Application of ORF12 gene in controlling drought resistance of rice

Abstract

The application relates to the technical field of rice genetic engineering. ORF12 The application discloses application of a gene in controlling drought resistance of rice. ORF12 The applicant identifies a gene capable of improving drought tolerance of rice through separation, cloning and function verification ORF12 , and application of the gene in genetic improvement of drought resistance of rice. ORF12 Through drought phenotype identification of a CRISPR mutant of the gene, overexpression and introduction of a line material, potting and field drought stress experiments in the booting stage show that the gene is a positive regulation factor for drought response of rice, and the function and application approach of the gene are verified.

Description

Technical Field

[0001] This invention belongs to the field of rice genetic engineering technology, specifically involving the application of the ORF12 gene in controlling drought resistance in rice. Through drought phenotype identification of CRISPR mutants, overexpression lines, and introduction lines of ORF12, pot and field drought stress experiments at the booting stage demonstrated that ORF12 is a positive regulator of rice drought response, confirming the function and application pathway of this gene. Background Technology

[0002] Crops grow in a sessile manner and are susceptible to drought at any stage of their life cycle. Plants exhibit significantly different tolerances to drought stress at different developmental stages. For example, drought stress during the seedling stage directly affects seedling emergence and growth; short-term water shortages during the vegetative growth stage do not cause significant yield losses, while drought stress from panicle differentiation to heading stage severely impacts yield. For rice, the most important research focus is on its drought resistance during the booting stage. Crops are affected by numerous environmental factors during their growth; drought, chilling injury, and high temperatures can lead to large-scale yield reductions, and in many regions, these environmental factors are bottlenecks to agricultural development. Developing stress-resistant crop varieties has always been one of the main goals of agricultural science and technology research. Throughout their long evolutionary history, crops have been subjected to various abiotic stresses. For survival and reproduction, plants need to evolve a system for recognizing, transmitting, amplifying, and controlling stress signals to respond to, adapt to, and defend against various adverse environments (Nakashima et al., 2014). The prevailing view is that the general response process of plants to abiotic stress involves plants recognizing various stress signals through various unknown sensors, and then producing substances such as calcium within the cell. 2+ Second messengers such as reactive oxygen species (ROS) and ABA transmit signals, which then affect the activity of downstream stress-related transcription factors through phosphorylation cascades or modifications such as ubiquitination. These active transcription factors can, on the one hand, specifically bind to and regulate the expression of other transcription factors, thereby forming a complex and orderly regulatory network that activates multi-layered regulatory pathways in response to stress signals; on the other hand, they can also specifically activate some functional genes involved in stress, synthesizing substances that can resist stress damage, such as regulating osmotic pressure (Hirayama and Shinozaki 2010; Huang et al 2012).

[0003] With the advancement of research on plant stress signaling pathways, recent studies have begun to reveal the molecular crossover between the regulatory mechanisms of biotic and abiotic stress responses and combined stress responses. Some scholars have broadly outlined the environmental regulatory mechanisms of plant immunity and the novel roles of immunomodulators in abiotic stress tolerance (Saijo and Loo 2020). NLR (nucleotide-binding, leucine-rich repeat) genes constitute a very large gene family in plants. During rice evolution, these genes have mostly replicated in a tandem repeat manner, leading to significant differences in the number of NLR genes in rice populations (Stein et al 2018). Typical NLR gene structures include: (I) CC-NBS-LRR type: These genes share the characteristic of having a coiled-coil domain in the N segment of the protein, followed by one or more nucleotide binding sites, and a leucine-rich repeat sequence at the C-terminus. (II) TIR-NBS-LRR type: These genes are structurally similar to the first type, except that the coiled structure is replaced by a Toll / IL-1receport, TIR domain. (III) NBS-LRR type: This type differs from the previous two in that the N-terminus of the protein lacks obvious CC and TIR domains. Currently, reports on NLR genes mainly focus on plant immune responses. However, some studies have found that NLRs are involved in abiotic stress. As early as 2004, scientists discovered that some plant NLRs also have a "dual identity." Chini et al. found that the NLR gene ADR1 positively regulates drought resistance in Arabidopsis thaliana (Chini et al 2004). In Arabidopsis thaliana, Ariga conducted a genome-wide association study on salt tolerance and identified an NLR locus containing four NLR genes. Through genetic and molecular biological methods, it was demonstrated that one of the NLR genes, ACQOS, negatively regulates salt-induced osmotic responses. Analysis of natural variations at the ACQOS locus showed that functional and non-functional ACQOS alleles maintain the trade-off between adaptation to biotic and abiotic stresses (Ariga et al 2017). This invention will fill the gap in the field of NLR gene involvement in crop drought resistance and provide gene resources for improving crop drought resistance.

