A QTL fragment regulating maize 100-grain weight, molecular marker and its application

Abstract

The present invention discloses a QTL fragment, a molecular marker and an application thereof for regulating corn 100-grain weight. When the Chr4_S_128905300 site of the QTL fragment exhibits a T allele variation and the Chr4_S_129728249 site exhibits a C allele variation, the corn 100-grain weight is higher, and a molecular marker and a primer thereof related to the corn 100-grain weight are developed. Therefore, the present invention provides an effective molecular assisted selection method for selecting individual plants with increased corn 100-grain weight, which can be applied to the genetic improvement of corn 100-grain weight to reduce breeding production costs; by pollinating and preserving individual plants carrying the first molecular marker and the second molecular marker and having a higher corn 100-grain weight trait, it is used for corn seed production, and has broad prospects.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a QTL fragment for regulating corn 100-grain weight, a molecular marker and an application thereof. Background Art

[0002] Corn is an important food crop, cash crop and industrial raw material, and its yield is of great significance to ensuring national economic production and people's lives. 100-grain weight is a traditional Chinese medicine factor related to corn yield. Therefore, breeding corn varieties with high 100-grain weight is of great significance to improving corn yield. As a complex quantitative trait, corn 100-grain weight is affected by most micro-effect alleles and the environment. Therefore, identifying the genetic segments related to controlling corn 100-grain weight and screening and identifying germplasm resources with high 100-grain weight through molecular-assisted selection are important ways to breed new high-yield corn varieties.

[0003] Corn 100-grain weight is a typical quantitative trait and is easily affected by environmental conditions. The selection of germplasm resources with high 100-grain weight through traditional breeding methods has problems such as long breeding cycle and low efficiency. Molecular marker-assisted selection technology has the advantages of fast breeding speed, high sensitivity, strong specificity, accuracy and reliability, and is not affected by factors such as the growth and development stage of the organism and external environmental conditions. It can accelerate the screening process of high 100-grain weight corn germplasm resources. Summary of the invention

[0004] Based on the above background, the present invention not only provides a QTL fragment that can regulate the 100-grain weight of corn, but also provides a molecular marker related to the 100-grain weight of corn. Through the application of the QTL fragment and its molecular marker, an effective and reliable molecular-assisted selection method can be provided for the genetic improvement of the 100-grain weight trait of corn and its molecular breeding.

[0005] The technical solution of the present invention is:

[0006] One of the objects of the present invention is to provide:

[0007] A QTL fragment for regulating corn 100-grain weight, wherein the QTL fragment is located at positions 128905300-129728249 on the fourth chromosome of corn; the Chr4_S_128905300 site allelic mutation of the QTL fragment is A / T; and the Chr4_S_129728249 site allelic mutation of the QTL fragment is T / C.

[0008] The second object of the present invention is to provide: an application of a QTL fragment for regulating corn 100-grain weight in genetic improvement and / or molecular breeding of corn 100-grain weight trait, wherein when the Chr4_S_128905300 locus exhibits a T allele variation and the Chr4_S_129728249 locus exhibits a C allele variation, the corn 100-grain weight is higher.

[0009] The third object of the present invention is to provide:

[0010] A molecular marker related to corn 100-grain weight, the molecular marker comprising at least one of two groups of molecular markers, the first group of molecular markers comprising a first molecular marker and a second molecular marker, and the second group of molecular markers comprising a third molecular marker and a fourth molecular marker;

[0011] The nucleotide sequences of the first molecular marker and the third molecular marker include the Chr4_S_128905300 site;

[0012] The nucleotide sequence of the first molecular marker is shown in SEQ ID NO.1;

[0013] The nucleotide sequence of the third molecular marker is shown in SEQ ID NO.3;

[0014] The nucleotide sequences of the second molecular marker and the fourth molecular marker include the Chr4_S_129728249 site;

[0015] The nucleotide sequence of the second molecular marker is shown as SEQ ID NO.2;

[0016] The nucleotide sequence of the fourth molecular marker is shown as SEQ ID NO.4.

[0017] The fourth object of the present invention is to provide:

[0018] The application of the above molecular markers in genetic improvement and / or molecular breeding of corn 100-grain weight trait.

[0019] The fifth object of the present invention is to provide:

[0020] A primer for amplifying the above-mentioned molecular marker, the primer comprising a first primer pair and a second primer pair;

[0021] The first primer pair includes primers shown in SEQ ID NO.5 and SEQ ID NO.6;

[0022] The second primer pair includes primers shown in SEQ ID N0.7 and SEQ ID N0.8.

