Application of REL inhibitors in the preparation of drugs for treating lung squamous cell carcinoma

Abstract

This invention belongs to the field of pharmaceutical technology and discloses the application of a REL inhibitor in the preparation of an anti-lung squamous cell carcinoma drug. This invention is the first to disclose the application of a REL inhibitor or a pharmaceutically acceptable salt thereof in the preparation of an anti-lung squamous cell carcinoma drug. This invention discovers that knocking down REL expression and / or activity can significantly inhibit the activity of lung squamous cells and reduce their proliferation and migration abilities, indicating that REL may be an important molecular target for the occurrence and development of lung squamous cell carcinoma, and may provide a new direction for the treatment of lung squamous cell carcinoma.

Description

Technical Field

[0001] This invention relates to the pharmaceutical field, and in particular to the application of a REL inhibitor in the preparation of drugs for treating squamous cell carcinoma of the lung. Background Technology

[0002] Lung cancer has the highest incidence and mortality rate among cancers, with squamous cell carcinoma of the lung accounting for approximately 25% to 30% of all lung cancers. Among related technologies, due to the lack of targeted therapy options, the treatment of squamous cell carcinoma of the lung mainly relies on surgery, chemotherapy, and immunotherapy, with a 5-year survival rate of less than 20%. Therefore, targeted therapy options for squamous cell carcinoma of the lung are urgently needed. This requires strengthening research into the molecular mechanisms of squamous cell carcinoma development, discovering new oncogenes, and thus developing new targets.

[0003] REL is a human gene that encodes the Rel protein. It is a member of the NF-κB (nuclear factor-κB) family of transcription factors and is also a signal transduction molecule. Related studies have shown that it plays an important role in a variety of biological processes, including cell proliferation, cell differentiation and apoptosis. In addition, the REL-encoded protein can also act as a transcription factor to regulate the transcriptional activity of multiple genes.

[0004] Given that squamous cell carcinoma of the lung is a complex tumor type involving the regulation of multiple signaling pathways and molecular mechanisms, and that research on the role of REL in squamous cell carcinoma of the lung has not yet been reported, further in-depth research and validation are needed. Summary of the Invention

[0005] This invention aims to at least solve one of the technical problems existing in the prior art. To this end, this invention proposes the use of a REL inhibitor or a pharmaceutically acceptable salt thereof in the preparation of an anti-lung squamous cell carcinoma drug, wherein the REL inhibitor can significantly reduce the migration ability, proliferation ability and cell activity of lung squamous cells.

[0006] This invention provides the use of a REL inhibitor or a pharmaceutically acceptable salt thereof in the preparation of an anti-lung squamous cell carcinoma drug.

[0007] According to the application of the embodiments of the present invention, at least the following beneficial effects are achieved: The present invention has found that REL inhibitors can significantly reduce the migration ability, proliferation ability and cell activity of lung squamous cells, and have a good promoting effect on improving the anti-lung squamous cell carcinoma effect.

[0008] In some embodiments of the present invention, the REL inhibitor includes agents that inhibit REL expression and / or reduce REL activity.

[0009] In some embodiments of the present invention, the REL inhibitor includes one of IT-603 and IT-901; preferably, the REL inhibitor is IT-603.

[0010] In some embodiments of the present invention, the REL inhibitor includes at least one of REL-targeting interfering RNA, REL-targeting antisense oligonucleotide, REL-targeting CRISPR, REL-targeting TALEN, and REL-targeting zinc finger nuclease.

[0011] In some embodiments of the present invention, the interfering RNA targeting REL includes dsRNA, siRNA, and shRNA targeting REL.

[0012] In some embodiments of the present invention, the shRNA targeting REL (Gene ID: 5966) includes shRNA with a nucleotide sequence as shown in SEQ ID NO. 3; and / or shRNA with a nucleotide sequence as shown in SEQ ID NO. 4.

[0013] In some embodiments of the present invention, the use of the anti-squamous cell carcinoma drug includes at least one of A) to C):

[0014] A) Reduces the activity of lung squamous cells;

[0015] B) Inhibits the proliferation of lung squamous cells;

[0016] C) Inhibits the migration ability of lung squamous cells.