[0004] The contradiction between water scarcity and crop water use is becoming increasingly prominent due to the exacerbation of extreme global climate change and the continuous increase in population. Discovering drought-resistant genes, improving crop drought resistance, and breeding new water-saving and drought-resistant crop varieties are effective ways to resolve this contradiction. The ORF12 gene involved in this invention belongs to the rice NLR protein family. Although there are some reports on the function of this type of protein in plants, few have been successfully used to improve the drought resistance of rice.

[0005] This invention isolates the ORF12 gene from rice and successfully identifies its function in improving rice stress resistance through transgenic materials and introduction lines. This will be of great significance for breeding new stress-resistant rice varieties and even for the genetic improvement of plant stress resistance. Summary of the Invention

[0006] The purpose of this invention is to provide the application of the ORF12 protein or the gene encoding the ORF12 protein in regulating the drought resistance of rice, wherein the ORF12 protein is shown in SEQ ID NO.2.

[0007] Another object of the present invention is to provide the application of the ORF12 protein in rice or the gene encoding the ORF12 protein in the preparation of drought-resistant transgenic rice, wherein the ORF12 protein is shown in SEQ ID NO.2.

[0008] To achieve the above objectives, the present invention adopts the following technical measures:

[0009] The scope of protection of this invention includes:

[0010] The application of ORF12 protein or the gene encoding ORF12 protein in rice in regulating rice drought resistance, wherein the ORF12 protein is shown in SEQ ID NO.2;

[0011] The applications described above are specifically as follows:

[0012] Increasing the expression level of ORF12 protein in rice can improve the drought resistance of rice.

[0013] Inhibiting or reducing the expression of ORF12 protein in rice can weaken the drought resistance of rice.

[0014] Increasing the expression level of the gene encoding the ORF12 protein in rice can improve the drought resistance of rice.

[0015] Knocking out, suppressing, or silencing the expression of the gene encoding the ORF12 protein in rice can reduce the drought resistance of rice.

[0016] In the above-described applications, preferably, the knockout is performed using the CRISPR / Cas9 system, where the target site of the gRNA is GGAATCGCTAATCCTCCCCATGG.

[0017] In the applications described above, the drought-resistant rice edited by the CRISPR / Cas9 system has polynucleotides as shown in SEQ ID NO. 3, SEQ ID NO. 4, or SEQ ID NO. 5.

[0018] The application of ORF12 protein or the gene encoding ORF12 protein in the preparation of drought-resistant transgenic rice, specifically, is the introduction of substances that increase the expression level of ORF12 protein in rice into rice.

[0019] In the above-described applications, preferably, the substance is a nucleic acid molecule containing an encoding ORF12 protein, or its expression cassette, recombinant vector, or recombinant microorganism;

[0020] The nucleic acid molecule encoding the ORF12 protein is shown in SEQ ID NO.1.

[0021] Compared with the prior art, the present invention has the following advantages:

[0022] The applicant disclosed for the first time that the ORF12 gene of rice is related to the drought resistance of rice. This gene can be transformed into a variety of plants, including rice, for the purpose of breeding new drought-resistant plant varieties. Attached Figure Description

[0023] Figure 1 Gene editing status of rice ORF12 CRISPR mutant;

[0024] C1, C2, and C3 are three homozygous families of ORF12 CRISPR mutants.

[0025] Figure 2 Normal and drought-stressed phenotypes of rice ORF12 CRISPR mutant materials in pots during the booting stage;

[0026] C1, C2, and C3 are three homozygous families of ORF12 CRISPR mutants (ORF12C), with wild-type Zhonghua 11 (ZH11) serving as a control.

