A molecular marker tightly linked to a QTL for long stigma in rice and its application
By developing the InDel molecular marker Z05, which is closely linked to the length of the rice column flower, the problem of difficult improvement of the exposure rate of rice stigma is solved, the seed production yield of hybrid rice is improved, and the research basis for the improvement of rice germplasm resources and gene cloning is provided.
Patent Information
- Application Number
- CN202311652814.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-30
- Publication Date
- 2025-08-22
- Estimated Expiration
- 2043-11-30
AI Technical Summary
The prior art is difficult to effectively locate and improve the exposure rate of rice stigma, resulting in a low heterocrossing fruiting rate and affecting the production of hybrid rice seed production.
A InDel molecular marker Z05 closely linked to the length of rice column flower was developed, and corresponding primer pairs were designed to detect and assist in the selection of long stigma rice parents, and the heterozygous fruiting rate was improved by increasing the length of column flower.
Through molecular marker assisted breeding, the seed production yield of hybrid rice is improved, providing the basis for improving rice germplasm resources, and laying the foundation for cloning and functional analysis of the total length gene of column flower.
Smart Images

Figure BDA0004587910990000051 
Figure BDA0004587910990000052 
Figure BDA0004587910990000061
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of rice molecular genetic breeding, and in particular relates to a molecular marker tightly linked to a rice long stigma QTL and its application. Background Art
[0002] Rice is one of the world's most important food crops, playing a crucial role in ensuring food security and biological research. With population growth and declining arable land, significantly increasing yield per unit area is essential. Hybrid rice, introduced in my country in the 1970s, boasts a yield approximately 20% higher than conventional rice of the same maturity period. Its commercialization has significantly boosted rice productivity. Utilizing hybrid vigor in rice has proven to be one of the most effective ways to increase rice yield.
[0003] my country is the world's largest producer and consumer of hybrid rice seeds. The annual hybrid rice planting area is 1.4×10 7 hm 2 , about 3.5×10 hybrid rice seeds are needed 5 Hybrid rice requires annual F1 seed production. The area and yield of F1 seed production in the previous season determine the planting area for the following hybrid rice season. Given a certain number of effective panicles per unit area, the F1 hybrid rice seed yield primarily depends on the outcrossing fruit set rate. This rate is primarily influenced by the degree of stigma exposure. Increasing the stigma exposure rate in male sterile lines increases the chances of receiving foreign pollen after flowering, thereby compensating for the low pollination rate caused by differences in flowering timing between the parents.
[0004] Yang (1997) found that the stigma exsertion rate was significantly positively correlated with F1 seed production yield. When the stigma exsertion rate of the sterile line increased by 1%, its outcrossing fruiting rate would increase by 0.74-0.92%, and the F1 seed production yield would increase by 47-68 kg / hm2. 2 . It has become a consensus that the outcrossing rate can be increased by improving the stigma exsertion of sterile lines, thereby improving the hybrid rice seed production yield. A large number of studies have shown that there is a wide variation in stigma exsertion among different rice materials, the stigma trait has a high broad-sense heritability, and the gene effect is mainly additive. To date, at least 129 QTLs controlling the stigma exsertion rate have been identified, distributed on 12 rice chromosomes. However, the stigma exsertion rate is easily affected by various external environments (such as weather, humidity, temperature, etc. during the heading and flowering period), making it difficult to conduct subsequent in-depth research after initial positioning.
[0005] The rate of stigma exsertion in rice is primarily determined by stigma length, style length, and the combined length of stigma and style (hereafter referred to as total style-flower length). Increasing either stigma or style length increases total style-flower length, thereby improving stigma exsertion. Rice pistil development and elongation occur within the spikelet, making them less susceptible to environmental influences, allowing for high phenotypic accuracy and easier interpretation of biological processes. Therefore, using stigma length, style length, or total style-flower length as indicators for gene mapping, gene cloning, and functional analysis is more reliable and feasible.
