Application of compound LY2940094 in the preparation of drugs for treating demyelinating diseases of the central nervous system

Compound LY2940094 promotes the differentiation of oligodendrocyte precursor cells into mature oligodendrocytes, solving the problem of the inability to promote myelin regeneration in existing technologies and achieving effective treatment of demyelinating diseases of the central nervous system.

CN117442618BActive Publication Date: 2025-11-14HANGZHOU INST FOR ADVANCED STUDY UCAS
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202311373997.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-10-23
Publication Date
2025-11-14
Estimated Expiration
2043-10-23

AI Technical Summary

Technical Problem

Current drugs for treating central nervous system demyelinating diseases mainly target the peripheral immune system and cannot promote myelin regeneration and nerve function recovery.

Method used

Using compound LY2940094 as the sole active ingredient, it promotes the differentiation of oligodendrocyte precursor cells into mature oligodendrocytes, thereby promoting the regeneration of myelin sheath in the central nervous system.

Benefits of technology

It significantly promotes the differentiation of OPCs into OLs, increases the expression of myelin-related genes and proteins, promotes in vitro myelin formation, and significantly promotes myelin regeneration in animal models, providing a new approach for the treatment of central nervous system demyelinating diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117442618B_ABST
    Figure CN117442618B_ABST
Patent Text Reader

Abstract

This invention relates to the field of biomedical technology, and provides the application of compound LY2940094 in the preparation of drugs for treating demyelinating diseases of the central nervous system. This invention verifies through modern biological techniques that compound LY2940094 can promote the differentiation of oligodendrocyte precursor cells (OPCs) into mature oligodendrocytes (OLs), thereby promoting the regeneration of myelin in the central nervous system and thus treating demyelinating diseases of the central nervous system.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and in particular to the use of a compound LY2940094 in the preparation of drugs for treating demyelinating diseases of the central nervous system. Background Technology

[0002] Central nervous system demyelinating diseases refer to diseases that damage or destroy the myelin sheath structure surrounding the axons of the central nervous system. These include multiple sclerosis (MS), acute disseminated encephalomyelitis (ADEM), and neuromyelitis optica (NMO). MS is the most common central nervous system demyelinating disease, causing visual and motor impairments and severely impacting quality of life. Current drug treatments for central nervous system demyelinating diseases primarily target the peripheral immune system, reducing the frequency of disease flare-ups and slowing disease progression, but they cannot further repair myelin damage or fundamentally cure the disease. Therefore, there is an urgent need to find new treatment methods.

[0003] The most prominent feature of demyelinating diseases is myelin sheath damage. The myelin sheath is an electrically insulating membrane that surrounds the axons of nerve cells. In the nervous system, the myelin sheath has multiple functions, including allowing action potentials to be rapidly and skipped along nerve axons, improving nerve conduction efficiency, and providing metabolic support for nerve axons. In the central nervous system, myelin sheaths are formed by oligodendrocytes (OLs) wrapping around axons, and oligodendrocytes differentiate from oligodendrocyte precursor cells (OPCs). Under normal circumstances, the OPCs stored in the central nervous system of adults can be activated and recruited to the lesion area and differentiate into OLs, thereby producing myelin sheaths that wrap around axons. However, under pathological conditions, this process is hindered. Current therapies targeting the immune system can reduce immune-mediated damage in demyelinating diseases, but they cannot promote myelin regeneration and the recovery of nerve function.

[0004] New research has found that promoting the differentiation of OPCs into OLs, which further promotes myelin regeneration, is an effective treatment strategy for demyelinating diseases.

[0005] Publication numbers CN 115501227 B and CN 115501234 B disclose the application of compounds of formula II and formula III in the preparation of drugs for the prevention and treatment of demyelinating diseases. Compounds of formula II and formula III can effectively treat and / or prevent demyelinating diseases.

[0006]

[0007] The structure of compound LY2940094 is shown in Formula I. According to existing reports, compound LY2940094 is an antagonist of opioid-related nociceptin receptor 1 (Oprl1). Current research shows that it mainly plays a role in regulating mood disorders, drug abuse, and motor regulation. It has also completed phase II clinical trials for the treatment of major depressive disorder, alcohol dependence, and Parkinson's disease, showing good safety. However, whether compound LY2940094 has any effect on demyelinating diseases has not yet been reported. Summary of the Invention

[0008] To address the problem that current treatments targeting the immune system can reduce immune-mediated damage in demyelinating diseases but cannot promote myelin regeneration, this invention provides the application of compound LY2940094 in the preparation of drugs for treating central nervous system demyelinating diseases.