[0027] (a) Phenotypes of wild-type ZH11 and mutant ORF12C materials before, after, and after rehydration under drought stress in pots; scale bar = 12 cm;

[0028] (b) Comparison of TBR_R (TBR: total area / area of ​​boundary rectangle (reflecting the degree of leaf curling), suffix "_R": drought value / value before drought stress) between wild-type ZH11 and mutant materials (C1, C2 and C3) after pot drought stress;

[0029] (c) Comparison of GPAR_R (GPAR: green leaf area / total leaf area, suffix "_R": drought value / pre-drought value) between wild-type ZH11 and mutant materials (C1, C2 and C3) after pot drought stress;

[0030] (d) Comparison of seed setting rate of wild-type ZH11 and mutant materials (C1, C2 and C3) under normal pot cultivation (_N) and drought stress (_D);

[0031] (e) Comparison of single-plant yields of wild-type ZH11 and mutant materials (C1, C2, and C3) under normal (_N) and drought stress (_D); n in the figure represents biological replicates; significance test of t-test, *: P<0.05, **: P<0.01, ***: P<0.001, ns: P>0.05. Figure 3 Rice ORF12 overexpression material (ORF12) TG OE) Normal and drought-stressed phenotypes in potted plants during the booting stage;

[0032] ORF12 TG OE-25, ORF12 TG OE-28 and ORF12 TG OE-50 represents three homozygous overexpressing families with single-copy ORF12 (ORF12) TG OE), with wild-type Zhonghua 11 (ZH11, i.e. OE-WT) as the control.

[0033] (a) ORF12 overexpression family TG OE-25, ORF12 TG OE-28 and ORF12 TG A schematic diagram of the relative expression levels of ORF12 in OE-50; the error bars represent the standard deviations (SDs) of three independent experiments.

[0034] (b) Wild-type ZH11 and ORF12 overexpression material (ORF12) TG OE) Phenotypes of potted plants before drought stress, after drought stress, and after rehydration; scale bar = 12cm;

[0035] (c) Wild-type ZH11 and ORF12 overexpression material (ORF12) TG OE-25, ORF12 TG OE-28 and ORF12 TG Comparison of TBR_R in potted plants after drought stress (OE-50);

[0036] (d) Wild-type ZH11 and ORF12 overexpression material (ORF12) TG OE-25, ORF12 TG OE-28 and ORF12 TG Comparison of GPAR_R in potted plants after drought stress (OE-50);

[0037] (e) shows the overexpression material of wild-type ZH11 and ORF12 (ORF12).TG OE-25, ORF12 TG OE-28 and ORF12 TG Comparison of single-plant seed setting rate of OE-50 after normal potting (_N) and drought re-watering (_D);

[0038] (f) shows wild-type ZH11 and ORF12 overexpression materials (ORF12) TG OE-25, ORF12 TG OE-28 and ORF12 TG Comparison of single-plant yield of OE-50 after normal pot cultivation (N) and drought re-watering (D);

[0039] In the figure, n represents biological replicates; the significance of the t-test is as follows: *: P<0.05, **: P<0.01, ***: P<0.001, ns: P>0.05. Figure 4 Rice ORF12 CRISPR mutant (ORF12C) and ORF12 overexpression material (ORF12) TG OE) Field drought stress phenotype during the booting stage;

[0040] C1, C2, and C3 are three homozygous families with ORF12 CRISPR mutants (ORF12C). TG OE-25, ORF12 TG OE-28 and ORF12 TG OE-50 represents three homozygous overexpressing families with single-copy ORF12 (ORF12) TG OE), with wild-type Zhonghua 11 (ZH11) as a control;

[0041] (a) Displaying the CRISPR mutant (C1), wild-type ZH11, and overexpression of ORF12 TG Phenotypes of OE-25 material before drought stress and during the re-watering recovery stage in dryland fields;

[0042] (b) Mutants (C1, C2, and C3), wild-type ZH11, and overexpression (ORF12) TG OE-25, ORF12 TG OE-28 and ORF12 TG Evaluation of the seed setting rate of OE-50 material under normal growth (N) and drought (D) conditions in the field;

[0043] (c) Mutants (C1, C2, and C3), wild-type ZH11, and overexpression (ORF12) TG OE-25, ORF12 TG OE-28 and ORF12 TGEvaluation of plot yield of OE-50 material under normal growth (N) and drought (D) conditions in the field;

[0044] In the figure, n represents biological replicates; the significance of the t-test is as follows: *: P<0.05, **: P<0.01, ***: P<0.001, ns: P>0.05. Figure 5 ORF12 under the background of rice MH63 T Phenotypic characteristics of imported lines under drought stress in potted plants during the booting stage;

[0045] NIL_ORF12 T As the introductory line, the recurrent parent MH63 was used as a control;