[0006] To date, researchers have detected 43 QTLs controlling stigma length, 40 QTLs controlling style length, and 33 QTLs controlling total stylol length using various populations. Liu et al. (2015) identified a stable QTL controlling total stylol length using 54 lines from a Kasalath fragment substitution population on a Nipponbare background and fine-mapped it to a 19.8 kb interval, with LOC_Os03g14850 as the annotated gene. Field seed production evaluation trials have shown that seed production yields in small combinations using sterile lines containing the long stigma allele were 16% higher than in controls (Dang et al., 2020).
[0007] It is of great significance to explore the long stigma gene of rice and find its closely linked markers, and to use them to improve the outcrossing fruiting rate of hybrid rice maternal sterile lines and increase the hybrid rice seed production yield. Based on this, the present invention obtains F2 and F2 lines with segregation of the total stigma length trait by hybridizing two parents with extremely significant differences in total stigma length, 7001S (1.636mm) and Z913S (2.468mm). 2:3 population, construct genetic linkage map of F2 population, investigate F2 and F 2:3 The total length of the stigma of the population was phenotyped and QTL was located; then a secondary segregating population of the target site was constructed to finely locate the target site, and molecular markers closely linked to it were found for assisted selection of rice thermosensitive genic male sterile lines with long stigma and high outcrossing rate. Summary of the Invention
[0008] The technical problem to be solved by the present invention is to provide a molecular marker tightly linked to a QTL for rice style length and an application thereof.
[0009] In order to solve the above technical problems, the present invention adopts the following technical solutions:
[0010] The invention discloses an InDel molecular marker Z05 related to rice style length. The nucleotide sequence of the InDel molecular marker Z05 is shown in SEQ ID NO: 1, namely, CACTCCGCAAATTAACACTTGGACTGCCGACTGGATTGAGTTTTATTCAAAGCATAGATTGGGCTTCCAATTAGAGTTGATAACCCAACGATTTGGAGATTCGGCAATATATGATAAAG.
[0011] Use of the InDel molecular marker Z05 disclosed in the present invention in at least one of the following 1)-5):
[0012] 1) Application in detecting or assisting in detecting the stigma length of rice pistils;
[0013] 2) Application in screening or identifying rice with a high rate of stigma exsertion;
[0014] 3) Application in the early prediction of stigma exsertion rate in rice pistils;
[0015] 4) Application in molecular marker-assisted breeding of photothermosensitive genic male sterile lines with high outcrossing rates;
[0016] 5) Application in the improvement of germplasm resources of photothermosensitive genic male sterile lines with high outcrossing rate.
[0017] Use of the InDel molecular marker Z05 disclosed in the present invention in at least one of the following 1)-5):
[0018] 1) Application in the preparation of a reagent for detecting or assisting in detecting the stigma length of rice pistils;
[0019] 2) Application in the preparation of reagents for screening or identifying rice with a high rate of stigma exsertion;
[0020] 3) Application in the preparation of early prediction reagents for rice pistil stigma exsertion rate;
[0021] 4) Application of molecular marker-assisted breeding reagents in the preparation of photothermosensitive genic male sterile lines with high outcrossing rates;
[0022] 5) Application of germplasm resource improvement reagents in the preparation of photothermosensitive genic male sterile lines with high outcrossing rates.
[0023] A primer pair for detecting the InDel molecular marker Z05. Preferably, the primer pair includes Z05-F: 5-CTTGGACTGCCGACTGGATT-3 and Z05-R: 5-CCTTTCCCCACGCACCTTTA-3.
[0024] A kit for detecting the length of rice stylophores, comprising a primer pair for detecting the InDel molecular marker Z05. Preferably, the kit comprises Z05-F: 5-CTTGGACTGCCGACTGGATT-3 and Z05-R: 5-CCTTTCCCCACGCACCTTTA-3.
