A nanobody 2C10 against human adenovirus and a preparation method and application thereof
By designing the nanobody 2C10 targeting human adenovirus, the problem of lacking an effective treatment for human adenovirus type 55 in the existing technology has been solved. It achieves high affinity and neutralizing activity, providing an effective means of prevention and treatment, while supporting the diagnosis and epidemic monitoring of human adenovirus.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ACADEMY OF MILITARY MEDICAL SCIENCES
- Filing Date
- 2023-11-08
- Publication Date
- 2026-06-26
AI Technical Summary
Currently, there are no effective antiviral drugs and vaccines to prevent and treat severe infections caused by human adenovirus type 55, and existing monoclonal antibodies cannot effectively bind to conserved viral regions shielded by sugars.
A nanobody 2C10 targeting human adenovirus was developed, which has the ability to specifically bind to human adenovirus type 55. By designing its complementary determinants CDR1, CDR2 and CDR3, and fusing them with the Fc fragment of human immunoglobulin G, a nanobody fusion protein was formed.
The nanobody 2C10 exhibits high affinity and neutralizing activity, and can specifically bind to human adenovirus type 55, providing an effective means of prevention and treatment, and can be used for the diagnosis and epidemic monitoring of human adenovirus.
Smart Images

Figure HDA0004537404250000011 
Figure HDA0004537404250000012 
Figure HDA0004537404250000013
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a nanobody 2C10 targeting human adenovirus, its preparation method, and its application. Background Technology
[0002] Human adenovirus (HAdV) is a non-enveloped, linear, double-stranded DNA virus that can infect various mucosal tissues, including the respiratory tract, gastrointestinal tract, genitourinary tract, and conjunctiva. It typically causes self-limiting illness, but severe cases can lead to death. Currently, 111 different HAdV strains have been identified, which can be classified into seven species (AG) based on differences in hemagglutination characteristics, tissue trophic properties, genomic sequence, serum antibody neutralization response, and pathogen specificity. HAdV-B is associated with respiratory diseases and is further divided into B1 (HAdV-3, 7, 16, 21, and 50) and B2 (HAdV-11, 14, 34, 35, and 55). Among these, HAdV7 and HAdV55 are associated with severe respiratory infections. HAdV7 is one of the most frequently found strains associated with periodic outbreaks of acute respiratory disease (ARD) in children and adults worldwide, and is associated with diseases such as acute respiratory disease syndrome, pneumonia, and hemophagocytic lymphocytosis. HAdV55 is a novel virus derived from the recombination of adenoviruses 11 and 14. It possesses the neutralizing antigenic epitope of HAdV11 while exhibiting pathogenic characteristics of HAdV14. HAdV55 is associated with severe and fatal pneumonia in children and immunocompetent adults. Infections caused by HAdV7 and HAdV55 are generally more severe than those caused by other HAdVs. However, there are currently no specific antiviral drugs or vaccines available. Therefore, effective prevention and treatment methods are needed to combat this pathogen.
[0003] Antibodies can effectively prevent and treat viral infections. Besides traditional monoclonal antibodies, the variable domain (VHH) of the heavy chain in heavy chain antibodies offers another possibility for the production of therapeutic antibodies. VHH, also known as nanobodies, are the variable domains of heavy chain antibodies (VHH) that are naturally occurring in camel-like animals (camels, llamas, alpacas, and their close relatives) or sharks, lacking the light chain. Individually cloned and expressed VHHs possess structural stability and antigen-binding activity comparable to the original heavy chain antibody. The small size of nanobodies allows them to bind to epitopes that are typically inaccessible to traditional antibodies, such as conserved viral regions often shielded by sugars. Nanobodies have been used in various biotechnological applications, including basic research, diagnostics, and therapy. In 2018, the FDA approved the first bivalent nanobody, Caplacizumab, for the treatment of thrombotic thrombocytopenic purpura. Ablynx's bispecific nanobody, Ozoralizumab (Nanozora), was also approved for marketing in Japan in 2022, demonstrating the practicality of nanobodies and their fusion proteins. Nanobodies are also being used in research on the prevention and treatment of infections caused by bacteria and viruses. For example, there has been extensive research on the antiviral activity of nanobodies against various difficult-to-treat viruses, including human immunodeficiency virus-1 (HIV-1), chikungunya virus, human respiratory syncytial virus (RSV), Middle East respiratory syndrome coronavirus (MERS-CoV), and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). This project utilizes nanobody technology to develop human adenovirus antibodies to enrich the methods for the prevention and treatment of adenovirus infections. Summary of the Invention
[0004] The main problem to be solved by this invention is to develop a nanobody that can specifically bind to human adenovirus type 55 and play a role in the diagnosis or treatment of human adenovirus.
[0005] To address the aforementioned problems, the present invention provides a nanobody targeting human adenovirus or an antigen-binding fragment containing the nanobody.
[0006] The nanobody targeting human adenovirus or the antigen-binding fragment containing the nanobody provided by the present invention has three complementary determinants CDR1, CDR2 and CDR3; the amino acid sequence of CDR1 is shown in SEQ ID No.1, the amino acid sequence of CDR2 is shown in SEQ ID No.2 and the amino acid sequence of CDR3 is shown in SEQ ID No.3.
[0007] The CDRs mentioned above are sequences defined according to the IMGT numbering system.
[0008] The nanobodies described herein typically comprise a VHH consisting of four framework regions (FRs) and three complementarity-determining regions (CDRs), referred to as FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. The antigen-binding fragment contains at least a portion of the nanobodies, which is sufficient to confer the ability of the fragment to specifically bind to human adenovirus type 55.
[0009] The four frame regions can be FR1, FR2, FR3 and FR4.
[0010] The amino acid sequence of FR1 is SEQ ID No. 12 or SEQ ID No. 17;
[0011] The amino acid sequence of FR2 is SEQ ID No. 13 or SEQ ID NO. 18;
[0012] The amino acid sequence of FR3 is SEQ ID No. 14 or SEQ ID NO. 19;
[0013] The amino acid sequence of FR4 is SEQ ID No. 15 or SEQ ID NO. 20.
[0014] In the nanobodies or antigen-binding fragments described above, the nanobodies may be any of the following:
[0015] A1) Nanobody with an amino acid sequence as shown in SEQ ID No. 4;
[0016] A2) Nanobodies with amino acid sequences as shown in SEQ ID No. 5;
[0017] A3) Nanobody fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID No. 4 or SEQ ID No. 5.
[0018] The protein tag refers to a polypeptide or protein that is fused with the target protein for expression, detection, tracing, and / or purification. The protein tag may be a His tag, Flag tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, or the Fc fragment of immunoglobulin G, etc.
[0019] In this invention, the protein tag is the Fc segment (hFc) of human immunoglobulin G.
[0020] In the above-mentioned nanobody, the nanobody is composed of the complementary determinant cluster region and the framework region.
[0021] In this invention, the term "antibody" refers to a heterotetraglycoprotein of approximately 150,000 Daltons with identical structural features, composed of two identical light chains (L) and two identical heavy chains (H). Each light chain is linked to the heavy chain by a covalent disulfide bond, and the number of disulfide bonds between heavy chains of different immunoglobulin isotypes varies. Each heavy and light chain also has regularly spaced intrachain disulfide bonds. Each heavy chain has a variable region (VH) at one end, followed by multiple constant regions. Each light chain has a variable region (VL) at one end and a constant region at the other end; the constant region of the light chain is opposite to the first constant region of the heavy chain, and the variable region of the light chain is opposite to the variable region of the heavy chain. Specific amino acid residues form interfaces between the variable regions of the light and heavy chains.