[0046] (a) MH63 and the introductory material NIL_ORF12 T Phenotypes of potted plants before and after drought stress, scale bar = 12cm;

[0047] (b) For MH63 and import system NIL_ORF12 T Comparison of TBR_R of plants after drought stress in potted plants;

[0048] (c) For MH63 and import system NIL_ORF12 T Comparison of GPAR_R of plants after drought stress in potted plants;

[0049] (d) refers to MH63 and the import system NIL_ORF12 T Comparison of seed setting rate per plant under normal pot conditions (N) and drought stress (D);

[0050] (e) refers to MH63 and the import system NIL_ORF12 T Comparison of yield per plant under normal pot conditions (N) and drought stress (D);

[0051] In the figure, n represents biological replication; asterisks indicate significant differences in t-tests, **: P < 0.01, ***: P < 0.001, ns: P > 0.05. Detailed Implementation

[0052] The following embodiments define the present invention and describe the methods for constructing ORF12 CRISPR mutants, cloning DNA fragments containing the complete coding region of the ORF12 gene, and verifying the function of the ORF12 gene. Based on the following description and these embodiments, those skilled in the art can determine the essential features of the present invention, and various changes and modifications can be made to the invention to suit different uses and conditions without departing from the spirit and scope thereof.

[0053] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field; unless otherwise specified, the reagents or materials described are all from commercial sources.

[0054] Example 1:

[0055] Isolation and cloning of the ORF12 gene:

[0056] Using cDNA from leaves of the rice variety Nipponbare as a template, the CDS sequence encoded by the ORF12 gene was amplified by PCR using primers CDS-F:ATGGCGGAATCGCTAATCCT and CDS-R:TTAGATTCCAGACCTTGATT. The amplified sequence contained the CDS sequence shown in SEQ ID NO.1 and encoded the protein shown in SEQ ID NO.2.

[0057] The PCR reaction conditions were as follows: 95℃ pre-denaturation for 3 min; 94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 1 min, 33 cycles; extension at 72℃ for 5 min. The amplified PCR product was ligated into the pGEM-T Easy vector (purchased from Promega), positive clones were screened and confirmed by sequencing, and the ORF12 CDS sequence was obtained.

[0058] The applicant named the clone pGEM-ORF12 plasmid.

[0059] Example 2:

[0060] Construction of the ORF12 gene overexpression vector:

[0061] The specific steps for constructing the overexpression vector are as follows: First, the positive clone pGEM-ORF12 plasmid obtained in Example 1 was amplified using primers ORF12-OE-F (TACGAACGATAGCCGGTACCATGGCGGAATCGCTAATCCT) and ORF12-OE-R (TTGCGGACTCTAGAGGATCCTTAGATTCCAGACCTTGATT) to generate a DNA fragment containing the full length of ORF12. The reaction conditions were: 94℃ pre-denaturation for 3 min; 94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 1 min, 30 cycles; 72℃ extension for 5 min.

[0062] The fragment was ligated using Gibson Assembly with the pCAMBIA1301U vector (source) digested with restriction endonucleases KpnI and BamHI. After sequencing confirmation, the vector was ready for genetic transformation.

[0063] Example 3:

[0064] Construction of the ORF12 CRISPR vector

[0065] The ORF12 gene sequence was obtained from the Rice Data database (http: / / www.ricedata.cn / gene / ). Target sites were selected using CRISPR-P v2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ). Vector construction for CRISPR mutant lines can be referred to relevant literature (Xie Kabin et al. Boosting CRISPR / Cas9 multiplex editing capability with the endogenous tRNA-processing system. PNAS. 2015, 112:3570-3575.), and will not be described in detail here due to space limitations. The target sites selected on the CRISPR-Pv2.0 website are as follows:

[0066] Target site: GGAATCGCTAATCCTCCCCATGG.

[0067] Example 4:

[0068] Transformation of plasmid vectors and positive detection of transgenic plants

[0069] Using Agrobacterium-mediated rice genetic transformation, the constructed overexpression vector and CRISPR vector were transferred into the rice variety "Zhonghua 11" (a publicly available rice variety provided by the China National Rice Research Institute). After pre-culture, infection, co-culture, screening for hygromycin-resistant callus, differentiation, rooting, hardening-off, and transplanting, transgenic plants were obtained.