[0017] In some embodiments of the present invention, the anti-squamous cell carcinoma drug further comprises pharmaceutically acceptable excipients.

[0018] In some embodiments of the present invention, the pharmaceutically acceptable excipients include at least one of diluents, excipients, fillers, binders, disintegrants, absorption enhancers, surfactants, adsorbents, lubricants, sweeteners, and flavorings.

[0019] According to some embodiments of the present invention, the excipient comprises water.

[0020] According to some embodiments of the present invention, the filler includes at least one of starch and sucrose.

[0021] According to some embodiments of the present invention, the adhesive comprises at least one of cellulose derivatives, alginate, gelatin, and polyvinylpyrrolidone.

[0022] According to some embodiments of the present invention, the wetting agent includes glycerin.

[0023] According to some embodiments of the present invention, the disintegrant includes at least one of agar, calcium carbonate, and sodium bicarbonate.

[0024] According to some embodiments of the present invention, the absorption enhancer comprises a quaternary ammonium compound.

[0025] According to some embodiments of the present invention, the surfactant comprises hexadecyl alcohol.

[0026] According to some embodiments of the present invention, the adsorbent carrier includes at least one of kaolin and soap clay.

[0027] According to some embodiments of the present invention, the lubricant includes at least one selected from talc, calcium stearate, magnesium stearate, and polyethylene glycol.

[0028] In some embodiments of the present invention, the dosage form of the anti-squamous cell lung cancer drug is at least one of solid dosage form, liquid dosage form and semi-solid dosage form.

[0029] In some embodiments of the present invention, the solid dosage form includes tablets, granules, powders, and capsules;

[0030] And / or, the liquid formulation includes an injectable formulation;

[0031] And / or, the semi-solid formulation includes ointments and creams.

[0032] Other features and advantages of the invention will be set forth in the description which follows, and will be apparent in part from the description, or may be learned by practicing the invention. Attached Figure Description

[0033] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0034] Figure 1 This is a statistical chart showing the expression of REL in normal tissues and lung squamous cell carcinoma tissues according to the present invention.

[0035] Figure 2 The map of the shREL lentivirus vector constructed in this invention.

[0036] Figure 3 This is a statistical diagram showing the expression of knocked-down REL in H1703 and SK-MES-1 cells in this invention.

[0037] Figure 4 This is a comparison of cell migration ability in H1703 cells before and after REL knockdown in this invention.

[0038] Figure 5 This is a comparison of cell migration ability in SK-MES-1 cells before and after REL knockdown, as presented in this invention.

[0039] Figure 6 This is a comparison of cell viability before and after knocking down REL expression in H1703 and SK-MES-1 cells according to the present invention.

[0040] Figure 7 This is a comparison of cell proliferation capacity before and after knockdown of REL expression in H1703 and SK-MES-1 cells in this invention.

[0041] Figure 8 The results show the cell viability of H1703 and SK-MES-1 cells before and after treatment with the IT-603 inhibitor of this invention.

[0042] Figure 9 The results show the changes in cell migration ability of H1703 cells after treatment with the IT-603 inhibitor of this invention.

[0043] Figure 10 The results show the changes in cell migration ability of SK-MES-1 cells after treatment with the IT-603 inhibitor of this invention.

[0044] Figure 11 This is a comparison of cell proliferation capacity of H1703 and SK-MES-1 cells before and after treatment with the IT-603 inhibitor of this invention.

[0045] Figure 12 This image shows the tumor formation in mice after LLC cells knocked down REL expression according to the present invention. Detailed Implementation

[0046] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0047] The terms "preferred," "more preferably," etc., used in this invention refer to embodiments of the invention that provide certain beneficial effects under certain circumstances. However, other embodiments may also be preferred under the same or other circumstances. Furthermore, the description of one or more preferred embodiments does not imply that other embodiments are unavailable, nor is it intended to exclude other embodiments from the scope of this invention.

[0048] When a numerical range is disclosed herein, the range is considered continuous and includes the minimum and maximum values ​​of the range, as well as every value between the minimum and maximum values. Furthermore, when the range refers to integers, it includes every integer between the minimum and maximum values ​​of the range. Additionally, when multiple ranges are provided to describe a feature or characteristic, the ranges may be combined. In other words, unless otherwise specified, all ranges disclosed herein should be understood to include any and all subranges to which they are incorporated.

