A recombinant sheep beta-defensin 2 protein expressed by Pichia pastoris and its application

Abstract

The present invention discloses a recombinant sheep β-defensin 2 protein expressed by Pichia pastoris and its application. The recombinant sheep β-defensin 2 gene designed according to the CDS of the sheep β-defensin 2 gene is integrated into the genome of Pichia pastoris GS115, thereby realizing the secretory expression of the target gene on Pichia pastoris. The recombinant sheep β-defensin 2 protein expressed by Pichia pastoris eukaryotic cells has a strong antibacterial effect and has broad application prospects in the development of new antibiotic alternative products and antimicrobial peptides for sheep feed.

Description

Technical Field

[0001] The invention relates to sheep recombinant antimicrobial peptides, and in particular to the expression of recombinant sheep beta-defensin 2 protein in Pichia pastoris and the verification of its antimicrobial activity. Background Art

[0002] With the increasing research on antibiotics, more than 60 kinds of antibiotics have been used in animal husbandry, playing an important role in the prevention and treatment of animal diseases, improving feed utilization efficiency, and promoting the rapid growth of livestock and poultry. However, with the long-term addition and abuse of subtherapeutic doses of antibiotics, the production of drug-resistant bacteria, dysbacteriosis, adverse reactions, and drug residues have seriously affected the safety of animal food, endangering the environment and human health. Seeking green and efficient alternatives to antibiotics has become a research focus. Antimicrobial peptides (AMPs) are polypeptide substances that are widely present in nature. As a key component of the body's innate immunity, they have biological functions such as resistance to bacteria, fungi, tumors, and viruses. AMPs have become one of the hot spots in the research of antibiotic substitutes due to their advantages such as being less likely to produce drug resistance and no residue.

[0003] For ruminants, the rumen is an important organ for nutrient fermentation, which can produce short-chain fatty acids and microbial proteins to provide energy and protein for individuals. Studies have found that adding AMPs (e.g., PBD-m1 and LUC-n) to the diet can effectively improve the fermentation function of the rumen, increase the concentrations of acetic acid, propionic acid and total volatile fatty acids, and at the same time improve the structure of the rumen microbiome, change the rumen fermentation parameters, and improve feed utilization. In addition, the results of "Study on the Effect of SBD2 on the Resistance of Hu Sheep to F17 Escherichia coli Infection and Its Regulatory Mechanism" show that beta-defensin 2 is an important endogenous component of the digestive tract (mainly the intestine) of ruminants to resist infection.

[0004] At present, protein expression generally uses prokaryotic expression system, which has the advantages of short expression cycle and high expression amount, but also has some disadvantages: the expressed protein is not modified, and the activity of natural protein cannot be guaranteed. The expressed protein can be used for antibody preparation or detection, and is rarely used to express biologically active proteins; the expression time and expression level cannot be regulated, and overexpression of some target genes will lead to non-physiological reactions. The target protein is often expressed in the form of inclusion bodies, which makes it difficult to purify the product. However, using Pichia pastoris, a eukaryotic host, can achieve soluble expression of the target protein and retain its biological activity to the greatest extent, and it can be used in production with simple sterilization and freeze-drying.

[0005] Although there are many studies on the expression of sheep antimicrobial peptides in the prokaryotic expression system of Escherichia coli and the eukaryotic expression system of Pichia pastoris, there are no reports on the exogenous expression of sheep β-defensin 2 (SBD2). Chinese patent CN101538582A proposes a method for expressing duck β-defensin 2 recombinant protein, but due to the physiological environment and flora of the digestive tract of ruminants, the duck β-defensin 2 recombinant protein cannot exert its antibacterial activity after being fed to ruminants such as sheep.

[0006] In addition, Chinese patent CN1699416A proposes a glycine-rich recombinant protein (including a peptide segment with 1 to 5 AA added to the end of a natural antimicrobial peptide sequence), but the activity of this type of antimicrobial recombinant protein has only been verified under mild physiological conditions. Summary of the invention

[0007] The purpose of the present invention is to provide a recombinant sheep β-defensin 2 protein expressed by Pichia pastoris and its application. The recombinant sheep β-defensin 2 protein expressed by Pichia pastoris has the potential to exert a strong antibacterial effect in the physiological environment of the digestive tract of ruminants such as sheep.