[0022] In this invention, the terms "single-domain antibody (VHH)" and "nanobody" have the same meaning, referring to the variable region of the cloning antibody heavy chain. A single-domain antibody (VHH) consisting of only one variable region of the heavy chain is constructed, which is the smallest antigen-binding fragment with complete function.
[0023] The antigen-binding fragments mentioned above may be complete antibodies, fusion antibodies, antibody-drug conjugates, Fab fragments, Fv fragments, Fab' fragments, F(ab')2 fragments, single-chain antibodies (ScFv), or minimum recognition units (MRUs) containing the nanobody.
[0024] The term "Fab fragment" refers to a heterodimer composed of a heavy chain (Fd) and a complete light chain linked by disulfide bonds, containing only one antigen-binding site. The aforementioned heavy chain (Fd) refers to approximately half of the H chain portion of the Fab (containing approximately 225 amino acid residues, including VH, CH1, and part of the hinge region).
[0025] The term "Fv fragment" refers to a vector containing VH and VL genes that can be constructed separately, co-transfected into cells to express them separately, and then assembled into a functional Fv antibody; alternatively, a stop codon can be set between VH and VL in the vector to express two small protein fragments, which can then be bound together by non-covalent bonds to form an Fv antibody (Fv fragment).
[0026] The term "Fab' fragment" contains a portion of a light chain and a heavy chain containing the VH domain and the CH1 domain, as well as the region between the CH1 and CH2 domains, thereby allowing interchain disulfide bonds to form between the two heavy chains of two Fab' fragments to form the F(ab')2 molecule.
[0027] The term "F(ab')2 segment" contains two light chains and two heavy chains containing portions of a constant region between the CH1 and CH2 domains, thereby forming an interchain disulfide bond between the two heavy chains. Therefore, the F(ab')2 segment consists of two Fab' segments held together by the disulfide bond between the two heavy chains.
[0028] In this invention, the term "variable" refers to the fact that certain portions of the variable region of an antibody differ in sequence, resulting in the binding and specificity of various specific antibodies to their specific antigens. However, variability is not uniformly distributed throughout the entire variable region of an antibody. It is concentrated in three segments in the variable regions of the light and heavy chains, called complementarity-determining regions (CDRs) or hypervariable regions. The more conserved portions of the variable region are called framework regions (FRs). The variable regions of the natural heavy and light chains each contain four FR regions, which are generally β-sheet configurations, linked by three CDRs forming a linking loop, and in some cases may form a partially β-sheet structure. The CDRs in each chain are closely packed together through the FR regions and together with the CDRs of the other chain, form the antigen-binding site of the antibody (see Kabat et al., NIH Publ. No. 91-3242, Vol. I, pp. 647-669 (1991)). Constant regions do not directly participate in antibody-antigen binding, but they exhibit different effector functions, such as participating in antibody-dependent cytotoxicity.
[0029] In some embodiments, the nanobodies of the present invention may be truncated at the N-terminus or C-terminus to contain only a portion of FR1 and / or FR4, or to lack one or both of those backbone regions, as long as they substantially maintain antigen binding and specificity.
[0030] In this invention, the nanobody is named nanobody 2C10.
[0031] The present invention also provides biomaterials related to the nanobodies described above, wherein the biomaterials may be any of the following:
[0032] B1) Nucleic acid molecules that encode the nanobodies or antigen-binding fragments described above;
[0033] B2) An expression cassette containing the nucleic acid molecule described in B1);
[0034] B3) A recombinant vector containing the nucleic acid molecules described in B1);
[0035] B4) A recombinant vector containing the expression cassette described in B2);
[0036] B5) Recombinant microorganisms containing the nucleic acid molecules described in B1);
[0037] B6) Recombinant microorganisms containing the expression cassette described in B2);
[0038] B7) Recombinant microorganisms containing the recombinant vector described in B3);
[0039] B8) Recombinant microorganisms containing the recombinant vector described in B4).
[0040] In the above-mentioned biological materials, the nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.
[0041] In the aforementioned biological materials, the expression cassette (B2) refers to DNA capable of expressing the nanobody in host cells. This DNA may include not only a promoter to initiate transcription of the nanobody-encoding gene, but also a terminator to terminate transcription of the nanobody-encoding gene. Furthermore, the expression cassette may also include an enhancer sequence.
[0042] Recombinant vectors containing the expression cassette can be constructed using existing expression vectors.
[0043] In the aforementioned biological materials, the carrier may be a plasmid, a granule, a bacteriophage, or a viral vector.
[0044] In the above-mentioned biological materials, the recombinant vector may be a recombinant vector obtained by introducing the nucleic acid molecule described in B1) into the pTSE-hFc vector.
[0045] In the above-mentioned biological materials, the microorganisms may be bacteria (such as Escherichia coli), yeast, algae, or fungi.
[0046] In the above-mentioned biomaterials, the encoding gene of CDR1 of the nanobody is nucleotides 76-102 of SEQ ID No. 6, the encoding gene of CDR2 is nucleotides 151-180 of SEQ ID No. 6, and the encoding gene of CDR3 is nucleotides 289-339 of SEQ ID No. 6.
[0047] In the above-mentioned biological materials, the nucleic acid molecule described in B1) can be any of the following:
[0048] C1) DNA molecules with nucleotide sequences as shown in SEQ ID No. 6;
[0049] C2) DNA molecules with nucleotide sequences as shown in SEQ ID No. 7;
[0050] C3) A DNA molecule that hybridizes under stringent conditions with a DNA molecule defined by C1) or C2) and encodes the nanobody;
[0051] A DNA molecule encoding the nanobody having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology to any of the defined DNA sequences in C4 and C1-C3).
[0052] The stringent conditions can be as follows: hybridization at 50°C in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 2×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 1×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 0.5×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 0.5×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA. Hybridization can be performed in a mixed solution of EDTA, followed by rinsing at 50°C in 0.1×SSC and 0.1% SDS; alternatively, hybridization can be performed at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 65°C in 0.1×SSC and 0.1% SDS; alternatively, hybridization can be performed in a solution of 6×SSC and 0.5% SDS at 65°C, followed by washing once each with 2×SSC and 0.1% SDS and 1×SSC and 0.1% SDS.
[0053] Those skilled in the art can readily mutate the nucleotide sequence of the nanobody 2C10 encoding gene described in B1) of the present invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides having 75% or more identity with the nucleotide sequence of 2C10 described in B1) of the present invention, as long as they encode the nanobody and possess nanobody 2C10 activity, are derived from and equivalent to the nucleotide sequence of the present invention.
[0054] The present invention also provides a method for preparing the above-mentioned nanobody, which may include the following steps: introducing a nucleic acid molecule encoding the nanobody described above into a recipient cell to obtain a transgenic cell expressing the nanobody, culturing the transgenic cell to obtain the nanobody.
[0055] Furthermore, the nucleic acid molecule encoding the nanobody is the nucleic acid molecule described above.
[0056] In the above method, the nucleotide sequence of the nucleic acid molecule encoding the nanobody described above can be any of the following:
[0057] C1) DNA molecules with nucleotide sequences as shown in SEQ ID No. 6;
[0058] C2) DNA molecules with nucleotide sequences as shown in SEQ ID No. 7;
[0059] C3) A DNA molecule that hybridizes under stringent conditions with a DNA molecule defined by C1) or C2) and encodes the nanobody;
[0060] A DNA molecule encoding the nanobody having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology to any of the defined DNA sequences in C4 and C1-C3).
[0061] Furthermore, the recipient cell may be a microbial cell, such as bacteria (e.g., Escherichia coli), yeast, algae, or fungi.
[0062] In a specific embodiment of the present invention, the recipient cell may be a HEK293-F cell.
