Electrochemical redox-coupled power-generating artificial wetland system, application and use method

Abstract

The present application relates to the technical field of water treatment, and in particular to an electrochemical redox-coupled power-generating artificial wetland system, application and use method, wherein the electrochemical redox-coupled power-generating artificial wetland system includes an electrochemical redox cell, the electrochemical redox cell includes a first anode and a first cathode; a power-generating artificial wetland, the power-generating artificial wetland is connected to the electrochemical redox cell, the power-generating artificial wetland includes a second anode and a second cathode, the second anode is connected to the first cathode, and the second cathode is connected to the first anode. The electrochemical redox cell serves as a pretreatment section to prevent antibiotic prototypes and heavy metal ions from entering the power-generating artificial wetland at the same time, and the electrochemical redox cell is used to decouple heavy metal-antibiotic complex pollution, reduce the synergistic selection pressure of heavy metal-antibiotic complex pollution on the microbial flora in the power-generating artificial wetland, and effectively inhibit the production of resistance genes inside the power-generating artificial wetland.

Description

Technical Field

[0001] The present application relates to the technical field of water pollution control and water treatment, and in particular to an electrochemical redox-coupled power-generating artificial wetland system, and its application and use method. Background Art

[0002] Antibiotic Resistance Genes (ARGs) have the characteristics of horizontal transfer and difficulty in biodegradation. They will spread in media such as soil and water, and even spread along the food chain, posing a great threat to the ecological environment and human health. The probability of antibiotic-heavy metal complex pollution in the water and soil environment is high, and the selection pressure of heavy metals will further lead to an increase in the abundance of ARGs. Therefore, in order to inhibit the proliferation of ARGs, we must not only pay attention to the concentration of the antibiotic substance itself in the environmental medium, but also significantly reduce the level of coexistence of heavy metals and antibiotics in the same environmental medium.

[0003] Traditional artificial wetlands are low-cost ecological wastewater treatment processes widely used in industries such as aquaculture and livestock and poultry farming. A large number of studies have shown that power-generating artificial wetlands (CW-MFCs) can generate electricity while achieving efficient pollutant treatment, and have certain advantages over ordinary wetlands in removing antibiotics and controlling ARGs. However, there is still a certain amount of ARGs in the matrix and effluent of power-generating artificial wetlands, which fails to overcome the inherent contradiction that microorganisms have to be continuously exposed to antibiotic-heavy metal combined pollution, resulting in excessive proliferation of ARGs inside the wetland, and even an increased risk of transmission to the external environment.

[0004] Therefore, we proposed an electrochemical redox coupled power generation artificial wetland system and its application to solve the above problems. Summary of the invention

[0005] The purpose of this application is to solve the shortcomings existing in the above-mentioned background technology and propose an invention name.

[0006] In a first aspect, the present application discloses an electrochemical redox-coupled power-generating artificial wetland system, comprising:

[0007] An electrochemical redox cell, the electrochemical redox cell comprising a first anode and a first cathode;

[0008] The power-generating artificial wetland is connected to the electrochemical redox tank. The power-generating artificial wetland includes a second anode and a second cathode. The second anode is connected to the first cathode, and the second cathode is connected to the first anode.

[0009] By adopting the above-mentioned technical scheme, the technical scheme of the present application preferably combines an electrochemical redox tank with an electricity-generating artificial wetland. Surface water containing antibiotics and metals is treated by an electrochemical redox oxidation tank. The antibiotics in the surface water are oxidized by the first anode and the heavy metals in the surface water are reduced by the first cathode. The heavy metals and antibiotics in the surface water can be effectively removed, thereby effectively preventing the antibiotic prototype and heavy metal ions from entering the electricity-generating artificial wetland at the same time. This may achieve a preliminary decoupling of the combined pollution of antibiotics and heavy metal ions, thereby reducing the synergistic selection pressure on the microbial flora in the electricity-generating artificial wetland.

[0010] The second anode in the power-generating artificial wetland is an anaerobic biofilter, and the second cathode is a wetland-type biocathode. The microorganisms in the power-generating artificial wetland decompose organic matter to produce electrons, forming an electric potential and a coupling system in the artificial wetland, which can achieve secondary degradation of the initially decoupled surface water and remove impurities such as metals and antibiotics in the surface water by oxidation-reduction.