[0070] The above-mentioned Agrobacterium-mediated genetic transformation method (system) for rice (Zhonghua 11) was improved based on the method reported by Hiei et al. (Hiei et al., Efficient transformation of rice, Oryza sativa L., mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA, Plant J, 6:271-282, 1994).

[0071] The specific genetic transformation steps in this embodiment are as follows:

[0072] (1) Electrotransformation: The final genetic transformation vector was electrotransformed into Agrobacterium EHA105 strain at 1800V, plated onto LA medium with corresponding resistance selection, and positive clones were screened for use in the following transformation callus.

[0073] (2) Callus induction: The mature rice seeds of Zhonghua 11 (a publicly used rice variety provided by the China National Rice Research Institute) were dehulled, and then treated with 70% ethanol for 1 minute, and the seed surface was disinfected with 0.15% mercuric chloride (HgCl2) for 15 minutes. The seeds were washed with sterile water 4-5 times. The disinfected seeds were placed on the induction medium (components are listed below). The inoculated callus induction medium was placed in the dark for 4 weeks at a temperature of 25±1℃.

[0074] (3) Callus subculture: Select bright yellow, firm and relatively dry embryogenic callus, place it on subculture medium (components are listed below) and culture it in the dark for 2 weeks at a temperature of 25±1℃.

[0075] (4) Pre-culture: Select firm and relatively dry embryogenic callus and place it on pre-culture medium (components are listed below) and culture it in the dark for 2 weeks at a temperature of 25±1℃.

[0076] (5) Agrobacterium culture: Pre-culture Agrobacterium EHA105 (derived from CAMBIA, a commercial strain carrying the vector of the present invention) on LA medium with corresponding resistance selection (components are listed below) for two days at a culture temperature of 28°C; transfer the Agrobacterium to suspension medium (components are listed below) and culture on a shaker at 28°C for 2-3 hours.

[0077] (6) Agrobacterium infection: Transfer the pre-cultured callus to a sterilized bottle; adjust the Agrobacterium suspension to OD. 600 0.8-1.0; Soak the callus in Agrobacterium suspension for 30 minutes; Transfer the callus to sterilized filter paper and blot dry; Then place it on co-culture medium (components see below) and incubate for 3 days at a temperature of 19-20℃.

[0078] (7) Callus washing and selection culture: Wash the callus with sterile water until Agrobacterium is no longer visible; soak in sterile water containing 400 ppm carbenicillin (CN) for 30 minutes; transfer the callus to sterile filter paper and blot dry; transfer the callus to selection medium (components are listed below) and select 2-3 times, each time for 2 weeks (the concentration of carbenicillin for the first screening is 400 ppm, and the concentration of hygromycin is 250 ppm for the second and subsequent screenings).

[0079] (8) Differentiation: Transfer the resistant callus to a pre-differentiation medium (components below) and culture in the dark for 5-7 weeks; transfer the pre-differentiated callus to a differentiation medium (components below) and culture under light at a temperature of 26℃.

[0080] (9) Rooting: Cut off the roots that are produced during differentiation; then transfer them to a rooting medium and culture them under light for 2-3 weeks at a temperature of 26℃.

[0081] (10) Transplanting: Wash off the residual culture medium on the roots and transfer the seedlings with good root systems to the greenhouse, while keeping them moist for the first few days.

[0082] Positive detection of genetically modified plants

[0083] (1) In order to detect the expression level of the target gene in the overexpressed transgenic plants, the applicant used Real-time PCR to analyze the expression of the transgenic T0 generation plants. The total RNA used in the experiment was seedling RNA, and the ORF12 was detected by real-time quantitative PCR after reverse transcription.

[0084] The PCR parameters were: 95℃ pre-denaturation for 10 seconds, followed by 95℃ denaturation for 5 seconds, 60℃ annealing and extension for 30 seconds, for 40 cycles. The primer sequences used for real-time PCR were:

[0085] ORF12-QF:ATTGGAAACACGGTGCAGAGORF12-QR:TTTTCGCTGCTGCTGGAATG.

[0086] The expression levels of the target gene were detected in the T0 and T1 generations of transgenic plants. The ORF12 expression results in the T1 generation overexpression transgenic plants are shown in the figure. Figure 3 (a) Real-time PCR results showed that the overexpression family ORF12 was present in the transgenic material. TG OE-25, ORF12 TG OE-28 and ORF12 TG The expression of ORF12 in OE-50 single plants was significantly higher than that in wild-type Zhonghua 11 (ZH11), indicating that the overexpression effect was very good.