[0008] In order to achieve the above object, the present invention adopts the following technical solutions:

[0009] A sheep-derived acid-resistant recombinant antimicrobial peptide comprises a recombinant sheep beta-defensin 2 protein.

[0010] Preferably, the acid-resistant recombinant antimicrobial peptide further comprises a flexible linker peptide segment expressed by fusion with the recombinant sheep β-defensin 2 protein.

[0011] Preferably, the amino acid sequence of the recombinant sheep β-defensin 2 protein is as shown in SEQ.ID.NO.1, and the amino acid sequence size is 64AA.

[0012] Preferably, the flexible linker peptide segment is connected to the carboxyl terminus of the recombinant sheep β-defensin 2 protein, and the amino acid sequence of the flexible linker peptide segment is GGGGS.

[0013] Preferably, the acid-resistant recombinant antimicrobial peptide also includes a fusion-expressed His tag (e.g., 6×His), and the His tag is connected to the carboxyl terminus of the recombinant sheep β-defensin 2 protein through a flexible linker peptide (that is, the amino acid sequence of the flexible linker peptide and the His tag expressed in fusion with the recombinant sheep β-defensin 2 protein can be GGGGSHHHHHH).

[0014] The preparation method of the above-mentioned sheep-derived acid-resistant recombinant antimicrobial peptide comprises the following steps:

[0015] The acid-resistant recombinant antimicrobial peptide is expressed in eukaryotic cells using an expression system constructed based on Pichia pastoris.

[0016] Preferably, the preparation method specifically comprises the following steps:

[0017] 1) Obtain the corresponding CDS according to the sheep β-defensin 2 gene, construct a recombinant vector containing the target gene (i.e., the nucleotide sequence corresponding to the amino acid sequence of the recombinant sheep β-defensin 2 protein) according to the CDS of the sheep β-defensin 2 gene, the flexible linker peptide and the His tag, and use the recombinant vector to construct a Pichia pastoris expression strain for expressing the acid-resistant recombinant antimicrobial peptide, that is, the acid-resistant recombinant antimicrobial peptide can adopt the amino acid sequence shown in SEQ.ID.NO.3, and the amino acid sequence size is 75AA (a fusion sequence containing the amino acid sequence of the target protein and the His tag);

[0018] 2) After continuous fermentation and cultivation of the Pichia pastoris expression strain, the bacterial cells are separated and removed (i.e., sterilized) to obtain a fermentation broth supernatant containing the acid-resistant recombinant antimicrobial peptide.

[0019] Preferably, in the construction of the Pichia pastoris expression strain, the Pichia pastoris GS115 strain is used as the eukaryotic host of the recombinant vector.

[0020] Preferably, the recombinant vector is obtained by connecting a nucleotide sequence containing a target gene (eg, a gene sequence corresponding to the acid-resistant recombinant antimicrobial peptide shown in SEQ.ID.NO.2) with an inducible secretory Pichia pastoris expression vector (eg, pPIC9K) backbone.

[0021] Preferably, the Pichia pastoris expression strain is obtained by subjecting Pichia pastoris transformants containing the recombinant vector to resistance pressure screening (for example, using a high concentration of antibiotic G418).

[0022] An antibacterial additive, the additive contains the above-mentioned sheep-derived acid-resistant recombinant antibacterial peptide, and the specific form of the additive can be the supernatant of the fermentation liquid of the above-mentioned Pichia pastoris expression strain.

[0023] A sheep feed, which contains the above-mentioned sheep-derived acid-resistant recombinant antimicrobial peptide, can be prepared by adding the above-mentioned antimicrobial additive to the daily feed of sheep (for example, goats, sheep) or other types of feed.

[0024] The application of the above-mentioned sheep-derived acid-resistant recombinant antimicrobial peptide in the preparation of antimicrobial agents.

[0025] Preferably, the acid-resistant recombinant antimicrobial peptide has an inhibitory effect on pathogenic Escherichia coli.

[0026] Preferably, the biological activity verification of the acid-resistant recombinant antimicrobial peptide includes performing an Oxford cup antibacterial experiment on sheep-derived pathogenic bacteria, that is, using the Oxford cup method to determine the size of the inhibition zone, thereby determining the antibacterial activity of the acid-resistant recombinant antimicrobial peptide (or target protein).

[0027] Preferably, before the Oxford cup antibacterial experiment, the acid-resistant recombinant antimicrobial peptide is treated in an in vitro simulated sheep abomasum gastric acid environment (the pH of sheep abomasum gastric acid is between 1.05 and 1.32).