[0009] The chemical name of compound LY2940094 is 2-[4-[(2'-chloro-4',4'-difluoro-4',5'-dihydrospiro[piperidin-4,7'-[7H]thieno[2,3-C]pyran]-1-yl)methyl]-3-methyl-1H-pyrazol-1-yl]-3-pyridinemethanol, CAS number is 1307245-86-8, and molecular formula is C 22 H 23 ClF2N4O2S, its structural formula is shown in formula (I):

[0010]

[0011] Compound LY2940094 is an antagonist of opioid-related nociceptin receptor 1 (Oprl1). Current research indicates that it mainly plays a role in regulating mood disorders, drug abuse, and motor regulation. It has also completed phase II clinical trials for the treatment of major depressive disorder, alcohol dependence, and Parkinson's disease, demonstrating good safety.

[0012] Based on a high-throughput cell screening system, this invention discovered that compound LY2940094 can promote the differentiation of oligodendrocyte precursor cells (OPC) into mature oligodendrocytes (OL), thereby promoting the regeneration of myelin in the central nervous system and treating demyelinating diseases of the central nervous system.

[0013] Furthermore, the aforementioned drug for treating demyelinating diseases of the central nervous system is a drug that promotes myelin regeneration in the central nervous system.

[0014] Furthermore, the aforementioned demyelinating diseases of the central nervous system are diseases of myelin sheath damage in the central nervous system.

[0015] Furthermore, diseases that damage the myelin sheath of the central nervous system include multiple sclerosis, acute disseminated encephalomyelitis, and neuromyelitis optica.

[0016] Furthermore, the aforementioned drug for treating demyelinating diseases of the central nervous system uses compound LY2940094 as the sole active ingredient or is a pharmaceutical composition containing compound LY2940094.

[0017] The drug dosage form can be selected from microcapsules, intravenous emulsions, liposomes, aerosols, prodrug preparations, injections, mixtures, oral ampoules, tablets, capsules, pellets, emulsions, ointments, rubber plasters, films, sponges, iontophoresis agents, or transdermal absorption agents.

[0018] Furthermore, the drug for treating demyelinating diseases of the central nervous system comprises a therapeutically effective amount of the compound LY2940094 and pharmaceutically acceptable excipients.

[0019] The present invention also provides a medicament for treating demyelinating diseases of the central nervous system, comprising compound LY2940094 and pharmaceutically acceptable excipients.

[0020] Furthermore, in the aforementioned drug for treating demyelinating diseases of the central nervous system, the content of compound LY2940094 is 0.1-99 wt%.

[0021] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0022] This invention utilizes modern biological techniques to conduct a preliminary study on the function of compound LY2940094 in central nervous system demyelinating diseases. The study found that treatment with LY2940094 significantly promoted the differentiation of OPCs (including OPCs derived from neural progenitor cells (NPCs) and primary OPCs) into OLs at both the gene and protein levels, promoted myelin formation in an OPC-DRG neuron co-culture system, and promoted myelin regeneration in a Cuprizone-induced mouse demyelinating model. Therefore, treatment with LY2940094 can be considered a novel approach for treating central nervous system demyelinating diseases. Consequently, compound LY2940094 shows promising application potential in the preparation of drugs for treating central nervous system demyelinating diseases. Attached Figure Description

[0023] Figure 1 Figure showing the results of compound LY2940094 promoting OPC differentiation:

[0024] (A) Four days after OPC differentiation was induced, MBP in the control group and the group treated with compound LY2940094 (2μM) was significantly different. + Immunofluorescence staining image of OL;

[0025] (B) Different concentrations of compound LY2940094 induced OPC differentiation for 4 days, and MBP + Statistical chart of the percentage of OL cells in the total number of cells;

[0026] (C) Statistical graph of mRNA levels of myelin-related genes MBP, MAG and CNP in the control group and the compound LY2940094 (2μM) treatment group 4 days after OPC differentiation;