[0087] (2) To detect gene editing in CRISPR mutant plants, total DNA was extracted from leaves of T0 and T1 generation transformed plants using the CTAB method (Zhang et al., genetic diversity and differentiation of *Indica an japonica* rice detected by RFLP analysis, 1992, Theor Appl Genet, 83, 495-499). Using the total leaf DNA as a template, PCR was performed on T0 and T1 generation CRISPR transformed plants using the following primers for positive detection.

[0088] The primer sequences are as follows:

[0089] ORF12-CRI-F:CACCCACAAAGAAACTAAGATT;

[0090] ORF12-CRI-R:GCGTTGAGGTCCTTCATCCA;

[0091] All primers were synthesized by Qingke Biotechnology Co., Ltd.

[0092] The total volume of the PCR reaction was 20 μl. The specific preparation method was as follows: 100 ng template, 2 μl 10x PCR buffer, 1.6 μl 10 mM dNTPs, 1.5 μl 2.5 mM Mg2+, 0.4 μl each of forward and reverse primers (ORF12-CRI-F and ORF12-CRI-R), 0.2 μl r-Taq enzyme, and deionized water to a final volume of 20 μl (all PCR buffer, dNTPs, Mg2+, and r-Taq enzyme were purchased from Takara Bio Engineering Co., Ltd., Dalian). The PCR reaction conditions were as follows: ① 94℃ for 4 minutes, ② 94℃ for 30 seconds, ③ 57℃ for 30 seconds, ④ 72℃ for 1 minute, ⑤ cycle ②–④ 32 times, ⑥ 72℃ for 7 minutes, ⑦ store at 4℃. PCR products were detected by electrophoresis on a 1% (w / v) TBE agarose gel. The amplified fragments were sent to a sequencing company for sequencing, and the sequencing results were compared with a reference sequence to determine the genotype. In the transgenic T1 generation plants, homozygous mutant families C1 (containing the gene shown in SEQ ID NO.3), C2 (containing the gene shown in SEQ ID NO.4), and C3 (containing the gene shown in SEQ ID NO.5) were obtained. The sequencing results are as follows: Figure 1 As shown.

[0093] Example 5:

[0094] Methods for identifying drought resistance of rice genetic materials in pots during the booting stage

[0095] The pot drought resistance assessment of the relevant materials was completed on the rice phenotyping platform.

[0096] The tested materials were sown in bread pots for seedling cultivation and transplanted into medium-sized blue buckets after 25 days. Each bucket contained 4.5 kg of air-dried soil (bucket weight 0.2 kg), which was soaked two days before transplanting. At transplanting, one rice seedling was planted in each medium-sized blue bucket, with 12 seedlings planted per family. Six seedlings were subjected to drought stress (treatment group), and six seedlings grew normally (normal group). During the rice tillering stage, 150 ml of liquid fertilizer was added to each bucket. The liquid fertilizer formula was 371 g urea, 331 g KH2PO4, and 94 g KCl, and then water was added to a volume of 60 L. When the rice entered the panicle differentiation stage, the water in the treatment group buckets was drained. In the early stage of drought treatment, each bucket of material was weighed at 5.8 kg (including bucket weight) to begin drought stress, and then the weight was slowly reduced to 5.4 kg (including bucket weight). After that, depending on the weather conditions, 50 ml or 100 ml of water was poured into each bucket in the evening for 7-10 days of drought shaking. After the drought treatment ended, the rice was rehydrated, and 7 days after rehydration, both the treatment and normal groups were given an additional 150 ml of liquid fertilizer. In this experiment, the materials were transported to the rice phenotyping platform before stress, under severe stress, and after rehydration to obtain I-traits. Finally, at maturity, data such as single-plant yield and seed setting rate were harvested.

[0097] Example 6:

[0098] Methods for identifying drought resistance in rice genetic materials during the booting stage in the field

[0099] The field drought resistance assessment of the relevant materials was completed in the drought-resistant greenhouse.