[0028] The beneficial effects of the present invention are embodied in:

[0029] The present invention designs the expression of antibacterial recombinant protein based on sheep β-defensin 2. After eukaryotic expression in Pichia pastoris, activity detection shows that the antibacterial recombinant protein (actually recombinant sheep β-defensin 2 protein) has a strong antibacterial effect, and the preparation operation is simple, which is convenient for preparation application (for example, only bacteria can be removed from the fermentation liquid to separate the highly active protein). The recombinant sheep β-defensin 2 protein obtained by the present invention has broad application prospects in the development of new antibiotic alternative products and antibacterial peptides for sheep feed.

[0030] Furthermore, the present invention designs a flexible linker peptide for connecting a His tag at the carboxyl terminus of the recombinant sheep β-defensin 2 protein, which not only makes the recombinant sheep β-defensin 2 protein easier to detect, identify and subsequently purify, but also the antibacterial experimental results under acidification conditions confirm that a recombinant sheep β-defensin 2 protein fusion expression product with excellent acid resistance can be obtained using a Pichia pastoris expression system (specifically the above-mentioned Pichia pastoris expression strain), and can thus be used as an exogenous acid-resistant antibacterial preparation (for example, the fermentation broth supernatant of the above-mentioned Pichia pastoris expression strain) in a feed additive for ruminants (for example, sheep). BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 It is a double enzyme digestion identification diagram of the Pichia pastoris eukaryotic expression plasmid pPIC9K-SBD2 containing the antibacterial recombinant protein (fusion protein of recombinant SBD2 antimicrobial peptide and His tag) gene; Lane M: DL 10000 DNA marker; Lane 1: Double enzyme digestion identification results of the Pichia pastoris eukaryotic expression plasmid empty vector pPIC9K EcoR I and Not I; Lanes 2 to 4: Double enzyme digestion identification results of the Pichia pastoris eukaryotic expression plasmid pPIC9K-SBD2 EcoR I and Not I.

[0032] Figure 2The high-copy recombinant Pichia GS115 strain was screened on a high-concentration antibiotic (10 mg / mL G418) YPD plate; the left figure shows the resistance screening results of Pichia GS115 transformed with the eukaryotic expression plasmid empty pPIC9K; the right figure shows the resistance screening results of Pichia GS115 transformed with the eukaryotic expression plasmid pPIC9K-SBD2.

[0033] Figure 3 This is the PCR identification map of the recombinant Pichia pastoris strain culture medium integrated with the antibacterial recombinant protein gene (fusion protein of recombinant SBD2 antimicrobial peptide and His tag) under 10 mg / mL G418 pressure screening conditions; Lane M: DL 1000 DNA marker; Lane 1: negative control; Lane 2: pPIC9K empty vector strain control.

[0034] Figure 4 The Western Blot identification patterns of the antibacterial recombinant proteins expressed by recombinant Pichia pastoris under different conditions; A is the result of the recombinant Pichia pastoris strain expressing the antibacterial recombinant protein (the fusion protein of the recombinant SBD2 antimicrobial peptide and the His tag) at different induction times; B is the result of the recombinant Pichia pastoris strain expressing the antibacterial recombinant protein (the fusion protein of the recombinant SBD2 antimicrobial peptide and the His tag) at different methanol induction concentrations; Lane M: protein Marker; Lane 1: empty control; Lane 2: supernatant of uninduced control; Lane 3: supernatant of 24h induced by 2% methanol concentration; Lane 4: supernatant of 48h induced by 2% methanol concentration; Lane 5: supernatant of 72h induced by 2% methanol concentration; Lane 6: supernatant of 96h induced by 2% methanol concentration; Lane 7: supernatant of 96h induced by 0.5% methanol concentration; Lane 8: supernatant of 96h induced by 1% methanol concentration; Lane 9: supernatant of 96h induced by 2% methanol concentration; Lane 10: supernatant of 96h induced by 3% methanol concentration.

[0035] Figure 5 The results of inhibition zone determination of the supernatant of recombinant Pichia pastoris after induction to express antibacterial recombinant protein (fusion protein of recombinant SBD2 antimicrobial peptide and His tag) (fermentation broth supernatant, 100 μL / well); ①: supernatant of empty control after 96 h of induction with 2% methanol concentration; ②: supernatant of uninduced control after 96 h; ③: supernatant after 48 h of induction with 2% methanol concentration; ④: supernatant after 96 h of induction with 2% methanol concentration.