[0063] The present invention also provides a nanobody fusion protein, wherein the nanobody fusion protein is formed by fusing the aforementioned nanobody or antigen-binding fragment with another molecule, wherein the other molecule may include the Fc domain of an immunoglobulin, a fluorescent protein, or a VHH with different specificities.
[0064] In a specific embodiment of the present invention, the other molecule is the Fc domain of a human immunoglobulin.
[0065] In a specific embodiment of the present invention, the amino acid sequence of the Fc domain of the human immunoglobulin described above is positions 127 to 353 of SEQ ID No. 8 or positions 127 to 353 of SEQ ID No. 9.
[0066] In specific embodiments of the present invention, the nanobody fusion protein described above may be any of the following:
[0067] M1) The amino acid sequence of the nanobody fusion protein is shown in SEQ ID No. 8;
[0068] M2) The amino acid sequence of the nanobody fusion protein is shown in SEQ ID No. 9;
[0069] The nanobody fusion protein is obtained by attaching a protein tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID No. 8 or SEQ ID No. 9 (M3).
[0070] In the above-mentioned nanobody fusion protein, the nucleic acid molecule encoding the fusion protein can be any of the following:
[0071] D1) A DNA molecule with a nucleotide sequence as shown in SEQ ID No. 10;
[0072] D2) DNA molecules with nucleotide sequences as shown in SEQ ID No. 11;
[0073] D3) A DNA molecule that hybridizes under stringent conditions with a DNA molecule defined by D1) or D2) and encodes the fusion protein;
[0074] A DNA molecule encoding the fusion protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology to any of the defined DNA sequences in D4 and D1-D3.
[0075] The present invention also provides an ELISA detection kit targeting human adenovirus type 55, the kit comprising the nanobody described above or an antigen-binding fragment containing the nanobody, or the biomaterial described above.
[0076] This invention also provides any of the following applications:
[0077] E1) The application of the nanobodies or antigen-binding fragments mentioned above in the preparation of products for detecting human adenovirus;
[0078] E2) The application of the aforementioned biomaterials in the preparation of products for detecting human adenovirus;
[0079] E3) Application of the preparation method described above in the preparation of products for detecting human adenovirus;
[0080] E4) The application of the aforementioned kit in the preparation of products for detecting human adenovirus;
[0081] E5) The application of the nanobodies mentioned above in the preparation of products bound to human adenovirus;
[0082] E6) The application of the aforementioned biomaterials in the preparation of products conjugated with human adenovirus;
[0083] E7) Application of the preparation method described above in the preparation of products conjugated with human adenovirus;
[0084] E8) Application of the aforementioned kit in the preparation of products conjugated with human adenovirus;
[0085] E9) The application of the nanobodies or antigen-binding fragments mentioned above in the preparation of human adenovirus detection reagents;
[0086] E10) The application of the nanobodies or antigen-binding fragments mentioned above in the preparation of human adenovirus diagnostic reagents;
[0087] E11) The application of the nanobodies or antigen-binding fragments described above in the preparation of drugs for the prevention and / or treatment of human adenovirus.
[0088] The above products may be medicines.
[0089] This invention includes not only complete antibodies, but also fragments of the aforementioned nanobodies or fusion proteins formed by antibodies and other sequences, possessing immunomodulatory activity. Therefore, this invention also includes polypeptides such as fragments, derivatives, and analogs of the aforementioned nanobodies that maintain the same biological function or activity as the antibodies of this invention. The polypeptides may be as follows: D1) a single-chain antibody containing the aforementioned nanobodies; D2) a Fab containing the aforementioned nanobodies; D3) a complete antibody containing the aforementioned nanobodies; D4) a fusion antibody containing the aforementioned nanobodies; D5) an antibody-drug conjugate containing the aforementioned nanobodies.
[0090] D4) The fusion antibody of the nanobody may be: M1) a nanobody fusion protein with an amino acid sequence as shown in SEQ ID No. 8; or M2) a nanobody fusion protein with an amino acid sequence as shown in SEQ ID No. 9.
[0091] As those skilled in the art will recognize, the conjugates and fusion antibody expression products comprise: conjugates formed by binding drugs, toxins, cytokines, radionuclides, enzymes, and other diagnostic or therapeutic molecules to the antibodies or fragments thereof of the present invention. The present invention also includes cell surface markers or antigens bound to the nanobodies or fragments thereof.
[0092] The present invention includes any protein or protein conjugate and fusion expression product (i.e., immunoconjugate and fusion expression product) having a heavy chain containing a variable region, provided that the variable region is the same as or has at least 90% homology with the heavy chain variable region of the antibody of the present invention, preferably at least 95% homology.
[0093] The antigen described in this invention is human adenovirus type 55.
[0094] This invention utilizes a VHH-based peptide and protein library, employing human adenovirus type 55 (HAdV55) as the antigen, to screen and obtain high-affinity nanobodies targeting HADV55. These antibodies exhibit excellent neutralizing activity and specificity, providing effective candidate antibody molecules and strong technical support for the prevention and treatment of human adenovirus infection. They can also be applied to the development of human adenovirus detection kits for early diagnosis and epidemic monitoring of human adenovirus infection, demonstrating broad application prospects. Attached Figure Description
[0095] Figure 1 CPE of HAdV55 on A549 cells. Where A: normal A549 cells; B: CPE that appears after HAdV55 is inoculated into A549 cells.
[0096] Figure 2 HADV55 virus particles were purified using a cesium chloride density gradient.
[0097] Figure 3 This study measured antibody titers in camel serum before and after human adenovirus type 55 immunization. The horizontal axis represents serum dilution, and the vertical axis represents antibody titers.
[0098] Figure 4 This describes the isolation of peripheral blood lymphocytes from camels. A: Camel peripheral blood before centrifugation; B: Location of peripheral blood lymphocytes after centrifugation.
[0099] Figure 5 This refers to the amplification of the VHH gene fragment. A: Results of the first round of PCR; B: Results of the second round of PCR.
[0100] Figure 6 Phage-ELISA is used to identify the binding of phage clones to the target antigen after secondary screening (partial). A: Phage-ELISA results from the first round of screening; B: Phage-ELISA results from the second round of screening. Odd-numbered columns are coated with the target antigen; even-numbered columns are coated with irrelevant antigens.
[0101] Figure 7 The purified anti-human adenovirus type 55 nanobody fusion protein was detected by SDS-PAGE electrophoresis.
[0102] Figure 8 To detect the binding activity of the anti-human adenovirus type 55 nanobody fusion protein.
[0103] Figure 9 To detect the neutralizing activity of the anti-human adenovirus type 55 nanobody fusion protein.
[0104] Figure 10 To detect the binding activity of the humanized anti-human adenovirus type 55 nanobody fusion protein.
[0105] Figure 11 To detect the neutralizing activity of the humanized anti-human adenovirus type 55 nanobody fusion protein.
[0106] Figure 12 To detect the acid-base stability of the humanized anti-human adenovirus type 55 nanobody fusion protein. Detailed Implementation
[0107] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0108] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0109] Unless otherwise specified, all quantitative experiments in the following examples are performed in triplicate.
[0110] For details on the preparation method of the pADSCFV-S vector in the following examples, please refer to "Example 1, Construction of a High-Quality Phage Presentation Antibody Library" in Chinese Patent CN105315371B. This biological material is only for repeating the experiments of this invention and should not be used for other purposes.
[0111] The expression vector pTSE-hFc used in the following examples was obtained by our laboratory by linking the gene for the Fc domain of human immunoglobulin to the pCMV vector. pTSE-hFc has been described in: Xie Qing, Li Zhiying, Zhang Wei, et al. Screening and identification of antibodies against the protective antigen V of Yersinia pestis [J]. Chinese Journal of Pathogenic Biology, 2022, 17(03): 266-271. The public can obtain this biological material from the applicant. This biological material is only for repeating the experiments of this invention and shall not be used for other purposes.