[0011] Electrochemical microorganisms in the power-generating artificial wetland can metabolize and convert the chemical energy of organic matter in sewage into electrical energy. However, the power generation of the power-generating artificial wetland is low, and it can only output low-voltage current, and the utilization of electrical energy is limited. However, due to the connection between the first anode and the second cathode, and the first cathode and the second anode, the electrical energy generated in the power-generating artificial wetland can be transmitted to the electrochemical redox pool, so that the energy levels of the above two electricity production and use are matched, ensuring that the electrochemical redox pool 1 exerts its barrier effect, and forming a coupled wetland system with mutual feedback of matter and energy.

[0012] Electrochemical redox cells use electron movement to replace the addition of chemical oxidants or reductants, with little or no secondary pollution; the reaction conditions are mild, can be carried out at room temperature and pressure, and have high energy efficiency. Electrochemical redox technology has shown good results in treating heavy metals or antibiotics, respectively. At the same time, under low-pressure conditions, electrocatalytic conversion has a series of advantages such as high current efficiency, low power consumption, and less oxygen evolution side reactions.

[0013] Optionally, the distance between the first anode and the first cathode is 10 mm-20 mm, the first anode is made of a nickel-iron alloy material, and the first cathode is made of a nickel-iron alloy material.

[0014] Optionally, the second anode and the second cathode both include:

[0015] First fixed net;

[0016] A second fixed net, the distance between the second anode and the second cathode is 5cm-10cm, the second fixed net is connected to the first fixed net, and the second fixed net and the first fixed net cooperate to enclose a containing cavity;

[0017] The graphite carbon felt is arranged in the accommodating cavity and is respectively in contact with the first fixed net and the second fixed net.

[0018] By adopting the above technical solution, graphite carbon felt can be used as the main carrier of microorganisms to enrich microorganisms, so that the microorganisms can be oxidized and reduced at the second anode and the second cathode to generate electrons. The first fixed net and the second fixed net can enhance the ability of the second anode or the second cathode to collect electrons. The cooperation of graphite carbon felt with the first fixed net and the second fixed net can stably enhance the efficiency of electron collection and transfer of the second anode and the second cathode. Graphite carbon felt, the first fixed net and the second fixed net are all cheap and easy to obtain, and have a better economic cost advantage.

[0019] Optionally, the power-generating artificial wetland includes a supporting layer, an anode layer, an intermediate layer, a cathode layer and a plant layer arranged in sequence from bottom to top, the supporting layer is composed of gravel with a particle size of 6mm-8mm, the anode layer is composed of activated carbon with a particle size of 1mm-2mm, the intermediate layer is composed of gravel with a particle size of 8mm-10mm, the cathode layer is composed of activated carbon with a particle size of 1mm-2mm, and the plant layer is composed of aquatic plants.

[0020] By adopting the above technical solution, the plant layer is connected to the cathode layer, and the oxygen secretion of the roots of the aquatic plants can increase the amount of electron acceptors in the cathode layer, thereby improving the power generation performance of the power-generating artificial wetland. The roots of wetland plants will also affect the population structure of microorganisms around the roots due to their own metabolism, thereby indirectly affecting the denitrification performance of the coupling system. Therefore, the increase in aquatic plants effectively improves the power generation effect and pollutant removal effect of the power-generating artificial wetland.

[0021] Optionally, the aquatic plants are selected from one or both of Houttuynia cordata and mint, and the aquatic plants further include one or both of water hyacinth and canna.

[0022] By adopting the above technical solution, in the technical solution of the present application, Houttuynia cordata or mint is preferably planted in the plant layer. Both Houttuynia cordata and mint are rich in polyphenols or anthraquinones. Therefore, the root secretions of Houttuynia cordata or mint contain polyphenols or anthraquinones with electron mediating functions, which can effectively improve the electron transfer efficiency in the cathode layer, promote the generation of bioelectricity and the removal of antibiotics. Planting water hyacinth or canna indica in the plant layer can increase the richness and diversity of the plant layer, and promote the power generation effect and pollutant removal effect of the power-generating artificial wetland.

[0023] Optionally, it also includes a water distribution pool, which is arranged between the electrochemical redox pool and the power-generating artificial wetland;

[0024] The electrochemical redox tank is provided with a first water inlet and a first water outlet, the first water inlet and the first water outlet are arranged on opposite sides of the electrochemical redox tank, in a first direction, the first water inlet is located below the first water outlet, and the first water outlet is connected to the water distribution tank;

[0025] The power-generating artificial wetland is provided with a second water inlet and a second water outlet. The second water inlet and the second water outlet are arranged on opposite sides of the power-generating artificial wetland. In the first direction, the second water inlet is located below the second water outlet. The second water inlet is located below the first water outlet. The second water inlet is connected to the water distribution pool.