[0023] The sixth object of the present invention is to provide:

[0024] The above-mentioned primers for amplifying molecular markers are used in detecting the right molecular markers.

[0025] The seventh object of the present invention is to provide:

[0026] The kit for detecting the above molecular markers contains primers with nucleotide sequences as shown in SEQ ID NO.5 to SEQ ID NO.8.

[0027] The seventh and eighth objects of the present invention provide:

[0028] The application of the above-mentioned primers for amplifying molecular markers in genetic improvement of corn 100-grain weight trait and / or molecular breeding.

[0029] The ninth object of the present invention is to provide:

[0030] A corn breeding method, which can use DNA from leaves of a single corn plant as a template, and use the nucleotide sequences shown in SEQ ID NO.5 to SEQ ID NO.8 as primers to perform PCR amplification to obtain an amplified product; the amplified product is sequenced and identified, and if the identification result shows that the corn carries the gene sequences shown by the first molecular marker and the second molecular marker, the corn plant is self-pollinated to obtain an inbred line with stable genetic inheritance of the target gene;

[0031] Alternatively, after DNA from leaves of individual corn plants at the seedling stage is identified, if the identification results show that the Chr4_S_128905300 locus of corn expresses T and the Chr4_S_129728249 locus expresses C allele variation, the corn plants are self-pollinated to obtain an inbred line with stable genetic inheritance of the target gene.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] The present invention provides an effective molecular assisted selection method for selecting individual plants with increased corn 100-grain weight, which can be applied to the genetic improvement of corn 100-grain weight and reduce the breeding production cost; by pollinating and preserving individual plants with higher corn 100-grain weight traits that carry the first molecular marker and the second molecular marker, or the Chr4_S_128905300 site expresses T and the Chr4_S_129728249 site expresses C allele variation, the method is used for corn seed production and has broad prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 The QTL Q of Example 1 of the present invention is KWEI1 The maize inbred lines SCML0849, Qi319 and those not carrying Q KWEI1 Comparative photos of corn kernels from the corn inbred lines ZNC442 and Lv 45. The upper row of corn in A is SCML0849, the lower row of corn is ZNC442, B is Lv 45, and C is QI 319. Among them, SCML0849 and Qi 319 are dent-shaped with higher 100-grain weights, while Lv 45 and ZNC442 are hard-grained with lower 100-grain weights.

[0035] Figure 2 is the target gene QTL Q KWEI1 The initial and fine positioning processes of the segment finally achieved a QTL segment size of 822Kb, with markers on both sides being Chr4_S_128905300 and Chr4_S_129728249 respectively. DETAILED DESCRIPTION

[0036] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with its embodiments; it should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0037] Example 1: Identification and development of QTL fragments and molecular markers of the present invention.

[0038] The inventors of the present invention used an inbred line ZNC442 with low 100-grain weight and an inbred line SCML0849 with high 100-grain weight as parents to construct a biparental segregation population as material, constructed an F2:3 population, utilized high-throughput GBS sequencing technology, and combined with linkage analysis materials to locate a genetic segment that was closely linked to the 100-grain weight variation, identified a QTL fragment related to the 128905300-129728249 (B73 V5) of chromosome 4 of corn, and found that the allelic mutation at the Chr4_S_128905300 site of the QTL fragment was A / T, and the allelic mutation at the Chr4_S_129728249 site of the QTL fragment was T / C.

[0039] The Chr4_S_128905300 site of the QTL fragment carried by SCML0849 showed a T allele variation, and at the same time, its Chr4_S_129728249 site showed a C allele variation, while the Chr4_S_128905300 site of the QTL fragment carried by ZNC442 showed an A allele variation, and at the same time, its Chr4_S_129728249 site showed a T allele variation. Therefore, it is obvious that this QTL fragment is significantly correlated with the high and low 100-grain weight of corn;

[0040] The QTL fragment when Chr4_S_128905300 locus shows T allele variation and Chr4_S_129728249 locus shows C allele variation is named QTL Q KWEI1 .