[0112] The HAdV55 virus (abbreviated as type 55 adenovirus) used in the following examples is described in: Doctoral Dissertation: Research on the Interaction between Human Type 55 Adenovirus and Host Based on Multi-omics, Wang Kaiying. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.
[0113] In the following examples, A549 cells were purchased from Peking Union Medical College Cell Resource Center, catalog number 25.
[0114] The following examples used SPSS 11.5 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and P < 0.001 (***) indicates a highly significant difference.
[0115] Example 1: Construction of a single-domain antibody library against human adenovirus type 55
[0116] I. Preparation of Human Adenovirus Type 55 Virus Stock Solution, Concentrated Solution and Inactivated Virus
[0117] 1. Preparation of human adenovirus type 55 venom
[0118] Culture of human adenovirus type 55: HAdV55 virus is human adenovirus type 55 (abbreviated as HAdV55).
[0119] A549 cells were cultured in conventional DMEM medium plus 10% (volume percentage) FBS medium (GIBCO, 10099141).
[0120] One day before inoculation with human adenovirus type 55, A549 cells were digested with trypsin and passaged in 75 cm cells. 2 In the cell culture flask, the cell density was increased to 80%-90% by the time of virus inoculation the next day. On the day of inoculation, the cell culture medium was slowly aspirated from the culture flask, 5 mL of DMEM was added to gently rinse the cells and discarded. Then, 3 mL of DMEM + 2% (volume percentage) FBS was added. HAdV55 virus was pipetted into the cell culture flask and infected at an MOI of ≈0.001. The flask was shaken several times to disperse the virus evenly. The flask was placed in an incubator at 37°C and 5% CO2 for 2 hours for adsorption, shaking the flask approximately every 30 minutes. After adsorption, the virus culture medium was discarded, and 15 mL of fresh DMEM + 2% (volume percentage) FBS was added. The cell culture flask was then placed in an incubator at 37°C and 5% CO2 for further culture. The cytopathic effect was observed daily.
[0121] The results are as follows Figure 1 As shown in Figures A and B: About 96 hours after inoculation, cytopathic effect reached 80% to 90%, characterized by cell shrinkage and shedding; the adenovirus culture was harvested, frozen and thawed 2-3 times at -80℃, centrifuged at 4,000 rpm for 5 min, and the supernatant was collected, aliquoted, and stored at -80℃, which is the human adenovirus type 55 stock solution.
[0122] 2. Adenovirus titer determination
[0123] One day before the experiment, A549 cells in good growth condition were harvested, digested with trypsin, and then the cell density was adjusted to 1.3 × 10⁻⁶ cells using DMEM + 10% (volume percentage) FBS. 5 / mL, inoculated into 96-well cell culture plates, 100μL per well, and incubated at 37℃ and 5% CO2; on the day of the experiment, remove the 96-well plates, discard the culture medium, wash once with serum-free medium, add DMEM + 2% (v / v) FBS, 100μL / well; then use serum-free medium to serially dilute the HADV55 virus solution to be tested 10-fold. -1 -10 -8 Eight dilutions were performed. The diluted virus was added to 10 μL / well of the prepared 96-well plate, with eight wells for each dilution. A blank control group was also set up. After the operation, the cells were placed in an incubator at 37°C and 5% CO2 for observation. After 7 days, the cell death rate in each well was counted, and the TCID50 of the original virus solution was calculated according to the following formula.
[0124] Distance ratio = (Percentage of lesions with a rate higher than 50% - 50%) / (Percentage of lesions with a rate higher than 50% - Percentage of lesions with a rate lower than 50%)
[0125] LgTCID50 = Distance ratio × Difference between the logarithms of dilutions + Logarithm of dilutions with a lesion rate higher than 50%.
[0126] Based on testing and calculation, the viral titer of the HAdV55 virus stock solution used in this embodiment is 3.16 × 10⁻⁶. 8 TCID50 / mL.
[0127] 3. Inactivation and purification of adenovirus
[0128] Transfer the HAdV55 virus stock solution obtained in step 1 to a 500mL sample vial. Adjust the pH to 7.6 with sodium bicarbonate. Then, add β-propiolactone (MACKLIN, P816096) at a ratio of 1:2000 while stirring. After thorough mixing, continue stirring at 4°C for inactivation. After 24 hours, adjust the pH to 7.6 again and add β-propiolactone at a ratio of 1:2000. Continue stirring at 4°C for another 24 hours for inactivation. Take at least 1‰ of the sample volume and hydrolyze it in a 37°C water bath for 4 hours (adjust the pH to around 7.0 with sodium bicarbonate when the sample turns yellow). After hydrolysis, take the sample from the previous day and transfer it to a 25cm sample. 2 A549 cells from one 25cm cell culture flask were seeded at a rate of 1 mL of sample. 2 A549 cells were seeded proportionally (less than 1 mL was counted as 1 mL). Simultaneously, cells seeded with non-inactivated virus and uninactivated cells (referred to as blank cells) were set up as controls. These were cultured and observed in a 37℃, 5% CO2 incubator. After 7 days, the cells were blindly passaged into new A549 cells, and observation continued. This blind passage was repeated for 3 generations. Cells seeded with non-inactivated virus showed cytopathic effects, while cells in the inactivated experimental group and blank cells did not. If these results indicated reliable inactivation and complete inactivation, the inactivation was considered complete. Otherwise, inactivation was considered incomplete, and re-inactivation and testing were required.
[0129] The virus stock solution, confirmed to be completely inactivated by inactivation testing, was centrifuged at 4,000 rpm for 10 minutes to remove cell debris. The Sepharose 4Fast Flow gel column was equilibrated with PBS buffer and loaded with the sample. The sample was then eluted with PBS, and the first elution peak was the target virus peak. This elution peak was collected, and 12.5 mL of heavy-density cesium chloride solution (42.23 g cesium chloride + 57.77 mL 10 mM Tris-HCl (pH 7.9-8)) was added to an Amicon-Ultra-15 ultrafiltration tube (50 kDa). Then, 12.5 mL of light-density cesium chloride solution (22.39 g cesium chloride + 77.61 mL 10 mM Tris-HCl (pH 7.9-8)) was slowly added, followed by 15 mL of virus suspension. The solution was balanced and centrifuged in an ultracentrifuge (Beckman L100-XP) at 25,000 rpm and 4°C for 2 hours.
[0130] The results are as follows Figure 2 As shown: After centrifugation with a cesium chloride density gradient, a major protein band was observed between the light and heavy density cesium chloride solutions. The band was collected and dialyzed with PBS to obtain inactivated HADV55 virus.
[0131] 4. Preparation of adenovirus concentrate
[0132] The HADV55 inactivated virus obtained in step 3 was transferred into an ultrafiltration tube (MILIPORE, catalog number UFC805008) with a molecular weight cutoff of 50kD. The tube was centrifuged at 4,000 rpm until the volume was reduced to 1 / 30 of the initial volume. The retentate was collected, aliquoted, and stored at -80℃ to obtain the HADV55 virus concentrate.