[0049] In the description of this invention, the terms "one embodiment," "some embodiments," "illustrative embodiment," "example," "specific example," or "some examples," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0050] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0051] (I) Construction of REL knockdown human lung squamous cell carcinoma cell line

[0052] 1. RNA extraction from lung cancer tissue

[0053] The specific method for RNA extraction from lung cancer tissue of the present invention includes the following steps:

[0054] Step S1: When extracting RNA from lung (cancer) tissue, lyse the tissue with 1 mL of Trizol reagent for every 50-100 mg of tissue by repeatedly blowing or shaking the tissue with a pipette to lyse the cells.

[0055] Step S2: Transfer the Trizol lysis buffer of the above lung (cancer) tissue into an EP tube and let it stand at room temperature for 5 minutes;

[0056] Step S3: Add chloroform to the EP tube at a ratio of 0.2 mL chloroform after every 1 mL Trizol, cap the EP tube, shake vigorously in your hand for 15 seconds, let it stand at room temperature for 2-3 minutes, and then centrifuge at 12000g at 4℃ for 15 minutes.

[0057] Step S4: Take the upper aqueous phase and place it in a new EP tube. Add isopropanol at a ratio of 0.5 mL isopropanol per 1 mL Trizol. After standing at room temperature for 10 minutes, centrifuge at 12000 g at 4℃ for 10 minutes.

[0058] Step S5: Discard the supernatant, add 1 mL of 75% ethanol per 1 mL of Trizol, wash, vortex mix, centrifuge at 7500g at 4℃ for 5 minutes, and discard the supernatant.

[0059] Step S6: Allow the precipitated RNA to air dry at room temperature.

[0060] Step S7: Dissolve the RNA precipitate with RNase-free water.

[0061] Step S8: Nanodrop concentration was determined, and electrophoresis gel was used to identify the quality of the extracted RNA.

[0062] 2. qPCR

[0063] (1) RNA reverse transcription

[0064] Prepare the RT reaction solution according to the components in List 1 (prepare the reaction solution on ice). To ensure the accuracy of the reaction solution preparation and reduce errors during aliquoting, prepare the reaction solution by a slightly larger volume than the actual amount needed, and finally add the RNA sample.

[0065] Table 1: RT reaction solution

[0066] reagents Usage Final concentration 5×PrimeScript Buffer(for Real Time) 2μL 1× PrimeScript RT Enzyme Mix I 0.5μL - Oligo dT Primer (50μM) 0.5μL 25pmol Random 6mers (100μM) 0.5μL 50 pmol Total RNA 500ng - <![CDATA[RNase Free ddH2O]]> up to 10μL -

[0067] The conditions for the above reverse transcription reaction are as follows:

[0068] The reaction system was placed at 37°C for 15 min for reverse transcription, then at 85°C for 5 s to inactivate the reverse transcriptase, and finally stored at 4°C.

[0069] (2) PCR amplification

[0070] Prepare the qPCR reaction solution according to the components shown in List 2 (prepare the reaction solution on ice). To account for aspiration error, the volume of the premixed solution should be at least 10% larger than the total volume of all reactions. The REL Forward primer sequence is: AGAATTTGTGGAAGTGTCAGAGG (SEQ ID NO.1); the REL Reverse primer sequence is: AATGGCTACTTGACGGTGTAC (SEQ ID NO.2).

[0071] Table 2: qPCR reaction system

[0072]

[0073] The Real-Time PCR reaction procedure described above is shown in Table 3:

[0074] Table 3: qPCR reaction procedure

[0075]

[0076] 3. Construction of lentiviral vectors

[0077] (1) shRNA design

[0078] The shREL sequence was designed using the software Psicoligomaker3 as follows:

[0079] REL-shRNA-F: TGAAACCCCGTCTCTACTAATTCAAGAGATTAGTAGAGACGGGGTTTCTTTTTTC (SEQ ID NO. 3);

[0080] REL-shRNA-R: TCGAGAAAAAAGAAACCCCGTCTCTACTAATCTCTTGAATTAGTAGAGACGGGGTTTCA (SEQ ID NO. 4).