[0036] Figure 6To verify the antibacterial effect of the supernatant of recombinant Pichia pastoris expressing antibacterial recombinant protein (fusion protein of recombinant SBD2 antimicrobial peptide and His tag) after in vitro acidification at 37°C and pH=1.0 (fermentation broth supernatant after 96h induction with 2% methanol concentration, 100μL / well); ①: without acidification; ②: 96h uninduced control supernatant; ③: acidification for 15min; ④: acidification for 30min; ⑤: acidification for 1h; ⑥: acidification for 2h. DETAILED DESCRIPTION

[0037] The present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. The embodiments are only used to explain the present invention, but not to limit the scope of protection of the present invention.

[0038] (I) Eukaryotic expression of sheep-derived recombinant SBD2 antimicrobial peptide in Pichia pastoris

[0039] 1 Materials and methods

[0040] 1.1 Materials

[0041] 1.1.1 Plasmids and strains

[0042] The cloning plasmid pUC57-SBD2 was synthesized by Nanjing GenScript Biotech Co., Ltd., and the expression vector pPIC9K plasmid and Pichia pastoris GS115 strain were purchased from Miaoling Bioengineering Co., Ltd.

[0043] 1.1.2 Reagents

[0044] Potassium dihydrogen phosphate, dipotassium hydrogen phosphate, methanol, glycerol, glucose, etc. were purchased from Sinopharm Chemical Reagent Co., Ltd.; lithium acetate (LiAc), dithiothreitol (DTT), biotin, geneticin, sorbitol, and YNB culture medium were purchased from Beijing Solebow Technology Co., Ltd.; mouse 6× histidine (Histidine, His) tag monoclonal antibody and horseradish peroxidase (HRP) labeled goat anti-mouse IgG monoclonal antibody were purchased from Sangon Biotechnology (Shanghai) Co., Ltd.; primers were synthesized by Qingke Biotechnology Co., Ltd.; protein marker was purchased from Beijing Quanshijin Biotechnology Co., Ltd.; yeast extract and tryptic peptone were purchased from OXOID, UK; tool enzymes EcoRⅠ, NotⅠ, and T4 DNA ligase were all purchased from Takara.

[0045] 1.1.3 Test instruments

[0046] Electronic balance ALC-1100.2, Beijing Sartorius Instrument System Co., Ltd.; clean bench YT-CJ-2ND, Beijing Yatai Cologne Instrument Technology Co., Ltd.; T100 PCR instrument and electrotransfer instrument, Bio-Rad, USA; H1650-W desktop high-speed microcentrifuge, Hunan Xiangyi Laboratory Instrument Development Co., Ltd.; 1-15K high-speed refrigerated centrifuge, Sigma, USA; DYCZ-24DN vertical electrophoresis instrument, Beijing Liuyi Instrument Factory; ThermoMultiskan MK3 microplate reader, Thermo Fisher Scientific, USA.

[0047] 1.2 Methods

[0048] 1.2.1 Construction of yeast expression strain

[0049] 1.2.1.1 Optimization of SBD2 gene and construction of recombinant SBD2 antimicrobial peptide gene cloning plasmid

[0050] According to the gene sequence information published on NCBI, the sheep β-defensin 2 (SBD2) gene was searched (see NM_001198545.1 in Table 1), and the nucleotide sequence corresponding to the protein amino acid sequence in the complete CDS of the SBD2 gene (the original gene of the recombinant SBD2 antimicrobial peptide) was connected with the nucleotide sequence corresponding to the carboxyl terminal extended peptide segment (G4S and 6×His) (GGAGGTGGTGGTTCTCATCACCATCATCATCAT), and a stop codon was added to the 3′ end of the connected sequence. Then, the nucleotide sequence corresponding to the original gene and the connected 6×His was optimized according to the codon preference of Pichia pastoris, and the EcoR I and Not I restriction enzyme recognition sites were added to both ends of the optimized gene sequence (see Table 2), and sent to Qingke Biotechnology Co., Ltd. for synthesis, and the synthetic product containing the target gene was integrated into the Escherichia coli cloning plasmid pUC57 to construct the cloning plasmid pUC57-SBD2.