[0026] In a second aspect, the present application discloses an application of an electrochemical redox-coupled power-generating artificial wetland system, characterized in that the electrochemical redox-coupled power-generating artificial wetland system is used to control the spread of antibiotic resistance genes in water.

[0027] By adopting the above technical scheme, an electrochemical redox pool is introduced into the process of reducing heavy metal-antibiotic composite pollution in traditional artificial wetlands, firstly, the decoupling of heavy metal-antibiotic composite pollution is achieved, the stress of heavy metals is reduced, and at the same time, the antibiotic molecules are converted into small molecule intermediates that are easily biodegradable. Then, the pollutants are further removed by using the power-generating artificial wetlands. At the same time, the electricity generated by the power-generating artificial wetlands is used to power the electrochemical redox pool, so as to effectively control the spread of ARGs and match the power generation and consumption levels.

[0028] In a third aspect, the present application discloses a method for using an electrochemical redox-coupled power-generating artificial wetland system, which uses the electrochemical redox-coupled power-generating artificial wetland system, comprising the following steps:

[0029] S1. Water pretreatment: Surface water containing antibiotics and heavy metals is taken as water to be treated, and the water to be treated is transported from the first water inlet to the electrochemical oxidation-reduction tank for preliminary degradation to obtain pretreated water;

[0030] S2. Secondary degradation: The pretreated water is transported to the water distribution pool through the first outlet, and then transported to the power-generating artificial wetland through the second inlet, flowing through the anode layer, the middle layer and the cathode layer in turn to complete secondary degradation and power generation.

[0031] By adopting the above technical solution, the electrochemical redox cell is used as a pretreatment device, the antibiotics in the surface water are oxidized by the first anode, and the heavy metals in the surface water are reduced by the first cathode, which effectively prevents the antibiotic prototype and heavy metal ions from entering the power-generating artificial wetland at the same time, and can achieve the initial decoupling of antibiotic-heavy metal complex pollution, reduce the stress of heavy metals, reduce the toxicity in surface water, and at the same time convert antibiotic molecules into biodegradable small molecule intermediates, which is conducive to further removal of pollutants by the power-generating artificial wetland. Due to the connected first anode and second cathode, first cathode and second anode, the electric energy generated by the power-generating artificial wetland can be provided to the electrochemical redox cell, forming an energy-self-sustaining system, which solves the problem that the electric energy recovered by the power-generating artificial wetland cannot be used.

[0032] Optionally, the residence time of the water to be treated in the electrochemical redox tank is 35-45 hours, and the residence time of the pretreated water in the power-generating artificial wetland is 70-75 hours.

[0033] By adopting the above technical solutions, the residence time of surface water in the electrochemical redox tank and the power-generating artificial wetland is optimized. The surface water degrades organic pollutants at the anode of the electrochemical redox tank, but does not pursue the complete mineralization of organic molecules, converts antibiotic molecules into small molecule intermediates that are easily biodegradable, and reduces the toxicity of wastewater, which is more conducive to microbial degradation. The cathode reduction of the electrochemical redox tank removes heavy metals, effectively eliminating the synergistic selection pressure of antibiotics and heavy metals.

[0034] In summary, this application has the following technical effects:

[0035] 1. The electrochemical redox tank is used as a pretreatment section to effectively prevent antibiotic prototypes and heavy metal ions from entering the power-generating artificial wetland at the same time. The electrochemical redox tank is used to decouple the heavy metal-antibiotic combined pollution, reduce the synergistic selection pressure of the heavy metal-antibiotic combined pollution on the microbial flora in the power-generating artificial wetland, and effectively inhibit the production of resistance genes inside the power-generating artificial wetland.

[0036] 2. The power-generating artificial wetland further degrades the antibiotic prototypes and their intermediates, and other general oxygen-consuming organic pollutants in the surface water discharged from the electrochemical redox pool, thereby achieving simultaneous wastewater treatment and power generation.

[0037] 3. The electricity generated by the power-generating artificial wetland is used to power the electrochemical redox pool. The power generation and use levels of the two are matched, and the energy is self-sufficient. While realizing the in-situ utilization of low-voltage electricity in the power-generating artificial wetland, it ensures that the electrochemical redox pool can exert its barrier effect.