[0133] II. Construction of a human adenovirus type 55 single-domain antibody library
[0134] 1. Camel immunization and determination of antibody titers in serum
[0135] The purified HAdV55 virus concentrate was mixed with an equal volume of Freund's complete adjuvant (Sigma, F5881), emulsified by shaking, and subcutaneously injected at multiple sites into healthy adult Bactrian camels. The immunization cycle was 14 days apart. Except for the first immunization which used Freund's complete adjuvant, all subsequent immunizations used Freund's incomplete adjuvant (Sigma, F5506). The antigen emulsion (approximately 3.5 mL / camel) was injected subcutaneously at multiple sites, with each camel receiving 0.75 mg of antigen. After four immunizations, serum was collected from the Bactrian camels. Pre-immunization serum was used as a negative control. The antibody titer in the camel serum was detected using ELISA, with human adenovirus type 55 as the coating antigen and HRP-labeled rabbit anti-camel IgG antibody (Solarbio, SE268) as the secondary antibody.
[0136] The results are as follows Figure 3 As shown, compared with the pre-immunization camel serum sample, the post-immunization serum showed effective and specific binding activity against human adenovirus type 55, confirming the production of specific antibodies in the camel serum, with an antibody titer of 51200.
[0137] 2. Isolation of peripheral blood lymphocytes from camel blood
[0138] After the specific antibody reaches the target titer, a pulse immunization is performed using unadjuvanted human adenovirus type 55 as the immunogen. Within one week of the pulse immunization, 100-150 mL of camel peripheral blood is collected and added to an anticoagulated blood collection bag for the separation of peripheral blood lymphocytes. Peripheral blood lymphocytes from the camel blood are separated using lymphocyte separation medium (stemcell, 07851).
[0139] The results are as follows Figure 4 As shown in Figures A and B: After centrifugation, the mixture of whole blood and lymphocyte separation fluid separates into four layers. The top layer is serum, the second layer is lymphocytes, the third layer is dextran from the lymphocyte separation fluid, and the bottom layer is red blood cells.
[0140] 3. Nested PCR amplification of the VHH gene fragment
[0141] Total RNA was extracted from isolated peripheral blood mononuclear cells (PBMCs) using the OMEGA EZNA Total RNA kit I (OMEGA, R6834), and then reverse transcribed into cDNA using the Invitrogen Superscript III First-strand Synthesis System for RT-PCR Reverse Transcription Kit (Invitrogen, 18080-051).
[0142] Nested PCR amplification of the VHH gene fragment: 1) In the first round of PCR amplification, the leader sequence and CH2 region of the camel antibody gene were amplified using the IgG-specific upstream primer CALL001 and downstream primer CALL002. The upstream and downstream primers recognized the leader sequence and CH2 sequence of the antibody, respectively; 2) Using the purified DNA product from the first round as a template, the VHH gene was obtained by the second round of PCR amplification using primers VHH-F and VHH-R.
[0143] Table 1 Primer sequences used in the two rounds of PCR
[0144] Primer name Primer sequence (5'-3') CALL001 GTCCTGGCTGCTCTTCTACAAGG CALL002 GGTACGTGCTGTTGAACTGTTCC VHH-F cggCCATGGcGGTCCTGGCTGCTCTTCTACA VHH-R tcccGCGGCCGCTGAGGAGAYGGTGACCWGGGT
[0145] The agarose gel electrophoresis results of the PCR products from the two rounds of amplification are shown in the figure. Figure 5In A and B: The first round of PCR amplification yielded two specific bands of approximately 1000bp and 700bp. The band of approximately 1000bp corresponds to the traditional antibody from the camel, while the band of approximately 700bp corresponds to the heavy chain antibody from the camel.
[0146] The approximately 700 bp band was extracted and recovered using the TaKaRa MiniBEST Agarose Gel DNA Extraction Kit (TaKaRa, 9762). Using the purified DNA product from the first round as a template, a second round of PCR amplification was performed with primers VHH-F and VHH-R. After agarose gel electrophoresis, the 450 bp band was recovered; this band represents the desired VHH gene.
[0147] 4. Electro-connection products
[0148] The VHH gene obtained from the second round of PCR amplification was digested with restriction endonucleases NcoⅠ and NotⅠ and then ligated with the pADSCFV-S vector (the molar ratio of pADSCFV-S vector to VHH gene fragment was 1:3) to obtain the recombinant vector pADSCFV-VHH.
[0149] The recombinant vector pADSCFV-VHH was transformed into E. coli TG1 competent cells (Solarbio, C1170) to construct a human adenovirus type 55 specific phage nanobody library. The electroporated bacterial culture was plated for amplification culture. The colonies on the plate were scraped off the next day to obtain the initial human adenovirus type 55 specific phage nanobody library. Simultaneously, 50 μL of the electroporated bacterial culture was serially diluted 10-fold. 3 ~10 7 Five dilutions of bacterial suspension were plated in 200 μL portions. Colony counts were performed the following day, and the library capacity of the human adenovirus type 55 specific phage nanobody library was calculated based on the dilution factor: Library capacity = (colony count × dilution factor) / plate volume × total volume. The calculated library capacity of this human adenovirus type 55 specific phage nanobody library is 5.2 × 10⁻⁶. 8 CFU.
[0150] III. Screening of a human adenovirus type 55 specific phage nanobody library
[0151] The bacterial culture of the human adenovirus type 55 specific phage nanobody library constructed in step two above was used for presentation using helper phage M13K07 (NEB, N0315S). The phages were then precipitated with 20% PEG / 2.5M NaCl solution (1L of solution contains 200g PEG6000 and 146.25g NaCl) to obtain the human adenovirus type 55 specific phage nanobody library.
[0152] Using purified human adenovirus type 55 as the antigen, the above-mentioned human adenovirus type 55 phage nanobody library was screened using a solid-phase screening strategy (experimental protocol referenced: Phage Display: A Universal Laboratory Guide / edited by Clackson, T., and Lowman, HB.; translated by Ma Lan et al., Chemical Industry Press, May 2008). The specific steps are as follows:
[0153] Add 1 mL of antigen diluted with 0.1 M NaHCO3 coating buffer to each immunoassay well, and incubate overnight at 4°C. The coating concentrations for each round of panning are 20 and 10 μg / mL, respectively. The next day, wash the immunoassay tubes twice with PBS for 3 min each time, and then block with 2% bovine serum albumin at 37°C for 2 h. After blocking, wash three times with PBST (1×PBS + 0.1% Tween-20), and then wash three times with PBS. Adjust the titer of the human adenovirus type 55 specific phage nanobody library to an appropriate concentration with blocking buffer, add it to the immunoassay tubes, and incubate at room temperature for 2 h. Then, shake at 200 rpm for 20 min. Wash 10 times with PBST, and then wash 5 times with PBS. After washing, add 1 mL of elution buffer (glycine-hydrochloric acid, pH 2.2) to each well, and elute at 400 rpm at room temperature for 20 min. Remove the elution buffer from the target antigen wells and add 50-60 μL of neutralization buffer (1 M NaHCO3). Neutralize with Tris-HCl (pH 8.0), mix well, and store at 4°C. Infect E. coli TG1 cells in the logarithmic growth phase and incubate at 37°C for 1 hour to produce and purify a secondary human adenovirus type 55 specific phage nanobody library for the next round of screening. Repeat the same screening process twice. The enrichment results are shown in Table 2.
[0154] Table 2. Enrichment analysis of human adenovirus type 55 phage nanobody library screening.