[0041] The QTL Q was verified by other maize inbred lines. KWEI1 When QTL Q KWEI1 When it is not present, the 100-grain weight is lower (as shown in Table 1):

[0042]

[0043] The results in the table above show that the QTL Q KWEI1 The 100-grain weight of the inbred lines QI319, SCML0849, and QB1148 was higher than that of the lines not carrying QTL Q KWEI1 The inbred lines in the section are Brigade 45, ZNC442, and QB1064.

[0044] The present invention has developed a molecular marker related to the 100-grain weight of corn, wherein the molecular marker is one of at least two groups of molecular markers, wherein the first group of molecular markers includes a first molecular marker and a second molecular marker, and the second group of molecular markers includes a third molecular marker and a fourth molecular marker;

[0045] The nucleotide sequences of the first molecular marker and the third molecular marker include the Chr4_S_128905300 site; the nucleotide sequences of the second molecular marker and the fourth molecular marker include the Chr4_S_129728249 site;

[0046] The nucleotide sequence of the first molecular marker is shown in SEQ ID NO.1;

[0047] The nucleotide sequence of SEQ ID NO.1 is as follows:

[0048] GGTTTCTATGTTCCTTAGTAGAACGAACTATTATGCAATAGAATTAGCTTGACTATCAAACAAATGAAGTGTTTGTTCATTGTATTTGTGTTATGTAGTTTTCACATATATTTTGAAAGTTTTTTCTTCCTTATTTGCACATATATTTGTGGTTCTCGTTATTAAATAAACCCTATATTATTTTTTACAGCTAATGGCTAT CCACGAAGCACAGAAGAATATTTTAACTTGTGCCATGCTAGAGCTAGAAATATTATTGAGAGAGCCTTTGGAAGGCTAAAGGGTCGCTGGGCTATTTTAAGGTCTCCGTCATTTTTTCCGGTCATCGCGTGGAAGAGGAAAAAGTAAAAGGGTGTGGACTTATTTTGAGGATGAAGCATTGGTGAAGGCACTCTATGAGC;

[0049] The nucleotide sequence of the second molecular marker is shown as SEQ ID NO.2;

[0050] The nucleotide sequence of SEQ ID NO.2 is as follows:

[0051] CCGAAGCTCAAGCCTCTATATTCAAAAGCTATTTCGAAAAACCAAAATCCCTTGGACACTCTGTGTCTGACTATTGTTAGGATTGAGAAACTGAGTGTTCCTGTTGAAAAACAGTTGAGCTTTTTCAGCTGAGTTGAACTTCAGTTGAGTTGAGCTTCTTCAGCTGAGTTTAACTTCAGCTACAGTTGAGCTTTGTCAGGC TAGTTGAACTTCAGCTGAGTTGAACTTCAACTTCAACTGTGAACCTCTTTGACCATACACTAATTGAACTTGCCTTTGGGCCAGTTGAACTAGGGTTTTTCTCCTAGACTTTCTGGTCAAGACCAGTTGAACTAGTCCCTAGGGGCGGTTCAACTGGTCTCTGACCCCTCTAGCTAGACTGCATAGCAGTCTGCCAGTC;

[0052] The nucleotide sequence of the third molecular marker is shown in SEQ ID NO.3;

[0053] The nucleotide sequence of SEQ ID NO.3 is as follows:

[0054] GGTTTCTATGTTCCTTAGTAGAACGAACTATTATGCAATAGAATTAGCTTGACTATCAAACAAATGAAGTGTTTGTTCATTGTATTTGTGTTATGTAGTTTTCACATATATTTTGAAAGTTTTTTCTTCCTTATTTGCACATATATTTGTGGTTCTCGTTATTAAATAAACCCTATATTATTTTTTACAGCTAATGGCTAA CCACGAAGCACAGAAGAATATTTTAACTTGTGCCATGCTAGAGCTAGAAATATTATTGAGAGAGCCTTTGGAAGGCTAAAGGGTCGCTGGGCTATTTTAAGGTCTCCGTCATTTTTTCCGGTCATCGCGTGGAAGAGGAAAAAGTAAAAGGGTGTGGACTTATTTTGAGGATGAAGCATTGGTGAAGGCACTCTATGAGC;

[0055] The nucleotide sequence of the fourth molecular marker is shown in SEQ ID NO.4;

[0056] The nucleotide sequence of SEQ ID NO.4 is as follows:

[0057] CCGAAGCTCAAGCCTCTATATTCAAAAGCTATTTCGAAAAACCAAAATCCCTTGGACACTCTGTGTCTGACTATTGTTAGGATTGAGAAACTGAGTGTTCCTGTTGAAAAACAGTTGAGCTTTTTCAGCTGAGTTGAACTTCAGTTGAGTTGAGCTTCTTCAGCTGAGTTTAACTTCAGCTACAGTTGAGCTTTGTCAGGT TAGTTGAACTTCAGCTGAGTTGAACTTCAACTTCAACTGTGAACCTCTTTGACCATACACTAATTGAACTTGCCTTTGGGCCAGTTGAACTAGGGTTTTTCTCCTAGACTTTCTGGTCAAGACCAGTTGAACTAGTCCCTAGGGGCGGTTCAACTGGTCTCTGACCCCTCTAGCTAGACTGCATAGCAGTCTGCCAGTC;

[0058] Therefore, the molecular markers of the present application may include only the first group of molecular markers, only the second group of molecular markers, or both the first group of molecular markers and the second group of molecular markers.

[0059] And developing amplification primers for amplifying the molecular markers for the above-mentioned molecular markers, the primers comprising a first primer pair and a second primer pair; wherein the first primer amplifies the first molecular marker and the third molecular marker, and the second primer pair amplifies the second molecular marker and the fourth molecular marker;

[0060] The first primer pair includes primers shown in SEQ ID NO.5 and SEQ ID NO.6;

[0061] Wherein SEQ ID NO: 5 is the left primer F: AGTTTTTTCTTCCTTATTTGCACAT;

[0062] SEQ ID NO: 6 is the right primer R: GTGCCTTCACCAATGCTTCA

[0063] The second primer pair includes primers shown in SEQ ID N0.7 and SEQ ID N0.8.

[0064] Wherein SEQ ID NO: 7 is the left primer F: CAAAATCCCTTGGACACTCT;

[0065] SEQ ID NO: 8 is the right primer R: GACCAGTTGAACCGCCCCTA;

[0066] Example 2: In this example, maize inbred lines Qi 319 and Lu 45 were used as materials to verify the QTL fragments. See Table 1. Through screening and identification, Lu 45 did not carry the target QTL QTL of Example 1. KWEI1 , which is manifested by lower 100-grain weight; Qi 319 carries the target QTL Q KWEI1 The Chr4_S_128905300 locus of Qi 319 showed a T allele variation, and the Chr4_S_129728249 locus showed a C allele variation.

[0067] Example 3: The reference parameters for the process of amplifying molecular markers using the primers for amplifying molecular markers of the present invention are:

[0068] 1) DNA extraction: Tiangen Company's new plant genomic DNA extraction kit (centrifugal column type), DNA concentration was measured and then diluted to 15ug / ml;

[0069] 2) 20ul reaction system

[0070] Table 2:

[0071]

[0072] 3) PCR amplification procedure

[0073] Table 3:

[0074]

[0075] Electrophoresis: 1% agarose gel; 1×TAE buffer; voltage 120V, current 150mA, electrophoresis for 20 minutes.

[0076] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of primers for detecting molecular markers in genetic improvement and / or molecular breeding of maize 100-grain weight trait, characterized in that: The molecular markers include a first molecular marker and a second molecular marker, The nucleotide sequence of the first molecular marker is shown in SEQ ID NO.1; The nucleotide sequence of the second molecular marker is shown as SEQ ID NO.2; The primers include a first primer pair and a second primer pair; The first primer pair includes primers shown in SEQ ID NO.5 and SEQ ID NO.6; The second primer pair includes primers shown in SEQ ID N0.7 and SEQ ID N0.8; When the primers are used to detect that corn carries both the first molecular marker and the second molecular marker, the 100-grain weight of the corn is high.

2. A corn breeding method, characterized in that: The method uses DNA from leaves of a single corn plant as a template, performs PCR amplification using a first primer pair and a second primer pair, and obtains an amplified product; the amplified product is sequenced and identified, and if the identification result shows that the corn carries the gene sequence indicated by the first molecular marker and the second molecular marker, the corn plant is self-pollinated to obtain an inbred line with stable genetic inheritance of the target gene; The first primer pair includes primers shown in SEQ ID NO.5 and SEQ ID NO.6; The second primer pair includes primers shown in SEQ ID NO.7 and SEQ ID NO.8; The nucleotide sequence of the first molecular marker is shown in SEQ ID NO.1; The nucleotide sequence of the second molecular marker is shown as SEQ ID NO.2.

Images