[0038] 4. This application uses Chinese medicinal plants rich in polyphenols or anthraquinones, such as Houttuynia cordata and mint. Their secretions contain anthraquinone / polyphenol substances with electron mediating functions, which further improve the efficiency of electron transfer, thereby promoting the generation of bioelectricity and the effective removal of antibiotics.

[0039] 5. This application maintains the ecological characteristics of a wetland-based technical system, with simple operation and low operating costs. It fundamentally overcomes the inherent contradiction of traditional artificial wetlands in controlling such complex pollution, that is, when microorganisms have to be continuously exposed to antibiotic-heavy metal complex pollution, resulting in excessive proliferation of ARGs inside the wetland and even transmission to the external environment. It has high potential for application in the treatment of wastewater contaminated by heavy metals and antibiotics. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 It is a structural schematic diagram of an electrochemical redox-coupled power-generating artificial wetland system.

[0041] Figure 2 Schematic diagram of the structure of the second anode and the second cathode.

[0042] Description of reference numerals:

[0043] 1. Electrochemical redox cell; 11. First anode; 12. First cathode; 13. First water inlet; 14. First water outlet; 2. Power-generating artificial wetland; 21. Second anode; 22. Second cathode; 23. Second water inlet; 24. Second water outlet; 25. Filling layer; 26. Plant layer; 3. Water distribution pool; 4. Conductor; 5. First fixed net; 6. Second fixed net; 7. Graphite carbon felt. DETAILED DESCRIPTION

[0044] The present application is further described below in conjunction with specific embodiments.

[0045] Example

[0046] Embodiment 1:

[0047] In a first aspect, the present application provides an electrochemical redox-coupled power-generating artificial wetland system, which is mainly composed of an electrochemical redox tank 1 and a power-generating artificial wetland 2.

[0048] Reference Figure 1 Specifically, the electrochemical redox tank 1 includes a first anode 11 and a first cathode 12, and the power-generating artificial wetland 2 is connected to the electrochemical redox tank 1. The power-generating artificial wetland 2 includes a second anode 21 and a second cathode 22. The second anode 21 is connected to the first cathode 12, and the second cathode 22 is connected to the first anode 11.

[0049] In other words, the electrochemical redox tank 1 has a first anode 11 and a first cathode 12. The power-generating artificial wetland 2 is connected to the electrochemical redox tank 1. Specifically, the power-generating artificial wetland 2 is connected to the electrochemical redox tank 1 through a wire 4, which can be a copper wire 4 or a titanium wire 4. The power-generating artificial wetland 2 has a second anode 21 and a second cathode 22, the second anode 21 and the first cathode 12 are connected through a wire 4, and the second cathode 22 and the first anode 11 are connected through a wire 4, which can be a copper wire 4 or a titanium wire 4.

[0050] Reference Figure 1 The distance between the first anode 11 and the first cathode 12 is 10 mm-20 mm. Optionally, the distance between the first anode 11 and the first cathode 12 can be 10 mm, 15 mm, or 20 mm. Specifically, in this embodiment, the distance between the first anode 11 and the first cathode 12 is 15 mm.

[0051] Reference Figure 1 The first anode 11 and the first cathode 12 are both made of nickel-iron alloy, and the nickel-iron alloy is a composite material Ni-Fe-B composed of nickel-iron alloy and boron prepared at a high temperature of 400°C. The size of the first anode 11 and the first cathode 12 is 30mm×30mm. Ni-Fe-B material has good conductivity and rich active centers, it has a large specific capacitance and strong electron transfer ability, and excellent electrochemical performance, so the electrochemical redox cell 1 can fully decouple and decompose heavy metals and antibiotics in surface water.

[0052] Reference Figure 1 The main body of the power-generating artificial wetland 2 is an acrylic cylinder with a height of 38 cm and a diameter of 10 cm, and a total volume of 3L. The power-generating artificial wetland 2 includes a supporting layer, an anode layer, an intermediate layer, a cathode layer and a plant layer arranged in sequence from bottom to top. The supporting layer, the anode layer, the intermediate layer and the cathode layer constitute a packing layer 25, and the packing layer 25 occupies an effective volume of 0.96L. The supporting layer is 18 cm high and is filled with gravel with a particle size of 6-8 mm. The anode layer is 10 cm high and is filled with 1-2 mm activated carbon particles. The intermediate layer is 7 cm high and is filled with 8-10 mm gravel. The cathode layer is 3 mm high and is filled with 1-2 mm activated carbon particles.