[0081] (2) Enzyme digestion

[0082] The pLenti Lox 3.7 vector was selected and digested with HpaI and XhoI. The digestion system is shown in Table 4. The digestion conditions were: 37℃ for 30 min, followed by 1% gel recovery.

[0083] Table 4: Enzyme digestion system

[0084] Components content pLenti Lox 3.7 1ug (volume depends on plasmid concentration) 10×buffer 2μL Hpa Ⅰ 1μL Xho Ⅰ 1μL ddH2O up to 20μL

[0085] (4) Primer annealing and ligation

[0086] Prepare 10×Annealing Buffer (containing 100mM Tris, pH 7.5-8.0, 500mM NaCl and 10mM EDTA) and prepare the primer reaction system as shown in Table 5.

[0087] Table 5: Primer Annealing System

[0088] Components content 10×Annealing Buffer 3μL 100μM forward primer 1μL 100μM reverse primer 1μL <![CDATA[ddH2O]]> 25μL

[0089] The primers were annealed at 95°C for 5 minutes, then slowly cooled to room temperature to obtain double-stranded shREL. The annealed double-stranded shREL was ligated with the enzyme-digested pLenti Lox 3.7 using ligase and incubated at room temperature for 4 hours to obtain the ligation product. The ligation system is shown in Table 6.

[0090] Table 6: Connection System

[0091] Components Added amount Annealled oligos 6μL Digested pLenti Lox 3.7 2μL 10x T4 DNA Ligase buffer 1μL T4 DNA Ligase 1μL

[0092] (4) Transformation

[0093] Thaw competent cells on ice, add DNA to the cells, gently tap the tube wall to mix, incubate on ice for 30 min, heat shock at 42°C for 1 min, incubate on ice for 2 min, add antibiotic-free LB medium, incubate at 37°C on a shaker for 1 hour, centrifuge, discard part of the supernatant, resuspend and plate (LB medium containing the antibiotic corresponding to the vector), incubate overnight, and after identification as a positive clone, the shREL lentiviral vector is obtained. The plasmid map of the shREL lentiviral vector is shown below. Figure 2 As shown.

[0094] 4. Lentiviral preparation and infection

[0095] (1) Lentiviral preparation

[0096] According to 2×10 5 Seed 293T cells per well into 6-well plates and incubate overnight at 37°C with 5% CO2. Take a 1.5 mL sterile EP tube, add 0.3 mL of OPTI-MEM and 8.8 μL of PEI, mix gently, and incubate at room temperature for 5 minutes to obtain the PEI solution. Then take another 1.5 mL sterile EP tube, add 0.3 mL of OPTI-MEM and 2.2 μg of DNA (including pLentiLox 3.7, Rev, Gag / Pol, and VSV-G in a 1:1:1 ratio), mix gently, and incubate at room temperature for 5 minutes to obtain the DNA solution.

[0097] Add the DNA solution as a hanging drop to the PEI solution, mix gently, and incubate at room temperature for 20 minutes. Then, evenly add the incubated mixture to each well of a 6-well plate containing 293T cells, and gently shake the plate to distribute it evenly. Incubate at 37°C in a 5% CO2 cell culture incubator for 16 hours. After 16 hours, change the culture medium to 0.2 mM DMEM containing 10% FBS and 1% P / S. Continue culturing for 48 hours, then collect the virus (designated as shREL virus), filter the medium through a 0.45 μm filter into a new EP tube, and place it in a 4°C freezer overnight for stability before use. Alternatively, flash-freeze the virus in liquid nitrogen the next day and store it at -80°C, taking care to avoid repeated freeze-thaw cycles.