[0100] The tested materials were sown in seedbeds and transplanted to drought-resistant ponds 25 days later. Field planting followed a plot pattern with 4 rows and 4 plants per plot. Five plots were randomly assigned to each family. Irrigation was stopped when the materials reached the jointing stage, and the drainage valves were opened to remove surface water and begin stress treatment. During rainy days, the movable rain-shielding devices of the drought-resistant greenhouses were opened to ensure protection from rain during stress. After drought stress, the rice's response to drought was dynamically monitored using a drone phenotyping platform. When either the control or the transgenic material exhibited irreversible leaf curling, the drought stress was maintained for another 5 days before ending, initiating the re-irrigation recovery phase. Finally, at maturity, yield and other relevant data were harvested from each plot, with 6 relatively uniformly growing rice plants (excluding those on either side of the aisle) harvested to examine yield and seed setting rate data for both dryland and paddy field materials.

[0101] Example 7:

[0102] Identification of drought stress phenotypes in pot experiments during the booting stage of rice ORF 12 CRISPR mutant materials

[0103] The homozygous mutants with identified genotypes (ORF12C, i.e., C1, C2 and C3) and the wild-type transgenic recipient Zhonghua 11 (ZH11) were subjected to pot drought stress experiments according to the method in Example 5.

[0104] Phenotypic results are as follows Figure 2 As shown in Figure a, under normal conditions, there was no difference in growth between the control ZH11 and the homozygous ORF12C mutant plants; after drought stress and rehydration, the mutant materials had significantly more dead leaves than the control ZH11. After drought stress, the relative leaf curling indices of the three mutant families and the wild type were 0.074, 0.064, 0.065, and 0.097, respectively, indicating that the degree of leaf curling in the mutant materials was higher than that in the wild type after drought stress. Figure 2 (b) The relative green values ​​of the three mutant families were 0.132, 0.178, and 0.173, respectively, significantly lower than the control's 0.284. Figure 2 (c). Simultaneously, we investigated the seed setting rate and yield traits of individual plants under normal growth and drought stress conditions for the relevant materials. The results showed that, under normal growth conditions, the seed setting rate of individual plants in the mutant and wild-type materials (…) Figure 2 (d) and output ( Figure 2 (e) There was no significant difference; after drought stress treatment, the average seed setting rate of the mutant material was 26.8%, significantly lower than that of the wild type (42.5%). Figure 2 In the middle (d), the average yield per plant of the mutant material was 1.05g, which was also significantly lower than the 3.61g of the wild type. Figure 2 The above results indicate that, compared to the wild-type ZH11, the mutant material exhibits a drought-sensitive phenotype. Figure 2 ).

[0105] Example 8:

[0106] Identification of drought stress phenotypes in potted rice ORF12 overexpression materials during the booting stage

[0107] The overexpression material identified as ORF12 overexpressing (ORF12) TG OE, or ORF12 TG OE-25, ORF12 TG OE-28 and ORF12 TG OE-50) and the transgenic recipient wild-type Zhonghua 11 (ZH11) were subjected to pot drought stress experiments according to the method in Example 5.

[0108] The results are as follows Figure 3 As shown in Figure a, ORF12 overexpression families ORF12 TG OE-25, ORF12 TG OE-28 and ORF12 TG The relative expression level of ORF12 in OE-50 was significantly higher than that of ZH11. Phenotypic results are as follows: Figure 3As shown in Figure b, under normal conditions, there was no difference in growth between the control ZH11 and the ORF12-OE overexpressing plants; after drought stress and rehydration, the number of dead leaves in the overexpressing materials was significantly less than that in the control ZH11. After drought stress, the relative leaf curling indices of the three overexpressing families and the wild-type material were 0.083, 0.086, 0.085, and 0.067, respectively, indicating that the degree of leaf curling in the overexpressing materials was significantly lower than that in the wild-type material after drought stress. Figure 3 (c); the relative green scores of the three overexpression families were 0.182, 0.252, and 0.272, respectively, significantly higher than the wild-type's 0.076. Figure 3 (d). Simultaneously, we investigated the seed setting rate and yield traits of individual plants under normal growth and drought stress conditions. The results showed that under normal growth conditions, overexpression significantly increased the seed setting rate of wild-type materials (d). Figure 3 (e) and output ( Figure 3 There was no significant difference in (f) between the two groups; after drought stress treatment, the average seed setting rate of the overexpression material was 34.68%, significantly higher than that of the wild type (24.15%). Figure 2 In the study of overexpression materials, the average yield per plant was 1.786 g, significantly higher than the 1.026 g of the wild type. Figure 2 The above results indicate that, compared to wild-type ZH11, overexpression of ORF12 significantly enhances the drought resistance of rice. Figure 3 ).