[0155] Number of filters Input Output Output / Input enrichment factor 1 <![CDATA[5×10 11 ]]> <![CDATA[7.8×10 7 ]]> <![CDATA[1.56×10 -4 ]]> --- 2 <![CDATA[1×10 11 ]]> <![CDATA[2.67×10 8 ]]> <![CDATA[2.67×10 -3 ]]> 17.12
[0156] After two rounds of screening, well-separated single colonies containing phages were inoculated into 96-well plates (600 μL / well) containing 2YT-GA medium (1 L of 2YT medium contains 16 g tryptone, 10 g yeast extract, 5 g sodium chloride, 100 μg / mL ampicillin, and 20% glucose). Two negative control wells (clones without clones or clones inoculated with other antigens) were reserved. The plates were incubated at 37°C for 5-6 hours. M13KO7 helper phage was added at a ratio of MOI≈50, at a rate of 100 μL / well to deep-well plates containing single phage clones. The plates were incubated at room temperature for 30 min, followed by incubation at 37°C for 1 hour at 150 rpm. The deep-well plates were centrifuged at room temperature (2000 rpm, 10 min), and the supernatant was discarded. The plates were then induced to express phage particles displaying the antibody variable region by adding 1 mM arabinose.
[0157] IV. Identification of specific single positive clones using phage-linked immunosorbent assay (Phage-ELISA).
[0158] Phage particles specifically bound to purified inactivated human adenovirus type 55 were measured using Phage-ELISA. The antigen was inactivated human adenovirus type 55, and adjacent columns of each antigen group were used as parallel coatings of irrelevant antigens as negative controls. Coating was performed overnight at 4°C. The coated ELISA plate was then discarded, washed six times with PBST, and blocked with blocking buffer (200 μL / well of 100 mL PBS containing 2 g of skim milk powder). The plate was incubated at 37°C for 2 h. The blocking buffer was discarded, and then 100 μL / well of the induced phage supernatant was added to the wells coated with the target antigen and control antigen, respectively. The plates were incubated at 37°C for 1.5 h. The plates were then washed six times with PBST, and a fresh 0.2 μg / mL solution was prepared. HRP-labeled M13 mouse monoclonal antibody (SinoBioligical, 1973-MM05T-H) was added to ELISA plates at 100 μL / well and incubated at 37°C for 45 min. The plates were then washed 6 times with PBST. A chromogenic buffer (approximately 10 mL per ELISA plate, i.e., 9 mL of chromogenic buffer plus 1 mL of 10×OPD and 10 μL of 30% hydrogen peroxide) was prepared and added to ELISA plates at 100 μL / well. The plates were incubated in the dark for 15-20 minutes. 2M sulfuric acid stop buffer (50 μL / well) was added, and the readings were taken at dual wavelengths of 492 / 630 nm. For the antigen group, wells with ELISA signal values >3 times that of the negative control group were considered positive clones.
[0159] Some Phage-ELISA experimental results can be found in Figure 6 ,in Figure 6(A) Phage-ELISA results from the first round of screening; (B) Phage-ELISA results from the second round of screening. Odd-numbered columns were coated with the target antigen; even-numbered columns were coated with irrelevant antigens. Phage-ELISA-positive clones were sent to a biotechnology service company for sequencing to obtain the DNA sequence of the inserted fragment, ultimately yielding camel-derived nanobody 2C10, which specifically binds to human adenovirus type 55. Partial sequence information of nanobody 2C10 is shown in Table 3.
[0160] Table 3. Statistical table of 2C10 nanobody sequences.
[0161] area amino acid sequence Position in sequence list CDR1 EDTSNMVRM SEQ ID No.1 CDR2 INPGRGYTTY SEQ ID No.2 CDR3 AATKTGGRWDSADNYPY SEQ ID No. 3
[0162] The amino acid sequence of nanobody 2C10 is shown in SEQ ID No. 4, comprising an antibody gene complementarity-determining region (CDR) and a frame region (FR). The complementarity-determining region is divided into three parts, which can be defined as CDR1, CDR2, and CDR3, and are respectively denoted as SEQ ID No. 1, SEQ ID No. 2, and SEQ ID No. 3. The frame region is divided into four parts, which can be defined as FR1, FR2, FR3, and FR4, and are respectively denoted as SEQ ID No. 12, SEQ ID No. 13, SEQ ID No. 14, and SEQ ID No. 15. The gene encoding the above-mentioned anti-human adenovirus type 55 nanobody 2C10 has the nucleotide sequence shown in SEQ ID No. 6. Specifically, the encoding gene of CDR1 of nanobody 2C10 is nucleotides 76-102 of SEQ ID No. 6, the encoding gene of CDR2 is nucleotides 151-180 of SEQ ID No. 6, and the encoding gene of CDR3 is nucleotides 289-339 of SEQ ID No. 6.
[0163] Example 2: Preparation of anti-human adenovirus type 55 nanobody
[0164] 1. Construction of eukaryotic expression plasmid for anti-human adenovirus type 55 nanobody fusion protein
[0165] Based on the human adenovirus type 55 single-domain antibody gene sequence (SEQ ID No. 6), its C-terminus was fused with the Fc segment (hFc) of human immunoglobulin G to obtain the encoding gene of the 2C10-hFc fusion protein. The nucleotide sequence of the encoding gene of the fusion protein is SEQ ID NO. 10, and the expressed amino acid sequence is SEQ ID No. 8, which is the anti-human adenovirus type 55 nanobody fusion protein 2C10-hFc.
[0166] The obtained coding gene sequence of 2C10 was cloned into the expression vector pTSE-hFc using conventional molecular biology techniques, inserted between the Sal I and Nhe I restriction sites. Clones were then selected for sequencing verification. The 2C10 gene was amplified using primers 2C10-F: 5'-gggtcgaccggtCGGCCGCATCTGGTG-3' and 2C10-R: 5'-GTCGCTAGCTGAGGAGACGGTGACCTGGGTCC-3'. The amplified 2C10 gene was then inserted into the pTSE-hFc vector, successfully constructing a eukaryotic expression vector and obtaining the recombinant vector, which was named pTSE-hFc-2C10-VHH.
[0167] The structure of the recombinant vector pTSE-hFc-2C10-VHH is described as follows: The recombinant vector is obtained by replacing the fragment between the two restriction endonuclease sites Sal I and Nhe I of the DNA molecule with the nucleotide sequence SEQ ID No. 6, while keeping the other sequences of the vector pTSE-hFc unchanged.
[0168] 2. Expression and purification of anti-human adenovirus type 55 nanobody fusion protein
[0169] The recombinant eukaryotic expression plasmid pTSE-hFc-2C10-VHH constructed in step 1 was transfected into FreeStyle using the FectoPRODNA Transfection Reagent (Polyplus, 116-001). TM HEK293-F cells (Invitrogen, R79007). Cell viability was monitored 48 hours after transfection. When cell viability dropped to 80-85%, the culture supernatant was collected by centrifugation at 8,000 rpm for 10 min for purification. The supernatant was filtered through a 0.45 μm filter to remove impurities, and 10×PBS was added to adjust the ion concentration to be close to that of the binding buffer. Antibody purification was performed using an AKTA purification system (GE, AKTA EXPLORER). A HiTrap MabSelect Xtra purification column was installed in the AKTA purification instrument, and the appropriate system parameters were set. The purification column was equilibrated with binding buffer and loaded with the antibody. Equilibration was continued, and then the pre-packed column was washed with citrate solution (pH 3.0) to elute the antibody protein. Collection began when UV280 reached 100 and ended when UV280 dropped to 100. The buffer was then replaced with citrate solution (pH 6.0) to obtain the nanobody fusion protein 2C10-hFc.
[0170] The concentration of the nanobody fusion protein was determined using a NanoDrop UV spectrophotometer (ThermoScientific), and the protein concentration was found to be between 2.66 mg / mL and 3.8 mg / mL. The purified antibody solution was then analyzed by polyacrylamide gel electrophoresis, and the results are as follows: Figure 7 As shown: The molecular weight of the antibody is consistent with expectations. The purified nanobody fusion protein has a band size of approximately 40 kDa under reducing conditions and approximately 80 kDa under non-reducing conditions.