[0027] (D) OPC differentiation induced by different treatment durations of compound LY2940094 (2μM), and MBP protein imprinting after 4 days;

[0028] Figure 2 Figure showing the results of compound LY2940094 promoting primary OPC differentiation and myelin formation in an OPC-DRG neuron co-culture system:

[0029] (A) Primary OPC differentiation induced for 4 days, MBP in control group and compound LY2940094 (2μM) treatment group + Immunofluorescence staining image of OL;

[0030] (B) Different concentrations of compound LY2940094 induced primary OPC differentiation for 4 days, and MBP + Statistical chart of the percentage of OL cells in the total number of cells;

[0031] (C) Immunofluorescence staining images of MBP and NFH in the control group and the group treated with compound LY2940094 (10 μM) in the co-culture system;

[0032] (D) MBP formed in the co-culture system after treatment with different concentrations of compound LY2940094 + NFH + Myelin sheath length statistics chart;

[0033] Figure 3 Figure showing the results of compound LY2940094 promoting myelin regeneration in a Cuprizone-induced mouse demyelination model:

[0034] (A) Schematic diagram of Cuprizone-induced mouse demyelination / myelination regeneration model;

[0035] (B) Fast blue staining of the corpus callosum region in Cuprizone model mice;

[0036] (C) Representative images of fast blue staining of the corpus callosum region of mice after different treatment times with compound LY2940094 (30 mg / kg);

[0037] (D) Statistical results of the myelinated area (blue area) in the corpus callosum of mice after different treatment times with compound LY2940094 (30mg / kg). Detailed Implementation

[0038] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be noted that the embodiments described below are intended to facilitate the understanding of the present invention and do not limit it in any way.

[0039] Example 1

[0040] Immunofluorescence staining, real-time quantitative PCR, and protein blotting demonstrated that compound LY2940094 promotes OPC differentiation.

[0041] 1) Materials and Methods

[0042] Preparation of OPCs (oligodendrocyte precursor cells):

[0043] The cerebral cortex was isolated from 14.5-day-old mouse embryos, ground, and filtered through a 40μm filter. The cell suspension was diluted in NPC medium (DMEM / F12 (Gibco, USA) containing 20 ng / ml EGF (PEPROTECH, USA), 20 ng / ml bFGF (PEPROTECH, USA), 2% B27 (Gibco, USA), and Penicillin / Streptomycin (Gibco, USA)) and seeded into 10cm dishes, designated as generation P0. Cells were cultured for 44-48 hours before subculturing. During subculturing, the culture dish was gently shaken horizontally, and the contents were transferred to 15ml centrifuge tubes. The cells were centrifuged at 120g for 3 minutes (Eppendorf, Germany), and the supernatant was discarded. The cell pellet was dispersed, and pre-warmed Accutase (Sigma, USA) was added. Digestion was performed at room temperature for 3 minutes, followed by the addition of diluted DMEM / F12 enzyme solution to terminate the digestion. The cells were centrifuged at 180g for 3 minutes, and the supernatant was discarded. The cells were resuspended in NPC medium and cultured further. When cultured to P3 generation, cells were resuspended in OPC medium (DMEM / F12 containing 10 ng / ml PDGF-AA (PEPROTECH, USA), 10 ng / ml bFGF, 2% B27, Penicillin / Streptomycin) and seeded into cell plates coated with polyornithine (Sigma, USA) and cohesin (Sigma, USA) for two days to induce OPC formation.

[0044] LY2940094 promotes the differentiation of OPC into MBP + OL Effect Analysis:

[0045] After obtaining OPCs using the above method, the medium was changed to OL medium (DMEM / F12 containing 2% B27, Penicillin / Streptomycin), and 1‰ DMSO (Sigma, USA) was added as a solvent control group, along with different concentrations of compound LY2940094 (MCE, USA) (0.5μM, 1μM, 2μM, 4μM, 8μM) to induce OPC differentiation. Four days later, the culture medium was discarded, and cells were fixed with 4% paraformaldehyde (Sigma, USA) for 15 min. The cells were washed three times with 1×PBS buffer (Biosharp, China), blocked for 30 min with 1×PBS buffer containing 0.6% Triton X-100 (Macklin, China) and 2.5% BSA (Roche, Switzerland), and then incubated overnight at 4°C with primary antibody (MBP, 1:500, Biolegend, USA). The cells were washed three times with 1×PBS buffer, and then incubated for 1 h at room temperature in the dark with secondary antibody (1:1000, Invitrogen, USA). Hoechst (1 μg / ml, Solarbio, China) was added, and the cells were incubated for 5 min at room temperature in the dark. The cells were washed three times with 1×PBS buffer. Fluorescence images were obtained using a laser confocal scanning microscope (Leica, Germany). MBP cells were further analyzed using ImageJ software. + OL accounts for the proportion of total cells.

[0046] Analysis of the effect of compound LY2940094 on the expression of myelin-related genes:

[0047] OPCs were obtained using the method described above. The medium was then replaced with OL medium, and 1‰ DMSO was added as a solvent control. Compound LY2940094 (2 μM) was used to induce OPC differentiation for 4 days. The supernatant was discarded, and total RNA was extracted from the cells using Trizol reagent (Thermo, USA). cDNA was transcribed using the PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time) kit (Takara, Japan). Real-time quantitative PCR was performed on a real-time quantitative PCR instrument (CFX 96, Biorad) and... qPCR was performed using SYBR Green Master Mix (Low Rox Plus) (Yeasen, USA). Gene expression levels were quantified and normalized to Actin.

[0048] Use the following primers:

[0049] MBP Forward first(5'to 3'):TGACACCTCGAACACCACCTC.

[0050] Reverse primer(5' to 3'):CCTTGAATCCCTTGTGAGCC;

[0051] MAG Forward primer(5' to 3'):AGTGGAGGTCAGTTGTATGGTGC1

[0052] Reverse primer(5′ to 3′):GGCACGAAGGTGTAGCAGCGA1

[0053] CNP Forward primer(5' to 3'):GATGGTGTCCGCTGATGCTTA.

[0054] Reverse primer(5' to 3'):CCCGCTCGTGGTTGGTATC;

[0055] Actin Forward primer(5' to 3'):GGCTGTATTCCCCTCCATCG;

[0056] Reverse primer(5' to 3'):CCAGTTGGTAACAATGCCATGTT.

[0057] Publication LY2940094 license plate license plate MBP license plate:

[0058] OPCs were obtained using the method described above. The medium was replaced with OL medium, and 1‰ DMSO was added as a solvent control. Compound LY2940094 (2 μM) was added on days 0-1, 0-2, 0-3, 0-4, 1-2, 1-3, 1-4, 2-3, 2-4, and 3-4 of differentiation. On day 4, the supernatant was discarded, and the cells were washed with 1×PBS buffer. Cell lysis was achieved by continuous pipetting with 1×Protein Loading Buffer (Transgen, China), and the lysate was collected into centrifuge tubes. Cells were then disrupted using a cell sonicator (Xinzhi, China), centrifuged at 12000g for 15 min, and the supernatant was collected. Protein samples were separated by polyacrylamide gel electrophoresis, and the proteins were transferred to PVDF membranes. The membranes were blocked with 3% skim milk at room temperature for 1 h, and primary antibodies (MBP, 1:1000, Biolegend, USA; GAPDH, 1:5000, Biolegend, USA) were added and incubated overnight at 4°C. The membranes were then incubated with horseradish peroxide-labeled secondary antibody (1:5000, CST, USA) at room temperature for 1 h. The protein expression was measured by chemiluminescence immunoassay (Tanon, China), with GAPDH as an internal control.

[0059] 2) Results

[0060] like Figure 1 As shown in (A), after 4 days of OPC differentiation induction, compared with the control group, treatment with compound LY2940094 (2 μM) significantly increased the differentiation of OPCs into MBPs. + OL ratio.

[0061] like Figure 1 As shown in (B), compound LY2940094 promotes the differentiation of OPC into MBP in a concentration-dependent manner. + OL at a concentration of 2 μM showed the best effect in promoting OPC differentiation.

[0062] like Figure 1 As shown in (C), after 4 days of OPC differentiation induction, treatment with compound LY2940094 (2 μM) significantly promoted the expression of myelin-related genes MBP, MAG, and CNP compared with the control group.

