SNP molecular markers in the porcine SELENBP1 gene associated with intramuscular fat traits and their application

Abstract

The present invention provides a SNP molecular marker related to pig intramuscular fat trait in pig SELENBP1 gene and its application, wherein the molecular marker is located in the second intron of pig SELENBP1 gene and contains a nucleotide sequence with polymorphism C / T at position 362 of the sequence shown in SEQ ID NO.1; the present invention also provides a method for detecting SNP related to pig intramuscular fat trait in pig SELENBP1 gene, mainly including primer pairs shown in SEQ ID NO.2-3. The present invention provides a new marker for molecular marker-assisted breeding of pig intramuscular fat trait, and the marker can be used to realize rapid identification of pig intramuscular fat content, thereby improving pig breeding efficiency.

Description

Technical Field

[0001] The invention belongs to the technical field of pig molecular marker screening, and specifically relates to a SNP molecular marker related to pig intramuscular fat traits in the second intron of pig SELENBP1 gene and an application thereof. Background Art

[0002] Intramuscular fat content is an important evaluation index of pork quality, and it directly affects the taste and flavor of pork. The intramuscular fat trait is a medium heritability trait with a heritability between 0.2 and 0.4. However, since it is difficult to measure meat quality traits in vivo, it is difficult to improve them through conventional breeding. Therefore, finding molecular markers that affect meat quality traits and combining conventional breeding with marker-assisted selection (MAS) can accelerate the genetic improvement of pig intramuscular fat traits.

[0003] MAS uses molecular markers associated with specific traits as an auxiliary means for selective breeding. It has the advantages of being fast, accurate, and not affected by the environment. It can reduce the workload of on-site measurement personnel and shorten the breeding time. Single nucleotide polymorphism (SNP) refers to genetic polymorphism caused by mutation of a single nucleotide in the genomic DNA sequence. It is widely present in the genome and is often used in breeding practice through the MAS method. It plays a key role in the genetic improvement of important traits.

[0004] SELENBP1 belongs to the selenium-binding protein family. In 1989, Bansal et al. detected the expression of SELENBP1 in the liver of mice after injecting sodium selenite into 6-week-old mice. Pol et al. found that SELENBP1 can convert methane into hydrogen peroxide and hydrogen sulfide (Pol et al., 2018). Hydrogen peroxide and hydrogen sulfide are key signaling molecules in the process of cell differentiation and can increase the differentiation of fat precursor cells (Higuchi et al., 2013; Tsai et al., 2015). Steinbrenner et al. further found that the SELENBP1 gene is upregulated in mature adipocytes and may be a marker gene for the maturation of adipocytes (Steinbrenner et al., 2020). After searching, there is no report on the use of SELENBP1 gene SNPs as molecular markers, especially as molecular markers related to pig intramuscular fat traits, for screening or predicting pig breeds with excellent intramuscular fat traits. Summary of the invention

[0005] The present invention aims to provide a new molecular marker related to pig intramuscular fat trait in pig SELENBP1 gene and its application, so as to provide a reference for marker-assisted selection of pork quality traits.

[0006] The technical solution of the present invention is as follows:

[0007] The first aspect of the present invention provides a SNP molecular marker in the pig SELENBP1 gene related to the pig intramuscular fat trait. The SNP molecular marker is located in the partial DNA sequence of the second intron of the pig SELENBP1 gene and contains a nucleotide sequence with a polymorphism of C / T at position 362 as shown in SEQ ID NO.1.

[0008] In the above-mentioned SNP molecular markers, the genotype of the polymorphic site is TT, corresponding to high intramuscular fat content, and the genotype is CC, corresponding to low intramuscular fat content.

[0009] The second aspect of the present invention provides a set of primer pairs for detecting pig intramuscular fat traits, wherein the primer pairs are used to detect the SNP molecular markers described in the present invention.

[0010] Preferably, the primer pair uses the pig genome as a template and can obtain a sequence as shown in SEQ ID NO.1 through PCR amplification; specifically, the primer pair includes an upstream primer with a sequence as shown in SEQ ID NO.2 and a downstream primer with a sequence as shown in SEQ ID NO.3.

[0011] The third aspect of the present invention provides a kit for detecting pig intramuscular fat traits, which comprises primers for detecting the SNP molecular markers of the present invention, and may also comprise reagents for PCR amplification, including but not limited to DNA polymerase, PCR reaction buffer, dNTP, etc.

[0012] The fourth aspect of the present invention provides the use of the SNP molecular marker, primer pair, and kit of the present invention, comprising any of the following:

[0013] 1) Application in detecting or assisting in detecting the intramuscular fat content of pigs;

[0014] 2) Application in pig breeding, genetic improvement or molecular marker-assisted selection;

[0015] 3) Application in screening pigs with high intramuscular fat content or eliminating pigs with low intramuscular fat content.