[0171] Example 3: Analysis of the binding activity of nanobody fusion protein to human adenovirus type 55
[0172] The binding activity of the obtained nanobody fusion protein was determined by ELISA. The specific experimental method is as follows:
[0173] HADV55 inactivated virus (2 μg / mL) diluted with carbonate coating buffer (pH 9.6) was added to each well at a rate of 100 μL and incubated overnight at 4°C. The next day, the plate was washed 6 times with PBST, and blocking buffer containing 2% BSA was added. The plate was incubated at 37°C for 2 hours. The blocking buffer was discarded, and 24 serially diluted nanobody fusion protein 2C10-hFc dilution buffer (starting concentration 10 μg / mL, diluted with PBS) was added to each well at a rate of 100 μL / well, for a total of 24 gradients. Each gradient was placed in 2 wells, and the plate was incubated at 37°C for 90 min. The plate was then washed 6 times with PBST, and 100 μL of 1:4000 diluted HRP-labeled anti-human IgG antibody was added to each well. The plate was incubated at 37°C for 45 min. The plate was washed 6 times with PBST, and 50 μL of LOPD substrate chromogenic solution was added to each well. The plate was incubated at room temperature for 10 min. Finally, 50 μL of 1:4000 diluted HRP-labeled anti-human IgG antibody was added to each well. The enzyme-linked reaction was terminated with 1M sulfuric acid solution, and the optical density was measured using a dual-wavelength microplate reader at 492nm / 630nm.
[0174] The results are as follows Figure 8 As shown: the half-maximal effective concentration (EC50) of 2C10-hFc binding to human adenovirus type 55. 50 The value is 0.0019 nM.
[0175] Example 4: Efficacy of nanobody fusion protein 2C10-hFc against human adenovirus type 55 infection
[0176] Using human adenovirus type 55 as the viral target neutralized by the nanobody fusion protein, the study investigated whether the nanobody fusion protein 2C10-hFc could inhibit the infection of A549 cells by human adenovirus type 55. The experimental methods are as follows:
[0177] One day before the experiment, A549 cells in good growth condition were taken, digested with trypsin, and the cell density was adjusted to 3 × 10⁻⁶. 5 / mL, seeded into 96-well cell culture plates (100μL / well), and incubated at 37℃ in a 5% CO2 incubator for 24h; on the day of the experiment, remove the 96-well plates, discard the culture medium, wash once with serum-free culture medium, add DMEM + 2% (v / v) FBS, 100μL per well; then perform the following operations in groups:
[0178] Positive antibody control group: Anti-human adenovirus type 55 mouse serum (prepared in Example 1) was diluted with serum-free culture medium and serially diluted 2-fold to a total of 20 dilutions (specific concentrations: 1250, 625, 312.5, 156.25, 78.13, 39.06, 19.53, 9.77, 4.88, 2.44, 1.22, 0.61, 0.30, 0.15, 0.08, 0.04, 0.0191, 0.0095, 0.0048, 0.0024 nM). The antibody solution to be tested was mixed with the HAdV55 virus stock solution prepared in step one of Example 1 (diluted with serum-free culture medium to a virus concentration of 2 × 10⁻⁶). 3 Mix TCID50 / mL at a volume ratio of 1:1, incubate at 37°C for 1.5 h, then add 100 μL / well to each well and continue incubation at 37°C in a 5% CO2 incubator for 1 h.
[0179] Experimental Group (Nanobody Fusion Protein): The nanobody fusion protein prepared in Example 2 was diluted with serum-free medium to obtain test antibody solutions containing different concentrations (initial concentration of 1250 nM, serially diluted 2-fold, for a total of 20 dilutions, specifically: 1250, 625, 312.5, 156.25, 78.13, 39.06, 19.53, 9.77, 4.88, 2.44, 1.22, 0.61, 0.30, 0.15, 0.08, 0.04, 0.0191, 0.0095, 0.0048, 0.0024 nM) of nanobody fusion protein. Two wells were set up for each gradient. The test antibody solutions were then mixed with the HAdV55 virus stock solution prepared in step one of Example 1 (diluted with serum-free medium to a virus concentration of 2 × 10⁻⁶). 3 Mix TCID50 / mL at a volume ratio of 1:1, incubate at 37°C for 1.5 h, then add 100 μL / well to each well and continue incubation at 37°C in a 5% CO2 incubator for 1 h.
[0180] Virus group (VIRUS): Serum-free culture medium was mixed with the HAdV55 virus stock solution prepared in step one of Example 1 (diluted with serum-free culture medium to a virus concentration of 2 × 10⁻⁶). 3 Mix TCID50 / mL at a volume ratio of 1:1, incubate at 37°C for 1.5 h, then add 100 μL / well to each well and continue incubation at 37°C in a 5% CO2 incubator for 1 h.
[0181] Irrelevant antibody control group: Anti-human epidermal growth factor receptor antibody (Anti-EGFR) (described in invention patent CN102993305B) was diluted with serum-free culture medium to obtain test antibody solutions containing different concentrations (initial concentration of 1250 nM, serially diluted 2-fold, a total of 20 dilutions were set, with specific concentrations of: 1250, 625, 312.5, 156.25, 78.13, 39.06, 19.53, 9.77, 4.88, 2.44, 1.22, 0.61, 0.30, 0.15, 0.08, 0.04, 0.0191, 0.0095, 0.0048, 0.0024 nM) of Anti-EGFR antibody; the test antibody solution was mixed with the HAdV55 virus stock solution prepared in step one of Example 1 (diluted with serum-free culture medium to a virus concentration of 2×10⁻⁶). 3 Mix CID50 / mL at a volume ratio of 1:1, incubate at 37°C for 1.5 h, then add 100 μL / well to each well and continue incubation at 37°C in a 5% CO2 incubator for 1 h.
[0182] Empty cell control group (CELL): Serum-free medium was added to the wells after incubation at 37°C for 1.5 h, 100 μL / well, and then incubated at 37°C in a 5% CO2 incubator for 1 h.
[0183] Remove the 96-well plate, discard the supernatant, add DMEM + 2% (v / v) FBS medium (100 μL / well), and continue culturing at 37°C with 5% CO2 for 1 week until obvious cytopathic effects appear. After incubation at 37°C (at least 1 hour), replace with 2% FBS-DMEM and return to the incubator for continued culture, observing cell changes daily. After typical CPE appears, wash the aforementioned 96-well cell culture plate twice with sterile PBS, add 100 μL / well of DMEM medium (containing 10% FBS and 10% CCK8 reagent), and incubate at 37°C for 1-2 hours. Measure the absorbance at 450 nm using a microplate reader. Calculate the inhibition rate (%) of each antibody against cytopathic effects = (450 nm absorbance of the antibody / virus mixed incubation group - 450 nm absorbance of the virus group) / (450 nm absorbance of the empty cell control group - 450 nm absorbance of the virus group) × 100%. Use the detected OD... 450 The inhibition rate was calculated using nm data. Then, the logarithm of the concentration (10) was plotted on the x-axis, and the probability value corresponding to the inhibition rate was plotted on the y-axis. The IC50 was calculated using the probability value corresponding to an inhibition rate of 50%. 50 value.
[0184] The results are as follows Figure 9As shown, the half-maximal inhibitory concentration (IC50) of 2C10-hFc against human adenovirus type 55 is... 50 The value is 1.161 nM.