[0051] Table 1. Amino acid sequence of sheep β-defensin 2 (SEQ.ID.NO.1)

[0052]

[0053] Table 2. Nucleotide sequence table (SEQ.ID.NO.2)

[0054]

[0055] 1.2.1.2 Construction of pPIC9K-SBD2 recombinant plasmid

[0056] The pPIC9K plasmid and the cloning plasmid pUC57-SBD2 were double-digested with Takara fast digestion enzymes (EcoR I and Not I). The enzyme digestion system is shown in Table 3.

[0057] Table 3. Double enzyme digestion reaction system

[0058]

[0059] Enzyme digestion conditions: 37°C water bath for 1 hour. The digestion products were detected by 1% agarose gel electrophoresis, electrophoresis conditions: 150V voltage, 15min, DL 2000 DNA Marker as reference; gel UV imaging system was used for exposure and photography.

[0060] The electrophoresis product was cut from the gel, recovered, and the DNA product was purified using a DNA purification kit. The purified product of the antibacterial recombinant protein gene and the backbone formed after enzyme digestion of the pPIC9K plasmid were connected. The connection product was transformed into Escherichia coli TOP10 competent cells, and positive strains were obtained by ampicillin resistance screening. The recombinant plasmid verified to be correct according to the following method was named pPIC9K-SBD2. The recombinant plasmid was used to obtain the antibacterial recombinant protein by induced expression after transformation of Pichia pastoris (see Table 4).

[0061] Table 4. Amino acid sequence table (SEQ.ID.NO.3)

[0062]

[0063] 1.2.1.3 Identification of recombinant plasmids

[0064] (1) Extraction of recombinant plasmid pPIC9K-SBD2

[0065] A single E. coli colony of moderate size was selected and inoculated into 5 mL of LB medium (containing 100 g / mL Amp), and cultured at 37°C and 220 r / min for 12 h. The plasmid extraction kit was used for extraction.

[0066] (2) Enzyme digestion and identification of recombinant plasmid pPIC9K-SBD2

[0067] The extracted recombinant plasmid was double-digested with EcoR I and Not I for identification, and the digestion system was referred to Table 1. Digestion conditions: incubate in a 37°C water bath for 1 hour; and the digestion product was detected by 1% agarose gel electrophoresis.

[0068] (3) Sequence analysis of recombinant plasmid pPIC9K-SBD2

[0069] The recombinant plasmid was sent to Qingke Biotechnology Co., Ltd. for sequencing, and the sequence obtained was compared with the antibacterial recombinant protein gene sequence (Table 2) using Snapgene software.

[0070] 1.2.1.4 Preparation of competent Pichia pastoris

[0071] Pick a single colony of Pichia pastoris GS115 from the YPD plate, inoculate it into 5 mL of YPD liquid culture medium, and culture it with shaking at 28°C and 250 r / min overnight until OD600 is 4-6; take 1 mL and inoculate it into 100 mL of YPD liquid culture medium, and culture it with shaking at 30°C and 250 r / min until OD600 is 0.8; collect the bacteria by centrifugation at 4000 r / min, resuspend the bacteria with 100 mL of pre-cooled LiAc-DTT sorbitol solution, let it stand for 30 min, centrifuge and discard the supernatant; add 25 mL of pre-cooled 1 M sorbitol to resuspend the bacteria, centrifuge and discard the supernatant, repeat twice; resuspend the bacteria with 1 mL of pre-cooled 1 M sorbitol, aseptically aliquot 100 μL / tube, and store at -80°C for later use.

[0072] 1.2.1.5 Electroporation transformation of Pichia pastoris

[0073] (1) The constructed recombinant plasmid pPIC9K-SBD2 was linearized with Sal I restriction endonuclease, and the linearized DNA was recovered from the gel for later use.

[0074] (2) Mix 15 μg of linearized DNA with 80 μL of fresh Pichia competent cells and transfer to a 2 mm ice-cold electroporation cuvette.

[0075] (3) Place the electroporation cuvette in an ice bath for 5 minutes.

[0076] (4) According to the data provided by the electroporator, electric shock was performed at 1.5 kV, 25 μF, and 200 Ω.

[0077] (5) After the electroporation, add 1 mL of ice-cold sorbitol solution to mix the cells and transfer them to a 1.5 mL centrifuge tube.

[0078] (6) Spread the bacterial suspension on MD plates, with 300 μL applied to one plate.