[0016] The fifth aspect of the present invention provides a method for identifying pig intramuscular fat content, specifically: detecting the genotype of a SNP molecular marker associated with the pig intramuscular fat trait, wherein the polymorphic site of the SNP molecular marker is located at the rs327549410 site of the pig SELENBP1 gene;

[0017] Wherein, the genotype of the polymorphic site of the SNP molecular marker is TT, corresponding to high intramuscular fat content, and the genotype is CC, corresponding to low intramuscular fat content.

[0018] Preferably, the above method comprises the following steps:

[0019] S1. Using the genomic DNA extracted from the sample to be tested as a template, PCR amplification is performed using primers with sequences as shown in SEQ ID NOs. 2 to 3;

[0020] S2. Using the PCR product as a template, read the amplified sequence through SANGER sequencing to obtain the genotype.

[0021] The beneficial effects of the present invention are:

[0022] The present invention discovered a SNP molecular marker (rs327549410) in the second intron of the pig SELENBP1 gene that is associated with the pig intramuscular fat trait. The SNP molecular marker is located in a partial DNA sequence of the second intron of the pig SELENBP1 gene and is significantly associated with the pig intramuscular fat trait. It can be seen that the present invention provides a new molecular breeding marker for marker-assisted breeding of pig intramuscular fat traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 It is the agarose gel electrophoresis pattern of the sequence fragment of SEQ ID NO.1 in the pig SELENBP1 gene;

[0024] Figure 2 This is the SANGER sequencing reading result diagram of the rs327549410 site of the pig SELENBP1 gene, where Figure A is the CC genotype, Figure B is the CT genotype, and Figure C is the TT genotype. DETAILED DESCRIPTION

[0025] In order to better understand the present invention, the content of the present invention is further explained below in conjunction with specific embodiments and drawings. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0026] Unless otherwise specified, the examples are based on conventional experimental conditions. All reagents and materials used, unless otherwise specified, can be obtained from commercial sources.

[0027] Example 1 Acquisition of porcine SELENBP1 gene fragments and establishment of a polymorphism detection method

[0028] 1. Extraction of pig genomic DNA.

[0029] The experimental pig breed of the present invention is a new breed of Selenium City Black Pig jointly bred by the Animal Husbandry and Veterinary Research Institute of Hubei Academy of Agricultural Sciences and Hubei Tianzhili High-quality Pig Breeding Co., Ltd. The pig genomic DNA was extracted using an animal tissue genomic DNA kit produced by Beijing Qingke Xinye Biotechnology Co., Ltd. (operated according to the kit instructions).

[0030] 2. Obtaining the pig SELENBP1 gene fragment.

[0031] (1) PCR amplification.

[0032] The following primer pairs were designed based on the genomic sequence of the porcine SELENBP1 gene (GenBank accession number: NC_010446.5):

[0033] Amplify the upstream primer of SEQ ID NO.1 sequence: 5'-CAAACTAACAGGGCAAAGAA-3' (SEQ ID NO.2);

[0034] Amplify the downstream primer of SEQ ID NO.1 sequence: 5'-GAAAGAGGGTATGGCTATAAAA-3' (SEQ ID NO.3).

[0035] The above primers were used to perform PCR amplification in the genomic DNA of Xidu Black Pig. The PCR reaction system was 50 μL, and the concentrations of the components in the system were 100 ng template DNA, 10× buffer (containing Mg 2+ )4μL, 0.5μM each of the upstream and downstream primers mentioned above, 2.5μM dNTPs, and 1U TaqDNA polymerase.

[0036] The PCR operation program was as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 45 s, 35 cycles; extension at 72°C for 10 min; and storage at 4°C.

[0037] (2) Purification of PCR products.

[0038] The above PCR products were purified using the Gel Extraction Kit from Shanghai Sangon Biotechnology Co., Ltd. For specific steps, see the kit instructions.

[0039] 3. After purification, the PCR products were purified and the molecular markers were detected by SANGER sequencing.

[0040] The recovered PCR product was submitted to Beijing Aoke Dingsheng Biotechnology Co., Ltd. for SANGER sequencing. The SEQ ID NO.1 of the present invention is specifically:

[0041] CAAACTAACAGGGCAAAGAAGTTTAGCTGGCCTGCACTGGCTTCTGAAAACCTAATTGTGTAAATCTCTTCCCAGTTTCATGTTTAATGATGGCATCTTGATAGCTTGAAATCAGTAGTATTCACACCACAAAATTGGCAAGTGATACAAATTAAAAACACACATACACAAAACATAGGAAGGAAATATGAGTAGAAACTGCTGTTCTCATTTTTAAT TAAACTTCTTATTTTGAGACAATTATATATTCGCATGGAGTTATAAAAAATAATCCAGAAAGATCCAGTTTCTCCCAGTAGTAACATCTTGCAAAACTAGAGTACACTATCACAGCCAGGAAATTGAAATCCATGTAGTCAATAC / TAGAGCATTTTTATCACCACAGGGATCTCTCATGTTGCCCTTTTATAGCCATACCCTCTTTC (423bp in total).