[0185] Example 5: Humanization and Activity Evaluation of Anti-human Adenovirus Type 55 Nanobody Fusion Protein
[0186] 1. Humanization of anti-human adenovirus type 55 nanobody
[0187] NbBcII10, a universal template framework for humanizing single-domain antibodies, was utilized. FGLA Humanization of nanobodies against human adenovirus type 55. NbBcII 10 FGLA The amino acid sequence is shown in SEQ ID No. 16: it includes a frame region (FR) and an antibody gene complementarity-determining region (CDR). The frame region is divided into four parts, defined as FR1, FR2, FR3 and FR4, and denoted as SEQ ID No. 17, SEQ ID No. 18, SEQ ID No. 19 and SEQ ID No. 20, respectively. The complementarity-determining region is divided into three parts, which can be defined as CDR1, CDR2 and CDR3, and denoted as positions 26-37, 54-63 and 100-117 of SEQ ID No. 16, respectively.
[0188] The humanization method of 2C10-hFc is as follows: Using the Complementarity Determining Region Grafting method, the CDR regions of the target antibody 2C10-hFc are replaced with the corresponding CDR regions CDR1, CDR2, and CDR3 of the template antibody, while retaining the corresponding FR regions of the template antibody. This completes the humanization of the anti-human adenovirus type 55 nanobody 2C10, resulting in the humanized nanobody h2C10, whose amino acid sequence is SEQ ID No. 5. The nucleotide sequence of the gene encoding the humanized nanobody h2C10 protein is shown in SEQ ID No. 7.
[0189] 2. Construction of the eukaryotic expression vector pTSE-hFc-h2C10-VHH for humanized nanobody against human adenovirus type 55
[0190] Based on the gene sequence of the humanized nanobody against human adenovirus type 55 (SEQ ID No. 7), its C-terminus was linked to the Fc segment (hFc) of human immunoglobulin G to obtain the encoding gene of the h2C10-hFc fusion protein. The nucleotide sequence of the encoding gene is SEQ ID No. 11, and the expressed amino acid sequence is SEQ ID No. 9, which is the h2C10-hFc fusion protein against human adenovirus type 55. The variable region gene of the humanized antibody was designed and synthesized by BGI Genomics. Using conventional molecular biology methods, the synthesized variable region gene of the humanized nanobody was cloned into the pTSE-hFc vector to construct the eukaryotic expression vector pTSE-hFc-h2C10-VHH.
[0191] The structure of the recombinant vector pTSE-hFc-h2C10-VHH is described as follows: The recombinant vector is obtained by replacing the fragment between the two restriction endonuclease sites Sal I and Nhe I of the DNA molecule with the nucleotide sequence SEQ ID No. 7, while keeping the other sequences of the vector pTSE-hFc unchanged.
[0192] 3. Analysis of the binding activity of humanized nanobody fusion protein to human adenovirus type 55
[0193] The humanized nanobody fusion protein h2C10-hFc was prepared according to the method in step 2 of Example 2. The binding activity of the humanized nanobody fusion protein h2C10-hFc to human adenovirus type 55 was detected according to Example 3.
[0194] The results are as follows Figure 10 As shown: the half-maximal effective concentration (EC50) of h2C10-hFc binding to human adenovirus type 55. 50 The value is 0.0042 nM.
[0195] 4. The efficacy of humanized nanobody fusion protein against human adenovirus type 55 infection.
[0196] The half-maximum inhibitory concentration (IC50) of the humanized nanobody fusion protein h2C10-hFc against human adenovirus type 55 was detected according to the method in Example 4. 50 ).
[0197] The results are as follows Figure 11 As shown: The h2C10-hFc prepared in this invention can effectively inhibit human adenovirus type 55 infection, and its IC50 value is [missing information]. 50 It is 5.33 nM.
[0198] 5. Detection of acid-base stability of humanized nanobody fusion protein
[0199] Antibody stability is an important indicator for evaluating antibody druggability. The acid-base stability of the humanized nanobody fusion protein h2C10-hFc was preliminarily evaluated using an accelerated incubation experiment. The antibody was diluted to 200 nM and placed in PBS buffer adjusted to different pH values (5.5, 7.4, and 8.0), then incubated at 37°C for 7, 14, 21, and 28 days. The original sample (pH 7.4) was stored as a control at 4°C. The binding activity of the treated h2C10-hFc samples to HADV55 was analyzed using enzyme-linked immunosorbent assay (ELISA).
[0200] The results are as follows Figure 12 As shown, after the antibodies were placed at 37°C for 4 weeks under acidic (pH 5.5) and alkaline (pH 8.0) conditions, their binding activity to HADV55 did not decrease significantly, indicating that the humanized nanobody fusion protein h2C10-hFc has good acid-base stability, which is beneficial for later research and development.
[0201] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. A nanobody targeting human adenovirus type 55, characterized in that, The nanobody has three complementary determinant clusters CDR1, CDR2 and CDR3; the amino acid sequence of CDR1 is shown in SEQ ID No.1, the amino acid sequence of CDR2 is shown in SEQ ID No.2 and the amino acid sequence of CDR3 is shown in SEQ ID No.
3.
2. The nanobody according to claim 1, characterized in that, The nanobody is either A1) or A2) below: A1) Nanobody with an amino acid sequence as shown in SEQ ID No. 4; A2) Nanobody with amino acid sequence as shown in SEQ ID No. 5 3. A biomaterial relating to the nanobody of claim 1 or 2, wherein the biomaterial is any one of the following: B1) A nucleic acid molecule encoding the nanobody of claim 1 or 2; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecules described in B1); B4) A recombinant vector containing the expression cassette described in B2); B5) Recombinant microorganisms containing the nucleic acid molecules described in B1); B6) Recombinant microorganisms containing the expression cassette described in B2); B7) Recombinant microorganisms containing the recombinant vector described in B3); B8) Recombinant microorganisms containing the recombinant vector described in B4).
4. The biomaterial according to claim 3, characterized in that, B1) The nucleic acid molecule is a nucleic acid molecule encoding the nanobody of claim 1 or 2, wherein the encoding gene of CDR1 is nucleotides 76-102 of SEQ ID No. 6, the encoding gene of CDR2 is nucleotides 151-180 of SEQ ID No. 6, and the encoding gene of CDR3 is nucleotides 289-339 of SEQ ID No.
6.
5. The biomaterial according to claim 3 or 4, characterized in that, The nucleic acid molecule is any one of the following: C1) DNA molecules with nucleotide sequences as shown in SEQ ID No. 6; C2) DNA molecules with nucleotide sequences as shown in SEQ ID No.
7.
6. A method for preparing the nanobody according to claim 1 or 2, comprising the following steps: Nucleic acid molecules encoding the nanobody of claim 1 or 2 are introduced into recipient cells to obtain transgenic cells expressing the nanobody, and the transgenic cells are cultured to obtain the nanobody.
7. The preparation method according to claim 6, characterized in that, The nucleic acid molecule encoding the nanobody of claim 1 or 2 is any one of the following: C1) DNA molecules with nucleotide sequences as shown in SEQ ID No. 6; C2) DNA molecules with nucleotide sequences as shown in SEQ ID No.
7.
8. A nanobody fusion protein, characterized in that, The nanobody fusion protein is formed by fusing the nanobody described in claim 1 or 2 with the Fc domain of an immunoglobulin.
9. The nanobody fusion protein according to claim 8, characterized in that, The fusion protein is any one of the following: The M1 amino acid sequence is shown in SEQ ID No. 8 of the fusion protein; The M2 amino acid sequence is shown in SEQ ID No.
9.
10. An ELISA detection kit targeting human adenovirus type 55, characterized in that, The kit comprises the nanobody of claim 1 or 2, the biomaterial of claim 3 or 4, or the fusion protein of claim 8 or 9.
11. Any of the following applications: E1) The use of the nanobody described in claim 1 or 2 in the preparation of a human adenovirus type 55 detection reagent; E2) Use of the nanobody of claim 1 or 2 in the preparation of a medicament for the prevention and / or treatment of human adenovirus type 55.