[0063] like Figure 1 As shown in (D), the longer the OPC differentiation time is treated with compound LY2940094 (2μM), the higher the expression of MBP protein in the cells.

[0064] The above results demonstrate at both the mRNA and protein levels that compound LY2940094 promotes the differentiation of NPC-derived OPCs into OLs.

[0065] Example 2

[0066] Immunofluorescence staining demonstrated that compound LY2940094 promotes myelin formation in a co-culture system of primary OPC differentiation and OPC-DRG neurons.

[0067] 1) Methods and Materials

[0068] Compound LY2940094 promotes the differentiation of primary OPCs into MBPs. + OL cell effect analysis:

[0069] After isolating the cerebral cortex of C57BL / 6 newborn mice (1-3 days old), the cells were minced with scissors and digested with digestive enzymes (HBSS (Gibco, USA) containing 0.1 mg / ml DNase I (Sigma, USA) and 0.01% trypsin (Thermo, USA)) at 37°C for 15 min. Digestion was terminated by adding culture medium (DMEM basic (Gibco, USA) containing 2 mM L-glutamax (Gibco, USA), 10% FBS (Gibco, USA), penicillin / streptomycin). The cells were centrifuged at 100g for 5 min, and the supernatant was discarded. The cells were resuspended in culture medium, pipetted until no cell clumps were observed, filtered through a 70 μm filter, and seeded into T75 culture flasks coated with poly-L-lysine (Sigma, USA). After 9 days of culture, the culture flasks were fixed on a shaker and shaken at 50 rpm for 45 min to remove microglia. The culture medium was replaced with fresh medium, and the cells were allowed to stand for 3 h, followed by shaking at 220 rpm for 16 h. The suspension was then poured into 10 cm culture dishes and incubated at 37°C with 5% CO2 for 30 min. The suspended cells were then collected. Primary OPCs were obtained by centrifugation at 300 g for 5 min. The cells were seeded into cell plates coated with polyornithine and adhesion proteins. The next day, the medium was replaced with OL medium, and 1‰ DMSO was added as a solvent control. Different concentrations of compound LY2940094 (0.5 μM, 1 μM, 2 μM, 4 μM) were added to induce OPC differentiation. Three days later, the culture medium was discarded, and cells were fixed with 4% paraformaldehyde for 15 min. The cells were washed three times with 1×PBS buffer, blocked for 30 min with 1×PBS buffer containing 0.6% Triton X-100 and 2.5% BSA, and then incubated overnight at 4°C with primary antibody (MBP, 1:500). The cells were washed three times with 1×PBS buffer, and then incubated for 1 h at room temperature in the dark with secondary antibody (1:1000). Hoechst (1 μg / ml) was added, and the cells were incubated for 5 min at room temperature in the dark. The cells were washed three times with 1×PBS buffer. Fluorescence images were obtained using a laser confocal scanning microscope (Leica, Germany). MBP cells were further analyzed using ImageJ software. + The proportion of OL cells in the total number of cells.

[0070] Analysis of the effect of compound LY2940094 on myelin formation in OPC-DRG neuron co-culture system:

[0071] Dorsal root ganglion neurons (DRGNs) were prepared from C57BL / 6 newborn mice (7 days old). DRGs were isolated from the spinal cord and digested at 37°C for 15 minutes using papain (3 U / ml, Sigma, USA) and L-cysteine ​​(0.36 mg / ml, Sigma, USA). After centrifugation to remove papain, collagenase (100 U / ml, Thermo, USA) and neutral proteinase II (2 U / ml, Sigma, USA) were added and digested at 37°C for 15 minutes. After centrifugation to remove the enzyme solution, the cells were resuspended in DRGN culture medium (DMEM containing 10% FBS, penicillin / streptomycin), seeded in 6 cm cell culture dishes, and incubated at 37°C with 5% CO2 for 1.5 h. The suspension was collected, centrifuged, and resuspended in DRGN culture medium to obtain DRGNs, which were then seeded in cell plates coated with polyornithine and adhesion proteins. After standing at 37℃ and 5% CO2 for 4 hours, the culture medium was replaced with OL-medium (DMEM containing 2mM L-glutamax, 1mM Sodium pyruvate (Gibco, USA), 2% B27, 1% N2 (Gibco, USA), 0.5% FBS, 0.01% BSA, and 0.2μM M rogesterone (Tocris, UK)). On days 3 and 5, the medium was changed 3 / 4 of the way through, and 10μM 5-fluoro-2′-deoxyuridine (Sigma, USA) was added to remove glial cells. On days 7 and 9, the medium was completely changed. On day 9, primary OPCs obtained using the above method were seeded for co-culture, with 1‰ DMSO added as a solvent control and different concentrations of compound LY2940094 (1.25μM, 2.5μM, 5μM, 10μM). Six days later, the culture medium was discarded, and cells were fixed with 4% paraformaldehyde for 15 min. The cells were washed three times with 1×PBS buffer, blocked for 30 min with 1×PBS buffer containing 0.6% Triton X-100 and 2.5% BSA, and then incubated overnight at 4°C with primary antibodies (MBP, 1:500; NF-200, 1:1000, Sigma, USA). The cells were washed three times with 1×PBS buffer, and then incubated for 1 h at room temperature in the dark with secondary antibody (1:1000). Hoechst (1 μg / ml) was added, and the cells were incubated for 5 min at room temperature in the dark. The cells were washed three times with 1×PBS buffer. Fluorescence images were obtained using a laser confocal scanning microscope (Leica, Germany). The co-localization length of MBP and NF-200 was further analyzed using ImageJ software.

[0072] 2) Results

[0073] like Figure 2 As shown in (A), after 4 days of induction of primary OPC differentiation, treatment with compound LY2940094 (2 μM) significantly increased the differentiation of primary OPCs into MBPs compared with the control group. + OL ratio.

[0074] like Figure 2 As shown in (B), compound LY2940094 promotes the differentiation of primary OPCs into MBPs in a concentration-dependent manner. + OL at a concentration of 2 μM showed the best effect in promoting the differentiation of primary OPCs.

[0075] like Figure 2 As shown in (C), compared with the control group, treatment with compound LY2940094 (10 μM) resulted in MBP... + NFH + The length of the myelin segment increased significantly.

[0076] like Figure 2 As shown in (D), treatment with compound LY2940094 significantly promoted myelin formation in the co-culture system, with a concentration of 10 μM showing the best effect in promoting in vitro myelin formation.

[0077] The above results indicate that compound LY2940094 promotes the differentiation of primary OPCs into OLs and promotes myelin formation in OPC-DRG neurons.

[0078] Example 3

[0079] The specific mechanisms of central nervous system demyelinating diseases remain unclear, and the difficulty in obtaining tissue samples from patients limits research on these diseases. Therefore, selecting appropriate animal models is crucial for disease research. Commonly used animal models for studying demyelinating diseases include experimental autoimmune encephalomyelitis (EAE), virus-induced demyelination models (Theiler's murine encephalomyelitis virus (TMEV) model), and toxin-induced demyelination models (Cuprizone model). Dicyclohexanone oxaloyl dihydrazone (CPZ) is a copper ion chelator that specifically acts on oligodendrocytes to induce demyelination, independent of immune response. Feeding mice a diet containing 2% Cuprzone for 3-5 weeks induces demyelination in the cortex, corpus callosum, and superior cerebellar peduncle, and myelin regeneration occurs after feeding is stopped. Compared with the EAE model and TMEV model, the Cuprizone model is simple to operate, low in cost, and highly reproducible. It also includes both demyelination and myelin regeneration processes, making it an ideal model for studying demyelination and myelin regeneration.

[0080] In a Cuprizone-induced mouse demyelination model, compound LY2940094 promoted myelin regeneration.