[0025] Use of a primer pair for detecting the InDel molecular marker Z05 or a kit comprising the primer pair for detecting the InDel molecular marker Z05 in at least one of any one of 1) to 5) below:
[0026] 1) Application in detecting or assisting in detecting the stigma length of rice pistils;
[0027] 2) Application in screening or identifying rice with a high rate of stigma exsertion;
[0028] 3) Application in the early prediction of stigma exsertion rate in rice pistils;
[0029] 4) Application in molecular marker-assisted breeding of photothermosensitive genic male sterile lines with high outcrossing rates;
[0030] 5) Application in the improvement of germplasm resources of photothermosensitive genic male sterile lines with high outcrossing rate.
[0031] Use of a primer pair for detecting the InDel molecular marker Z05 or a kit comprising the primer pair for detecting the InDel molecular marker Z05 in at least one of any one of 1) to 5) below:
[0032] 1) Application in the preparation of a reagent for detecting or assisting in detecting the stigma length of rice pistils;
[0033] 2) Application in the preparation of reagents for screening or identifying rice with a high rate of stigma exsertion;
[0034] 3) Application in the preparation of early prediction reagents for rice pistil stigma exsertion rate;
[0035] 4) Application of molecular marker-assisted breeding reagents in the preparation of photothermosensitive genic male sterile lines with high outcrossing rates;
[0036] 5) Application of germplasm resource improvement reagents in the preparation of photothermosensitive genic male sterile lines with high outcrossing rates.
[0037] Beneficial effects of the present invention:
[0038] The present invention discloses a molecular marker Z05 that is tightly linked to a QTL for long stigma in rice. Molecular marker Z05 can be used to assist breeding and select hybrid rice seed parents with long stigmas. Increasing the stylus length of the seed-producing parents will help improve the rice outcrossing rate and thus increase the hybrid rice seed yield. The present invention also provides a research basis for the future cloning and functional analysis of the total stylus length gene. BRIEF DESCRIPTION OF THE DRAWINGS
[0039] Figure 1 The performance and stigma morphology of 7001S and Z913S plants. A: 7001S plant performance; B: 7001S stigma morphology; C: Z913S plant performance; D: Z913S stigma morphology.
[0040] Figure 2 Combine F2 and F for 7001S / Z913S 2:3 Distribution of stylus length in the population.
[0041] Figure 3 This is a QTL controlling style length located on chromosome 3. ★ in the figure indicates the location of TSSL3.1, which is located between SSR markers RM6349 and RM523.
[0042] Figure 4 TSSL3.1 is a near-isogenic line of TSSL3.1 Z913S Build a flowchart.
[0043] Figure 5 For the fine positioning of TSSL3.1.
[0044] Figure 6 This is the genotype identification of individual plants in the F2 population of the 7001S / Z913S combination using molecular marker Z05; in the figure, P1 is the short-stigma 7001S banding type, and P2 is the long-stigma Z913S banding type. DETAILED DESCRIPTION
[0045] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.
[0046] Example 1 7001S / Z913S F2, F 2:3 Population construction and style length phenotyping
[0047] The material used in this embodiment is the short stigma photothermosensitive genic male sterile line 7001S ( Figure 1 A, style length 1.636mm), long stigma thermosensitive genic male sterile line Z913S ( Figure 1 C, style length 2.468 mm) and their hybridization and self-pollination-derived F2 and F 2:3 Generations: 7001S, Z913S, F1, F2, and F 2:3 The identification of the styloid length phenotype was carried out by sampling the spikelets of the materials when they were in full bloom. Ten spikelets of each material / single plant were collected and stored in a centrifuge tube containing 2 ml of a pre-prepared fixative (0.1 ml of 38% formaldehyde: 0.1 ml of glacial acetic acid: 1.7 ml of 50% alcohol: 0.1 ml of glycerol). The tubes were brought back to the laboratory and photographed using a stereo microscope (MZ11, Guangzhou Mingmei Optoelectronics Technology Co., Ltd.) equipped with a camera (MDX4). Figure 1 B. Figure 1 D), and then the styloid length was measured by an image processing system (MicroShot v1.2), and 8 complete stigmas were measured for each material. Figure 2 As shown, 7001S / Z913S F2 and F 2:3 The stylus length phenotype in the population showed a continuous normal distribution, indicating that the stylus length in this combination was a quantitative trait.