[0042] Example 2 Detection of polymorphic distribution of SNP molecular markers in Selenium City black pigs

[0043] In this example, the polymorphism of the second intron rs327549410 site of the pig SELENBP1 gene was detected in Xidu black pigs. The detection results are shown in Table 1.

[0044] Table 1 Genotype frequency and allele frequency of rs327549410 locus of SELENBP1 gene in Sedu black pigs

[0045]

[0046] The results in Table 1 show that the rs327549410 locus of the SELENBP1 gene in Sedu Black Pig showed three genotypes: CC, CT or TT, and the frequency of the C allele was 0.74.

[0047] Example 3 Association analysis and application of SNP molecular markers with pig intramuscular fat traits

[0048] In order to determine whether the rs327549410 site of the pig SELENBP1 gene is related to the difference in pig intramuscular fat, the method established in Example 1 was used to perform polymorphism detection, and the correlation between different genotypes of the rs327549410 site of the pig SELENBP1 gene and the pig intramuscular fat trait was analyzed. The variance analysis of different SNP genotype combinations was performed using the SAS statistical software (SAS Institute Inc, Version 9.1) GLM program, and a significance test was performed. The model used was:

[0049] Y ij =μ+G i +D j +W j +e ij ;

[0050] Where Y ij is the phenotypic value of the trait, μ is the mean value, G i is the genotype effect (including gene additive effect and dominant effect; additive effect uses 1, 0 and -1 to represent CC, CT and TT genotypes respectively, and dominant effect uses 1, -1 and 1 to represent CC, CT and TT genotypes respectively); D j is the effect of slaughter age; W j is the slaughter weight effect; e ij is the residual effect.

[0051] An association analysis between different genotypes and intramuscular fat traits was conducted in Sedu Black Pigs. The statistical analysis results are shown in Table 2.

[0052] Table 2- Association analysis between the rs327549410 locus of the SELENBP1 gene and intramuscular fat traits in pigs

[0053]

[0054] Note: A and B indicate significant difference (P<0.05), * indicates significant difference (P<0.05).

[0055] As can be seen from Table 2, in Sedu Black Pigs, the intramuscular fat of the TT genotype at the rs327549410 locus was significantly higher than that of the CC genotype (P<0.05). The T allele is the dominant allele in this population. Therefore, individuals carrying the T allele should be retained in breeding, which is conducive to improving the intramuscular fat content of the population.

[0056] In summary, the polymorphism of the rs327549410 site of the SELENBP1 gene provided by the present invention is significantly correlated with the intramuscular fat content of pigs and can be used as a molecular marker for the intramuscular fat trait of pigs. It can be seen that the present invention provides a new molecular breeding marker for marker-assisted breeding of intramuscular fat traits of pigs.

[0057] The above implementation cases are only for illustrating the technical solutions and features of the present invention, and their purpose is to enable people familiar with the technology to implement them better. They cannot be used to limit the protection scope of the present invention. All equivalent changes or modifications made according to the spirit of the present invention are within the protection scope of the present invention, and those not described in detail are prior art.

Claims

1. Application of a SNP molecular marker related to pig intramuscular fat traits in the pig SELENBP1 gene or a primer pair for detecting the SNP molecular marker in detecting or assisting in detecting pig intramuscular fat content, wherein the SNP molecular marker is located in the second intron of the pig SELENBP1 gene and contains a nucleotide sequence with a polymorphism of C / T at position 362 of the sequence as shown in SEQ ID NO.

1.

2. Application of a SNP molecular marker related to pig intramuscular fat traits in the pig SELENBP1 gene or a primer pair for detecting the SNP molecular marker in pig breeding, genetic improvement or molecular marker-assisted selection, wherein the SNP molecular marker is located in the second intron of the pig SELENBP1 gene and contains a nucleotide sequence with a polymorphism of C / T at position 362 of the sequence shown in SEQ ID NO.

1.

3. The use of a SNP molecular marker related to the intramuscular fat trait of pigs in the pig SELENBP1 gene or a primer pair for detecting the SNP molecular marker in screening pigs with high intramuscular fat content or eliminating pigs with low intramuscular fat content, wherein the SNP molecular marker is located in the second intron of the pig SELENBP1 gene and contains a nucleotide sequence with a polymorphism of C / T at position 362 of the sequence shown in SEQ ID NO.

1.

4. A method for identifying the intramuscular fat content of pigs, characterized in that: Detecting the genotype of a SNP molecular marker associated with pig intramuscular fat traits, wherein the polymorphic site of the SNP molecular marker is located at the rs327549410 site of the pig SELENBP1 gene; The genotype of the polymorphic site of the SNP molecular marker is TT, corresponding to high intramuscular fat content, and the genotype is CC, corresponding to low intramuscular fat content.

5. The method according to claim 4, characterized in that The following steps are involved: S1. Using the genomic DNA extracted from the sample to be tested as a template, PCR amplification is performed using primers with sequences as shown in SEQ ID NOs. 2 to 3; S2. Using the PCR product as a template, read the amplified sequence through SANGER sequencing to obtain the genotype.

Images