[0098] (2) Cellular viral infection

[0099] H1703 cells were divided into groups of 2 × 10⁻⁶. 5 Density, SK-MES-1 cells at 1.5×10 5Cells were seeded at varying densities into 6-well plates, divided into two cell line groups. Each cell line group was further divided into an experimental group with shREL knockdown and a control group. In the experimental group, 1.2 mL of virus solution and 1.2 μL of Polybrene (8 mg / mL) were added to each well. The plates were gently shaken to ensure even distribution, and the cells were cultured at 37°C in a 5% CO2 incubator for 6-8 hours. Then, double the amount of cell culture medium (DMEM medium + 10% fetal bovine serum + Penicillin-Streptomycin) was added to each well of the 6-well plate. After culturing for another 48 hours, the cells were digested with 0.25% trypsin, and the cells were collected for RNA or total protein extraction. qPCR was used to detect low REL gene expression.

[0100] Test results as follows Figure 3 As shown, this invention successfully knocked down the expression of REL in H1703 cells and SK-MES-1 cells.

[0101] (II) Detection of the effect of REL knockdown on human lung squamous cell carcinoma cell lines

[0102] 1. Cell migration detection

[0103] H1703 cells were divided into groups of 2 × 10⁻⁶. 5 Density, SK-MES-1 cells at 1.5×10 5 Cells were seeded at varying densities in 6-well plates, divided into an experimental group (shREL knockdown group) and a control group. The experimental group was infected with shREL virus at a concentration of 3 MOI for 48 hours. H1703 and SK-MES-1 cells were then digested and seeded separately, with H1703 cells seeded at a density of 5 × 10⁻⁶ cells / well. 5 Density, SK-MES-1 cells at 4×10 5 Cells were seeded at a density of 12-well plates and incubated overnight at 37°C in a 5% CO2 cell culture incubator. Cell growth was observed to ensure it was appropriate. Then, a 200 μL pipette tip was used to make a straight incision on the bottom of the culture plate, and detached cells were washed away with PBS buffer. Serum-free culture medium was added, and the cells were incubated again at 37°C in a 5% CO2 cell culture incubator. Cell migration was observed under a microscope at 0, 24, 48, and 72 hours of culture, and the results were statistically analyzed.

[0104] The results are as follows Figure 4 and Figure 5 As shown, knocking down REL significantly reduced the cell migration ability of H1703 and SK-MES-1 cells, indicating that the REL gene affects the migration of human lung squamous cell carcinoma cells.

[0105] 2. Cell viability detection

[0106] H1703 cells were divided into groups of 2 × 10⁻⁶.5 Density, SK-MES-1 cells at 1.5×10 5 Cells were seeded at varying densities in 6-well plates, divided into an experimental group (shREL knockdown group) and a control group. The experimental group was infected with shREL virus at a concentration of 3 MOI for 48 hours. H1703 and SK-MES-1 cells were then digested and seeded separately, with H1703 cells seeded at a density of 1 × 10⁻⁶ cells / well. 5 Density, SK-MES-1 cells at 8×10 4 100 μL of each cell was seeded into a 98-well plate and incubated overnight at 37°C in a 5% CO2 cell culture incubator. Then, 10 μL of CCK-8 solution was added to each well, and the cells were cultured for another 2–4 hours. The absorbance at 450 nm was measured using a microplate reader at 0, 24, 48, and 72 hours of culture.

[0107] Test results as follows Figure 6 As shown, knocking down REL expression in lung squamous cell carcinoma cells significantly reduced cell viability, indicating that REL gene expression affects the viability of lung squamous cell carcinoma cells.

[0108] 3. Edu Experiment

[0109] H1703 cells were divided into groups of 2 × 10⁻⁶. 5 Density, SK-MES-1 cells at 1.5×10 5 Cells were seeded at high density in 24-well plates and cultured overnight until they recovered to normal growth. Then, they were infected with shREL virus for 48 hours. A 10 mM EdU stock solution was prepared and diluted with complete culture medium to a 2× EdU working solution (using APExBIO's EdU Imaging Kits (Cy3), K1075). The 2× EdU working solution was preheated at 37°C and 5% CO2 in a cell culture incubator, and then added in equal volumes to the cells in the 24-well plates, bringing the final EdU concentration to 1×. The plates were then incubated at 37°C and 5% CO2 for 2 hours. After EdU incubation, the culture medium was removed, and 1 mL of 3.7% formaldehyde was added to each well for fixation at room temperature for 15 minutes. The fixative was removed, and the cells were washed twice with 1 mL of PBS containing 3% BSA for 3-5 minutes each time. The washings were then removed, and 1 mL of PBS containing 0.5% BSA was added to each well. Incubate X-100 in PBS (or other permeabilizing solution) at room temperature for 20 minutes.