[0109] Example 9:

[0110] Identification of field drought stress phenotypes in rice ORF12 CRISPR mutants and ORF12 overexpression materials during the booting stage

[0111] Homozygous mutants with identified genotypes (ORF12C, i.e., C1, C2, and C3), and overexpression materials (ORF12) were used. TG OE, or ORF12 TG OE-25, ORF12 TG OE-28 and ORF12 TG OE-50) and the transgenic recipient wild-type Zhonghua 11 were subjected to field drought stress experiments according to the method in Example 6.

[0112] Phenotypic results are as follows Figure 4 As shown in Figure a, the results of the field plot drought experiment showed that, compared with wild-type ZH11, the mutant material retained significantly less green color after drought stress treatment. However, the overexpression material retained significantly more green color than ZH11 after drought stress treatment. Figure 4 (a) Furthermore, we investigated the seed setting rate and yield traits of plots under normal growth and drought stress conditions for the relevant materials.

[0113] The results showed that, under normal growth conditions, the plot seed setting rate and yield data analysis indicated that there were differences in plot seed setting rate among mutants, wild-types, and overexpression materials. Figure 4 (b) and plot yield ( Figure 4 (c) There was no significant difference; after drought stress treatment, the average seed setting rate of the mutant material was 35.09%, significantly lower than that of the wild type (45.08%). Figure 4 In section b), the average yield of the mutant material was 23.92 g, significantly lower than the wild type's 36.96 g. Figure 4 In contrast, the average seed set rate of the overexpression material plots was 56.90%, significantly higher than that of the wild type (45.07%). Figure 4 In section b), the average yield of the overexpression material was 44.63g, significantly higher than the 35.76g of the wild type. Figure 4 (c) The above results indicate that in the field, compared with the wild-type ZH11, the mutant material exhibited a drought-sensitive phenotype, while the overexpression material showed a more drought-resistant phenotype. Figure 4 ).

[0114] Example 10: Identification of ORF12 in rice under the MH63 background T Phenotypic characteristics of imported potted plants during the booting stage under drought stress

[0115] Import NIL_ORF12 T The materials and the recurrent parent MH63 were subjected to drought stress experiments according to the method in Example 5. The drought experiment results showed the following phenotypic outcomes: Figure 5 As shown in Figure a, after drought treatment, NIL_ORF12 T The degree of leaf curling in the material is significantly lower than that in the recurrent parent material MH63, NIL_ORF12 T The average relative leaf curl index of individual plants was 0.202, significantly higher than that of the recurrent parent MH63 (0.153). Figure 5 (b) The average greenness retention of a single plant was 0.503, significantly higher than that of the recurrent parent MH63 (0.282). Figure 5 (c). Furthermore, we investigated the seed setting rate and plot yield traits of the relevant materials under normal growth and drought stress conditions.

[0116] The results showed that, under normal growth conditions, the introduced line NIL_ORF12 T The cellar set rate between the material and the recurrent parent MH63 material ( Figure 5 (d) and plot yield ( Figure 5 There was no significant difference in (e) after drought stress treatment; the imported line NIL_ORF12 showed no significant difference. T The average seed setting rate of individual plants was 70.72%, significantly higher than the 52.86% of the wild type. Figure 5 d), import system NIL_ORF12 T The average yield per plant was 12.28g, significantly higher than the 8.32g of the wild type. Figure 5 In summary, compared to the reincarnation parent HM63, the imported system NIL_ORF12... T The material exhibits stronger drought resistance. Figure 5 ).

Claims

1. The application of ORF12 protein or the gene encoding ORF12 protein in regulating drought resistance in rice, wherein the ORF12 protein is shown in SEQ ID NO.2, and the regulation is to improve the drought resistance of rice by increasing the expression level of ORF12 protein or the expression level of the gene encoding ORF12 protein in rice.

2. The application of ORF12 protein or the gene encoding ORF12 protein in rice in the preparation of drought-resistant transgenic rice, wherein the application process includes introducing a substance that increases the expression level of ORF12 protein in rice into rice, wherein the substance is a nucleic acid molecule containing encoding ORF12 protein, or its expression cassette, recombinant vector, or recombinant microorganism, and wherein the ORF12 protein is shown in SEQ ID NO.

2.

3. The application according to claim 1 or 2, wherein the gene encoding the ORF12 protein is shown in SEQ ID NO.1.

Images