[0048] Example 2. Extraction of Total DNA from Leaves of 7001S, Z913S, 7001S / Z913S F1, and F2 Segregating Populations
[0049] Total DNA from leaves was extracted using the CTAB method. The reagents used in the process included CTAB extraction solution (0.2M Tris-Cl, 0.25mM NaCl, 25mM EDTA, 0.5% (by weight) SDS, pH 7.5), chloroform, isoamyl alcohol, and anhydrous ethanol. The specific steps are as follows:
[0050] A. During the tillering stage of rice, collect an appropriate amount of fresh leaves and store them in a -80°C freezer. Grind the leaves into a powder in a -20°C pre-cooled mortar with liquid nitrogen. Pour the powder into a 2.0ml centrifuge tube, add 600μL of SDS extraction solution, shake well, and incubate in a 65°C water bath for 30 minutes, shaking occasionally 3-4 times.
[0051] B. Add 100 μL of 5 M KAc to the centrifuge tube, shake well, and place on ice for 30 minutes. Add 400 μL of a chloroform-isoamyl alcohol (24:1, v / v) mixture, vortex, shake well, and centrifuge.
[0052] C. Transfer the supernatant to another centrifuge tube, add 400 μL of a mixture of chloroform and isoamyl alcohol (24:1, v / v), vortex, shake well, and centrifuge. Transfer the supernatant to another sterile centrifuge tube, add 700 μL of -20°C pre-cooled anhydrous ethanol, and shake well.
[0053] D. Store in a -20℃ refrigerator for 20 minutes, centrifuge, discard the supernatant, add 400μL 4℃ 70% ethanol to wash the precipitate for 10 minutes, discard the 70% ethanol, air-dry the DNA, dissolve it in sterile water, and store in a -20℃ refrigerator for later use.
[0054] Example 3. Primer development and polymorphism screening
[0055] Primers were screened based on reported SSR primers (International Rice Genome Sequencing Project, 2005) and developed indel markers (RAP-DB, http: / / rapdb.dna.affrc.go.jp / ). Among 1239 primer pairs, 139 showed significant polymorphic differences between the two parents (7001S and Z913S). The main reagents used in the process included Taq enzyme, dNTPs, acrylamide, sodium hydroxide, glacial acetic acid, and AgNO3. The polymorphic primer screening procedure is as follows:
[0056] A. DNA from parents 7001S and Z913S was extracted according to Example 2. The extracted DNA samples from the two parents were used for screening of polymorphic markers.
[0057] B.PCR system and procedure:
[0058]
[0059] PCR reaction procedure:
[0060] The reaction was performed on a PTC-100 Peltier Thermal Cycler (MJ Research Inc., USA) and the amplification program was set as follows:
[0061]
[0062] C. Gel electrophoresis
[0063] The amplified products were electrophoresed on an 8.0% polyacrylamide gel with a 100-bp DNA marker as a control. The electrophoresis buffer was 0.5× TBE and the gel was electrophoresed at a constant voltage of 180 V. After electrophoresis, the gel was stained using silver staining: fixation with a fixative (10% alcohol, 0.5% glacial acetic acid) twice for 6 minutes each; permeabilization with a 0.2% AgNO₃ solution for 10-12 minutes; washing twice with ddH₂O; and development with a 1.5% NaOH solution and a 1% formaldehyde colorimeter. The gel was rinsed with running water until clear bands appeared, then the gel was allowed to air dry and photographed for storage.