[0110] Dilute the prepared 10×EdU Buffer Additive stock solution with deionized water at a ratio of 1:10 to prepare a 1×EdU Buffer Additive working solution (i.e., add 2 mL of ddH2O to the vial of Component F and mix thoroughly until the EdU Buffer Additive is completely dissolved; this working solution should be prepared fresh before use). Finally, prepare the Click reaction solution according to the formula in Table 7. The prepared Click reaction solution must be used within 15 minutes of preparation.

[0111] Table 7: Click Reaction Solution

[0112] Components content 1×EdU Reaction Buffer 860μL <![CDATA[CuSO4]]> 40μL Cy3 azide 1μL 1×EdU Buffer Additive 100μL Total volume Approximately 1 mL

[0113] Remove the permeate from the previous step (containing 0.5%). Then, wash each well twice with 1 mL of PBS containing 3% BSA. Remove the washing buffer, add 0.5 mL of Click reaction solution to each well, and gently shake the culture plate to ensure the Click reaction solution is evenly distributed and covers the sample. Incubate at room temperature in the dark for 30 minutes, then aspirate the Click reaction solution and wash each well three times with 1 mL of PBS containing 3% BSA for 3-5 minutes each time. After washing, remove the washing buffer, then add 1 mL of 1×Hoechst 33342 solution to each well (preparation method: dilute Hoechst 33342 (Component G) solution with PBS at a ratio of 1:2000 to obtain a final concentration of 5 μg / mL). Incubate at room temperature in the dark for 30 minutes, then remove the Hoechst 33342 solution and wash each well three times with 1 mL of PBS for 3-5 minutes each time. Observe, photograph, and analyze the results using a fluorescence microscope.

[0114] Test results as follows Figure 7 As shown, knocking down REL expression in lung squamous cell carcinoma cells reduces cell proliferation, indicating that REL gene expression affects the proliferation of lung squamous cell carcinoma cells.

[0115] (III) Efficacy evaluation trials of REL inhibitors

[0116] (1) Cell activity

[0117] H1703 cells were divided into groups of 2 × 10⁻⁶. 5 Density, SK-MES-1 cells at 1.5×10 5 Cells were seeded at a density of 1 × 10⁶ wells in 6-well plates. The REL inhibitor IT-603 (purchased from Aladdin Shanghai) was diluted with culture medium to a final concentration of 20 μM. The medium containing the inhibitor was added to the cells, and after culturing for 24 hours, the cells were seeded into 96-well plates, with H1703 cells seeded at a density of 1 × 10⁶ cells / well.5 Density, SK-MES-1 cells at 8×10 4 Add 100 μL of cell suspension to each well. After inoculation, place the 96-well plate in a 37°C, 5% CO2 cell culture incubator. Then add 10 μL of CCK-8 solution to each well and continue culturing for 2-4 hours. Measure the absorbance at 450 nm using a microplate reader at 0, 24, 48, and 72 hours of culture.

[0118] Test results as follows Figure 8 As shown, adding a certain concentration of REL inhibitor can effectively reduce the proliferation ability of lung squamous cell carcinoma cells, indicating that REL inhibitor affects the proliferation ability of lung squamous cell carcinoma cells.

[0119] (2) Cell migration ability

[0120] H1703 cells were divided into groups of 1×10 5 Density, SK-MES-1 cells at 8×10 4 Cells were seeded at a density in 12-well plates, with an IT-603 inhibitor experimental group and a control group. The final concentration of the REL inhibitor IT-603 was 20 μM. Cells were cultured overnight at 37°C in a 5% CO2 incubator. After 48 hours of culture, cell growth was observed to ensure it was adequate. Then, a 200 μL pipette tip was used to make a straight incision on the bottom of the culture plate, and detached cells were washed away with PBS buffer. Serum-free culture medium was added, and the cells were cultured again at 37°C in a 5% CO2 incubator. Cell migration was observed under a microscope at 0, 24, 48, and 72 hours of culture, and the results were statistically analyzed.