[0079] (7) Incubate the coated plates at 28°C until single colonies appear.

[0080] (8) Select the transformants that grow normally on the MD plate one by one and seed them onto a YPD plate containing G418 at a final concentration of 10 mg / mL to screen for high-copy transformants.

[0081] 1.2.1.6 PCR identification of recombinant Pichia pastoris

[0082] Pick a single colony from the YPD plate containing G418 and shake it in a test tube (YPD medium containing G418) for 2 days; take 1 mL of the bacterial solution and add it to an Eppendof tube, centrifuge it at 9000r / min at room temperature for 4 minutes, and collect the bacteria; use the yeast genome extraction kit of Solebo Company to extract genomic DNA, dissolve the extracted genomic DNA in 50μL TE (pH 8.0), and store it at -20℃ for later use. PCR identification primers and reaction systems are shown in Tables 5 and 6.

[0083] Table 5. Identification primers

[0084]

[0085] Table 6. PCR amplification reaction system

[0086]

[0087]

[0088] PCR reaction program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, and the reaction was performed for 35 cycles; then extension at 72°C for another 10 min and storage at 4°C.

[0089] Take 10 μL of the amplified product for 2% agarose gel electrophoresis and take photos with a gel imaging system. Send the positive recombinant yeast strain genes to Qingke for sequence determination. Finally, the correctly identified recombinant yeast strains are numbered and saved.

[0090] 1.2.2 Inducible expression of antibacterial recombinant proteins

[0091] (1) A single colony of a recombinant Pichia pastoris strain integrated with an antibacterial recombinant protein gene was selected and placed in a 100 mL shake flask containing 25 mL of BMGY medium and cultured at 28° C. and 250 rpm until OD600 = 2-6 (16-18 h).

[0092] (2) 1 mL of bacterial solution was transferred to 100 mL of BMGY medium and cultured until OD600 was 4-6. The cells were collected by centrifugation at 4000 r / min and then 100 mL of BMMY medium was added. The culture was continued for four days. During this period, samples were taken every 24 hours and methanol was added to the concentrations of 0%, 0.5%, 1%, 2% or 3% (0% means no induction), thereby inducing the expression of the antibacterial recombinant protein gene with different concentrations of methanol.

[0093] (3) The products expressed under different conditions (specifically, the supernatant of the fermentation broth after sterilization) were taken respectively and added into SDS-PAGE protein loading buffer for sample preparation. Western Blot analysis was performed using mouse His tag monoclonal antibody as primary antibody and HRP-labeled goat anti-mouse IgG monoclonal antibody as secondary antibody.

[0094] 2. Results and Analysis

[0095] 2.1 Identification of recombinant plasmid pPIC9K-SBD2

[0096] The constructed recombinant plasmid pPIC9K-SBD2 was identified by double enzyme digestion. The results of electrophoresis after enzyme digestion were as follows: Figure 1 As shown, combined with the plasmid sequencing results, it was shown that the recombinant plasmid was constructed correctly and the size of the band corresponding to the antibacterial recombinant protein gene was 228bp.

[0097] 2.2 G418 Screening of recombinant Pichia pastoris strains with integrated antibacterial recombinant protein genes

[0098] The high-copy recombinant Pichia yeast strains were screened by inoculating the colonies grown on the MD plate one by one onto the YPD plate containing 10 mg / mL G418. The screening results are shown in the figure. Figure 2 As shown, the results show that the high-copy recombinant Pichia pastoris strain still has good growth performance under high resistance screening pressure. Under the same culture conditions, the positive colonies gradually become larger with the increase of time.

[0099] 2.3 PCR identification of recombinant Pichia pastoris strains

[0100] Positive colonies were selected for expansion culture, and then the yeast genome was extracted and the bacterial solution was PCR identified. The identification results were as follows: Figure 3 As shown (since the antibacterial recombinant protein gene is inserted into the Pichia pastoris AOX genome, the 500 bp band corresponding to the AOX gene fragment is displayed for the empty control strain, while the recombinant Pichia pastoris strain displays a 728 bp band corresponding to the fragment containing the antibacterial recombinant protein gene).