[0064] Example 4. Distribution of polymorphic markers in the F2 population and QTL mapping of style length
[0065] 184 individual plants in the F2 population were genotyped using 139 pairs of polymorphic markers (8-13 pairs on each chromosome) screened between the parents. A genetic map of the 7001S / Z913S F2 combination was constructed using Joinmap3.0 software based on linkage exchange rules. The complete composite interval mapping method in QTL IciMapping 4.1 software, based on stepwise regression linear analysis combined with maximum likelihood estimation, was used to detect additive QTLs for style flower length. Markers were selected and removed at significance levels of PIN = 0.05 and POUT = 0.10, respectively, with an LOD threshold of 2.5. 2:3 A major QTL locus, TSSL3.1, controlling style flower length, was detected in the marker interval RM6349-RM523 of rice chromosome 3 in all populations. TSSL3.1 was found in F2 and F 2:3 The LOD values were 8.1 and 5.7, respectively, explaining phenotypic variation of 13.68% and 10.34%, respectively. Figure 3 ).
[0066] Example 5. Fine mapping of the major QTL locus TSSL3.1 for style length
[0067] Using Z913S as the donor parent and 7001S as the recurrent parent, TSSL3.1 flanking markers (RM6349 and RM523) were used to assist selection in the BC5F2 generation to obtain the near-isogenic line TSSL3.1 containing the target locus TSSL3.1. Z913S ( Figure 4 ); At the same time, in order to encrypt the markers of the initial positioning interval of TSSL3.1 (RM6349-RM523), 5 pairs of published SSR primers were found (International Rice Genome Sequencing Project, 2005). At the same time, based on the sequence alignment results of 7001S and Z913S, 10 Indel markers were designed, of which 3 pairs of Indel molecular markers were significantly polymorphic between the parents (Table 1); Then, using the Nipponbare genome sequence as the reference sequence, the 3 pairs of Indel molecular markers with good polymorphism were anchored on the BAC / PAC clones, and the physical position and corresponding order of each marker were determined. Finally, the recombinant analysis was performed based on the phenotypic data (genotype) of the individual plant and the marker genotype at each marker, and the gene position was determined according to the number of recombinants at each marker ( Figure 5 ).
[0068] Table 1 TSSL3.1 flanking sequences and three pairs of marker sequences used for fine mapping
[0069]
[0070] 2933 individual plants of the F2 population were identified using markers at both ends of the confidence interval obtained by linkage analysis. Genotyping analysis of markers based on the RM6349 locus revealed 150 individual plants that had undergone recombination between the RM6349 locus and the TSSL3.1 locus. Genotyping analysis of markers based on the RM523 locus revealed 227 individual plants that had undergone recombination between the RM523 locus and the TSSL3.1 locus. Further analysis revealed that 32, 8, and 129 recombinants were identified at markers Z01, Z05, and Z07, respectively. Therefore, TSSL3.1 was precisely located within the 162.7kb interval of Indel molecular markers Z01 and Z05 ( Figure 5 ).
[0071] Example 6. Application of molecular marker Z05 in breeding of long-stigma photothermosensitive genic male sterile lines
[0072] The F2 generation was obtained by hybridizing the japonica photothermosensitive genic male sterile line 7001S (1.636 mm) with the long-stigma indica thermosensitive genic male sterile line Z913S (2.468 mm). The 7001S / Z913S F2 population was planted in the field, and individual plant genotypes were identified at the seedling stage using the indel marker Z05. The specific steps were similar to those for analyzing the distribution of polymorphic primers in the F2 population, including extraction of total DNA from leaves of the F2 segregating population (see the steps in Example 2), polyacrylamide gel electrophoresis, and analysis of distribution (Examples 3 and 4).
[0073] The results are as follows Figure 6Bands amplified by the Z05 marker in the F2 generation are shown. Among them, the banding patterns of eight plants, including No. 740, were consistent with the banding pattern of P1, the short-stigma photothermosensitive genic male sterile line 7001S; the banding patterns of 15 plants, including No. 738, were consistent with the banding pattern of P2, the long-stigma thermosensitive genic male sterile line Z913S; and the banding patterns of 23 plants, including No. 737, were hybrids of P1 and P2. Therefore, plants with P2 banding patterns and hybrids of P1 and P2 were retained in the F2 generation. The length of the style flower was measured after each plant reached peak flowering. The results showed that 26 of the 38 plants with the long-stigma Z05 banding pattern had style flower lengths greater than 2.200 mm, exceeding 68% of the number of plants selected by the marker (Table 2). By detecting molecular markers associated with style length, it is possible to predict style length and select seedlings at the seedling stage. This not only reduces production costs but also significantly improves selection efficiency, allowing for the rapid identification of long-stigma lines for the breeding of photoperiod- and thermo-sensitive genic male sterile lines. By identifying these major gene loci to predict style length, the breeding process for photoperiod- and thermo-sensitive genic male sterile lines with long stigmas and high outcrossing rates can be rapidly accelerated.
