leaf width.

Images