[0101] 2.4 Detection of recombinant Pichia pastoris expression products

[0102] When the induction time and methanol concentration were optimized, the expression products were expressed in shake flasks of the positively identified recombinant yeast strains and analyzed by Western Blot. The results were as follows: Figure 4 As shown, it can be seen that the expression level of the antibacterial recombinant protein (containing the fusion-expressed recombinant SBD2 antimicrobial peptide) was the highest at 96 h and 2% methanol concentration.

[0103] (II) Antibacterial activity detection of sheep-derived recombinant SBD2 antimicrobial peptide

[0104] 1. Materials and Methods

[0105] 1.1 Materials

[0106] 1.1.1 Experimental strains

[0107] The experimental strains 170#(O111) and 200#(O8) were two pathogenic Escherichia coli isolated from the feces of diarrheal lambs (goats) and preserved in the laboratory.

[0108] 1.1.2 Reagents

[0109] The sheep-derived recombinant SBD2 antimicrobial peptide was specifically prepared by referring to the method in (I) above (ie, the His tag was not removed); other reagents were of analytical grade.

[0110] 1.1.3 Test instruments

[0111] Biological safety cabinet (Sujing Antai Company); carbon dioxide cell constant temperature incubator (Thermo Scientific, USA); small low-temperature high-speed desktop centrifuge (Eppendorf, Germany).

[0112] 1.2 Test methods

[0113] 1.2.1 In vitro antibacterial activity of the expressed product

[0114] The Oxford cup method was used, with two pathogenic Escherichia coli O8 and 0111 isolated from the feces of diarrheal lambs in the laboratory as experimental strains, and the following steps were followed:

[0115] (1) Resuscitate the frozen stocks of the above two experimental strains, streak and culture at 37°C overnight, pick a typical single colony, inoculate it into a test tube containing 3 mL LB liquid medium, and culture until OD600 = 0.4-0.6 (1OD = 3-5×10 7 The bacterial count was adjusted to about 10 8 CFU / mL, directly apply 500μL of bacterial suspension to MH medium plate. After the bacterial solution is evenly applied and completely absorbed, place the autoclaved Oxford cup on the plate and press gently. Then add 100μL of fermentation supernatant of different expression times to each well, and take the supernatant of empty fermentation broth and the supernatant of uninduced fermentation broth as controls. Place in a 37℃ incubator for 24h to observe the antibacterial effect.

[0116] 1.2.2 Using the expression product to investigate acid tolerance

[0117] (1) Acidification treatment group: 1 mL of fermentation supernatant was adjusted to pH 1.0 with hydrochloric acid; (2) Normal group: The fermentation supernatant was not acidified. The uninduced fermentation supernatant was set as a control. The fermentation supernatant of each group was placed in a 37°C incubator and incubated for 2 hours. During this period, samples were taken from the acidification group at different time points. The antibacterial test was performed using the Oxford cup method to analyze the effect of the acidic environment on the antibacterial effect of antimicrobial peptides.

[0118] 2. Results and Analysis

[0119] 2.1 In vitro antibacterial activity test results

[0120] Oxford cup antibacterial test results ( Figure 5 ) showed that the empty control group and the uninduced control group had no antibacterial effect on the two pathogenic Escherichia coli strains. However, the expression product contained sheep-derived recombinant SBD2 antimicrobial peptide, which had a good antibacterial effect on the two pathogenic Escherichia coli strains.

[0121] 2.2 In vitro validation of acid tolerance results

[0122] By using hydrochloric acid to simulate the gastric acid environment (simulating the abomasum environment of sheep), that is, adjusting the pH value of the fermentation liquid supernatant and incubating for different time periods, the antibacterial effect analysis was performed. The results are as follows: Figure 6 As shown, the results showed that the antibacterial activity of the fermentation broth supernatant did not decrease significantly with the treatment time, suggesting that the sheep-derived recombinant SBD2 antimicrobial peptide contained in the expression product has good tolerance to gastric acid, can pass through the abomasum to reach the intestine, and continue to exert antibacterial activity in the intestine.

Claims

1. An antibacterial additive, characterized in that: The additive contains the acid-resistant recombinant antimicrobial peptide shown as SEQ.ID.NO.

3.

2. A sheep feed, characterized in that: The feed contains the acid-resistant recombinant antimicrobial peptide shown as SEQ.ID.NO.

3.

3. Use of an acid-resistant recombinant antimicrobial peptide as shown in SEQ.ID.NO.3 in the preparation of an antimicrobial agent, characterized in that: The bacteria is pathogenic Escherichia coli.

Images