[0074] Table 2 Genotype identification and stylus length of some individual Z05 plants in the F2 population
[0075]
[0076]
[0077] Note: “1” indicates the banding pattern of the short-stigma photothermo-sensitive genic male sterile line 7001S, “2” indicates the banding pattern of the long-stigma photothermo-sensitive genic male sterile line Z913S, and “3” indicates the heterozygous banding pattern of 7001S and Z913S.
Claims
1. An InDel molecular marker Z05 related to rice style length, characterized in that: The nucleotide sequence of the InDel molecular marker Z05 is shown in SEQ ID NO:
1.
2. Use of the InDel molecular marker Z05 according to claim 1 in at least one of the following 1) to 5): 1) Application in detecting or assisting in detecting the stigma length of rice pistils; 2) Application in screening or identifying rice with a high rate of stigma exsertion; 3) Application in the early prediction of stigma exsertion rate in rice pistils; 4) Application in molecular marker-assisted breeding of photothermosensitive genic male sterile lines with high outcrossing rates; 5) Application in the improvement of germplasm resources of photothermosensitive genic male sterile lines with high outcrossing rate.
3. Use of the InDel molecular marker Z05 according to claim 1 in at least one of the following 1) to 5): 1) Application in the preparation of a reagent for detecting or assisting in detecting the stigma length of rice pistils; 2) Application in the preparation of reagents for screening or identifying rice with a high rate of pistil stigma exsertion; 3) Application in the preparation of early prediction reagents for rice pistil stigma exsertion rate; 4) Application of molecular marker-assisted breeding reagents in the preparation of photothermosensitive genic male sterile lines with high outcrossing rates; 5) Application of germplasm resource improvement reagents in the preparation of photothermosensitive genic male sterile lines with high outcrossing rates.
4. A primer pair for detecting the InDel molecular marker Z05 according to claim 1.
5. The primer pair according to claim 4, characterized in that The primer pair includes Z05-F: 5-CTTGGACTGCCGACTGGATT-3 and Z05-R: 5-CCTTTCCCCACGCACCTTTA-3.
6. A kit for detecting the length of rice stylophore, characterized in that: The kit comprises the primer pair according to claim 4 or 5.
7. Use of the primer pair according to claim 4 or 5 or the kit according to claim 6 in at least one of the following 1) to 5): 1) Application in detecting or assisting in detecting the stigma length of rice pistils; 2) Application in screening or identifying rice with a high rate of stigma exsertion; 3) Application in the early prediction of stigma exsertion rate in rice pistils; 4) Application in molecular marker-assisted breeding of photothermosensitive genic male sterile lines with high outcrossing rates; 5) Application in the improvement of germplasm resources of photothermosensitive genic male sterile lines with high outcrossing rate.
8. Use of the primer pair according to claim 4 or 5 or the kit according to claim 6 in at least one of the following 1) to 5): 1) Application in the preparation of a reagent for detecting or assisting in detecting the stigma length of rice pistils; 2) Application in the preparation of reagents for screening or identifying rice with a high rate of stigma exsertion; 3) Application in the preparation of early prediction reagents for rice pistil stigma exsertion rate; 4) Application of molecular marker-assisted breeding reagents in the preparation of photothermosensitive genic male sterile lines with high outcrossing rates; 5) Application of germplasm resource improvement reagents in the preparation of photothermosensitive genic male sterile lines with high outcrossing rates.