[0053] Reference Figure 2The second cathode 22 and the second anode 21 in the power-generating artificial wetland 2 are both composed of a first fixed net 5, a second fixed net 6 and a graphite carbon felt 7. The first fixed net 5 and the second fixed net 6 enclose a receiving cavity, and the graphite carbon felt 7 is located in the receiving cavity. The first fixed net 5 and the second fixed net 6 clamp the graphite carbon felt 7. The first fixed net 5 and the second fixed net 6 are both 12-mesh 304 stainless steel wire meshes, and the graphite carbon felt 7 is 3mm hydrophilic graphite carbon felt. The graphite carbon felt 7 serves as the main attachment carrier of microorganisms, and the stainless steel wire mesh enhances the ability to collect and transfer electrons. Both are cheap and easy to obtain, and have economic cost advantages.

[0054] Inoculating anaerobic sludge in the anode layer and acclimatizing the power-producing microorganisms are beneficial to the subsequent power generation in the power-producing artificial wetland 2.

[0055] Reference Figure 1 , aquatic plants are planted in the plant layer 26, the aquatic plants include one or both of houttuynia cordata or mint, and the aquatic plants also include one or both of water hyacinth or canna. That is to say, the aquatic plants may include houttuynia cordata and water hyacinth, and may also include mint and canna, or may include houttuynia cordata, mint, water hyacinth and canna. Houttuynia cordata or mint are planted in the plant layer 26, and both houttuynia cordata and mint are rich in polyphenols or anthraquinones, so the root secretions of houttuynia cordata or mint contain polyphenols or anthraquinones with electron mediating functions, which can effectively improve the electron transfer efficiency in the cathode layer, promote the generation of bioelectricity and the removal of antibiotics.

[0056] Reference Figure 1 , the first direction is Figure 1 The vertical direction shown in . The electrochemical redox-coupled power-generating artificial wetland system also includes a water distribution pool 3. A first water inlet 13 and a first water outlet 14 are provided on the wall of the electrochemical redox pool 1. The first water inlet 13 is located on the left side of the bottom of the pool wall of the electrochemical redox pool 1, and the first water outlet 14 is located on the right side of the top of the pool wall of the electrochemical redox pool 1. The first water outlet 14 is connected to the uniform water distribution pool 3 of the power-generating artificial wetland 2. The uniform water distribution pool 3 is composed of gravel and / or crushed stone filter material with a particle size of 15-25 mm. The power-generating artificial wetland 2 has a second water inlet 23 and a second water outlet 24. The second water inlet 23 is located on the left side of the bottom of the power-generating artificial wetland 2, and the second water outlet 24 is located on the right side of the top of the power-generating artificial wetland 2. The uniform water distribution pool 3 is connected to the first water outlet 14 and the second water inlet 23. The effluent of the electrochemical redox pool 1 can enter the power-generating artificial wetland 2 evenly.

[0057] In summary, the first anode 11 and the first cathode 12 in the electrochemical redox tank 1 are respectively connected to the second anode 21 and the second cathode 22 of the power-generating artificial wetland 2 through the wire 4, and the power-generating artificial wetland 2 supplies power to the electrochemical redox tank 1 placed in front of the space, forming an energy-self-sustaining system. The electrochemical microorganisms in the power-generating artificial wetland 2 metabolize and can convert the chemical energy of organic matter in the sewage into electrical energy. In this embodiment, the electrical energy generated by the power-generating artificial wetland 2 is transmitted to the electrochemical redox tank 1 through the electrodes, and the energy levels of the electricity generated and used by the two are matched, ensuring that the electrochemical redox tank 1 exerts its barrier effect and forming a coupled wetland system in which matter and energy are fed back.

[0058] In a second aspect, the present application also provides an application of an electrochemical redox-coupled power-generating artificial wetland system, which is used to control the spread of antibiotic resistance genes in water.

[0059] In a third aspect, the present application also provides a method for using an electrochemical redox-coupled power-generating artificial wetland system, which uses the above-mentioned electrochemical redox-coupled power-generating artificial wetland system, comprising the following steps:

[0060] S1, water pretreatment: Take antibiotic-heavy metal surface water containing 5 mg / L SMT and 20 mg / L Cu2+ as the water to be treated, and transport the water to be treated from the first water inlet 13 to the electrochemical redox tank 1 at a flow rate of 12.5 mL / min for preliminary degradation, and stay for 40 hours to obtain pretreated water;

[0061] S2. Secondary degradation: The pretreated water is transported to the water distribution pool 3 through the first water outlet 14, and then transported to the power-generating artificial wetland 2 through the second water inlet 23, and flows through the anode layer, the middle layer and the cathode layer from bottom to top, completing secondary degradation and power generation under the combined action of wetland fillers, microorganisms, plants and electrochemistry, and staying for 72 hours.