[0081] 1) Methods and Materials

[0082] Nine-week-old C57BL / 6 mice were fed a diet containing 0.2% (w / w) Cuprzone for 5 weeks. After 5 weeks, the myelin sheath in the corpus callosum region of the mice was almost completely demyelinated. Cuprzone was removed, and the mice resumed their normal diet. Simultaneously, the mice were randomly divided into two groups and administered the drug: one group received a solvent control, and the other group received 30 mg / kg of compound LY2940094 via gavage daily. At weeks 5, 5+1, 5+2, and 5+3, the mice were anesthetized, perfused with physiological saline, and pre-fixed in 4% paraformaldehyde. The brains were then removed and fixed overnight in 4% paraformaldehyde at 4°C. The samples were washed three times with 1×PBS buffer and dehydrated in 30%, 50%, 70%, 80%, 90%, 95%, and 100% ethanol, respectively. The samples were then immersed in a 1:1 mixture of xylene and anhydrous ethanol, or in xylene, and subsequently embedded in paraffin for sectioning. The section thickness was 5 μm. Myelin regeneration was observed using Quick Blue staining. Tissue sections were dewaxed sequentially by immersion in xylene, 100% ethanol, and 95% ethanol, then soaked overnight in 0.1% Quick Blue solution (Sigma, USA) at 56°C. Excess stain was then washed away with 95% ethanol, followed by washing with double-distilled water. Differentiation was achieved using 0.05% lithium carbonate solution and 70% ethanol until the gray and white matter boundaries were clearly defined. Sections were counterstained with 0.5% eosin solution (Lexiang, China), followed by washing with double-distilled water and 95% ethanol. Dehydration was then performed with 100% ethanol, clearing with xylene, and mounting with neutral resin (Solarbio, China). Images were obtained using a microscope (Olympus, Japan). The proportion of myelin regeneration area in the corpus callosum to the total area of ​​the corpus callosum was further analyzed using ImageJ software.

[0083] 2) Results

[0084] like Figure 3 As shown in (A), this is a schematic diagram of a Cuprizone-induced mouse demyelination / myelination regeneration model.

[0085] like Figure 3 As shown in (B), compared with the control group, the corpus callosum of mice was almost completely demyelinated after 5 weeks of feeding with Cuprizone.

[0086] like Figure 3 As shown in (C), compared with the control group at the same time, treatment with compound LY2940094 (30 mg / kg) for 2 weeks significantly increased the area of ​​Fast Blue staining positive in the corpus callosum region of mice.

[0087] like Figure 3 As shown in (D), compared with the control group at the same time point, treatment with compound LY2940094 (30 mg / kg) for 2 weeks significantly increased the percentage of myelinated area in the corpus callosum of mice.

[0088] The above results indicate that in a Cuprizone-induced mouse demyelination model, compound LY2940094 significantly promotes myelin regeneration.

[0089] The embodiments described above provide a detailed explanation of the technical solutions and beneficial effects of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, additions, and equivalent substitutions made within the scope of the principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Application of compound LY2940094 in the preparation of drugs for treating demyelinating diseases of the central nervous system.

2. The use of compound LY2940094 according to claim 1 in the preparation of a drug for treating demyelinating diseases of the central nervous system, characterized in that, The aforementioned drug for treating demyelinating diseases of the central nervous system is a drug that promotes myelin regeneration in the central nervous system.

3. The use of compound LY2940094 according to claim 1 in the preparation of a drug for treating demyelinating diseases of the central nervous system, characterized in that, The aforementioned demyelinating diseases of the central nervous system are diseases of myelin sheath damage in the central nervous system.

4. The use of compound LY2940094 according to claim 3 in the preparation of a drug for treating demyelinating diseases of the central nervous system, characterized in that, Demyelination disorders of the central nervous system include multiple sclerosis, acute disseminated encephalomyelitis, and neuromyelitis optica.

5. The use of compound LY2940094 according to claim 1 in the preparation of a drug for treating demyelinating diseases of the central nervous system, characterized in that, The aforementioned drug for treating demyelinating diseases of the central nervous system is either compound LY2940094 as the sole active ingredient or a pharmaceutical composition containing compound LY2940094.

6. The use of compound LY2940094 according to claim 1 in the preparation of a drug for treating demyelinating diseases of the central nervous system, characterized in that, The drug for treating demyelinating diseases of the central nervous system comprises a therapeutically effective amount of the compound LY2940094 and pharmaceutically acceptable excipients.

Citation Information

Patent Citations

  • Application of compounds in the preparation of drugs for the prevention and treatment of demyelinating diseases

    CN115501227B

  • Uses of the compound in the preparation of drugs for the prevention and treatment of demyelinating diseases

    CN115501234B