[0121] Test results as follows Figure 9 and Figure 10 As shown, the REL inhibitor IT-603 can effectively reduce the cell migration ability of H1703 cells and SK-MES-1 cells.

[0122] (3) EdU experiment

[0123] H1703 cells were divided into groups of 2 × 10⁻⁶. 5 Density, SK-MES-1 cells at 1.5×10 5 Density seeding was performed in 24-well plates (climbing slides may be added if necessary). After overnight culture and recovery to normal growth, cells were treated with the REL inhibitor IT-603 for 48 hours, with a final concentration of 20 μM. The remaining procedures followed the Edu experimental steps described above.

[0124] Test results as follows Figure 11 As shown, REL inhibitors can significantly reduce the proliferation ability of lung squamous cell carcinoma cells.

[0125] (iv) In vivo experiments in mice

[0126] LLC cells were seeded in 10 cm dishes and incubated overnight at 37°C in a 5% CO2 cell culture incubator. The shREL virus should be removed from the -80°C freezer and thawed on ice beforehand to avoid rapid thawing which could reduce the viral titer. 1.2 mL of shREL virus solution (approximately 3 × 10⁻⁶ cells) was added to each well of a 6-well plate. 5 Add 1.2 μL of Polybrene (8 mg / mL) to the culture plate, gently shake to distribute evenly, and incubate for 6-8 hours. Then, add one times the amount of culture medium to each well of a 6-well plate and incubate at 37°C in a 5% CO2 cell culture incubator for 48 hours. Digest the cells with trypsin and collect the cells.

[0127] The collected LLC cells were distributed at a rate of 2 × 10⁶ cells per mouse. 6 Prepare the cell injection volume calculation and a sealable transparent box (approximately 6cm x 6cm x 6cm). Place two cotton balls inside the box and add 1mL of animal-grade isoflurane to each cotton ball. Place the mouse in the box and remove it after observing a slowing and deepening of its breathing (approximately 45 seconds). Quickly hook a thin string around the mouse's upper incisors and suspend it. Use curved forceps to pull the mouse's tongue out, and use your left thumb and forefinger to pull the tongue out as far as possible. Press down on the mouse's nose with your left middle finger to force it to breathe through its mouth while preventing it from swallowing. Quickly inject LLC cells into the back of the mouse's mouth using a pipette. Maintain this position for 30 seconds after injection to complete the experiment. House the mouse in an SPF environment. After 28 days, sacrifice the mouse and collect its lung tissue for observation and recording.

[0128] The results are as follows Figure 12 As shown, knocking down REL expression in mouse LLC cells resulted in smaller tumors in mice compared to the control group.

[0129] The embodiments of the present invention have been described in detail above. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. The application of a REL inhibitor in the preparation of a drug for treating lung squamous cell carcinoma; in, The REL inhibitor is a shRNA that targets REL, and the shRNA that targets REL is a shRNA with a nucleotide sequence as shown in SEQ ID NO. 3; and / or a shRNA with a nucleotide sequence as shown in SEQ ID NO.

4.

2. The application according to claim 1, characterized in that: The use of the anti-squamous cell lung cancer drug includes at least one of A) to C): A) Reduces the activity of lung squamous cells; B) Inhibits the proliferation of lung squamous cells; C) Inhibits the migration ability of lung squamous cells.

3. The application according to claim 1, characterized in that: The anti-squamous cell carcinoma drug also contains pharmaceutically acceptable excipients.

4. The application according to claim 3, characterized in that: The pharmaceutically acceptable excipients include at least one of the following: diluents, binders, disintegrants, absorption enhancers, surfactants, adsorbents, lubricants, sweeteners, and flavorings.

5. The application according to claim 3, characterized in that: The dosage form of the anti-squamous cell lung cancer drug is at least one of solid dosage form, liquid dosage form, and semi-solid dosage form.

6. The application according to claim 5, characterized in that: The solid dosage forms include tablets, granules, powders, and capsules; And / or, the liquid formulation includes an injectable formulation; And / or, the semi-solid formulation includes ointments and creams.

Images