[0062] In this embodiment, the electrochemical redox pool 1 is used to perform preliminary degradation of surface water, the cathode reduction removes heavy metals, the anode destroys the molecular structure of antibiotics, decouples the heavy metal-antibiotic composite pollution, and reduces the synergistic selection pressure on the microbial flora in the wetland. The pretreated water is transported to the power-generating artificial wetland 2, which performs secondary degradation and electricity generation, and feeds back the generated electricity to the electrochemical redox pool 1. The power generation and use energy levels of the two are matched, forming a mutual feedback effect.

[0063] Comparative Example

[0064] Comparative Example 1

[0065] The difference from Example 1 is that the electrochemical redox-coupled power-generating artificial wetland system is replaced by a power-generating artificial wetland system to perform surface water treatment.

[0066] Performance Test:

[0067] ARGs quantitative detection:

[0068] 1. Collect the effluent in Example 1 and Comparative Example 1. The collection process is as follows: first, the liquid in the reactor is rotated evenly, the collection volume is 30 mL, and suction filtration is performed under a filter membrane of 0.22 microns to obtain a separated body;

[0069] 2. Extract DNA. The DNA concentration under A260 / 280 conditions was 1.65-1.8. Then the fluorescence quantitative qPCR method was used to detect the amplification curve of ARGs in water. The primers corresponded to the 16S V3-V4 region. The upstream primer 338F was ACTCCTACGGGAGGCAGCAG, and the downstream primer 806R was GGACTACHVGGGTWTCTAAT.

[0070] 3. First, measure the plasmid DNA concentration of the ARGs standard, then dilute to -1 gradient (i.e., 0.7 ng / uL), then take 10 μL of the -1 gradient sample and add it to 90 μL of ddH2O to obtain a -2 gradient (i.e., 0.07 ng / uL) dilution sample. Follow this method until the dilution reaches -6 gradient, and use quantitative qPCR to detect the samples of each dilution gradient to obtain the ARGs standard curve;

[0071] 4. Substitute the fold value of the ARGs amplification curve obtained in step 3 into the ARGs standard curve to obtain the absolute content of ARGs.

[0072] System voltage test:

[0073] Insert a saturated calomel electrode into the power-generating artificial wetland, let the water surface cover the calomel electrode probe, and use a multimeter to measure the potential between the cathode and anode. In theory, the potential difference between the cathode and anode is equal to the voltage across the battery.

[0074] After testing, the resistance gene abundance of sul1 in comparative example 1 is 15 times that of sul1 in example 1, and the resistance gene abundance of sul2 in comparative example 1 is 22.8 times that of sul2 in example 1. At the same time, the system voltage in example 1 is 2.2 times that of the system voltage in comparative example 1.

[0075] In summary, the use of electrochemical redox coupled power-generating artificial wetland system to treat surface water containing heavy metals and antibiotics can effectively remove heavy metals and antibiotics in surface water, reduce the abundance and proliferation of ARGs, and at the same time increase the system voltage of the power-generating artificial wetland, making the voltage output more stable.

[0076] The above are only preferred specific implementation methods of the present application, but the protection scope of the present application is not limited thereto. Any technician familiar with the technical field can make equivalent substitutions or changes within the technical scope disclosed in the present application according to the technical solution and inventive concept of the present application, which should be covered by the protection scope of the present application.

Claims

1. A method for using an electrochemical redox-coupled power-generating artificial wetland system, characterized in that: An electrochemical redox-coupled power-generating artificial wetland system is used, and the electrochemical redox-coupled power-generating artificial wetland system comprises: An electrochemical redox cell (1), the electrochemical redox cell (1) comprising a first anode (11) and a first cathode (12); An electricity-generating artificial wetland (2), the electricity-generating artificial wetland (2) being connected to an electrochemical redox tank (1), the electricity-generating artificial wetland (2) comprising a second anode (21) and a second cathode (22), the second anode (21) being connected to the first cathode (12), and the second cathode (22) being connected to the first anode (11); The power-generating artificial wetland (2) comprises a supporting layer, an anode layer, an intermediate layer, a cathode layer and a plant layer (26) arranged in sequence from bottom to top, wherein the supporting layer is composed of gravel with a particle size of 6 mm to 8 mm, the anode layer is composed of activated carbon with a particle size of 1 mm to 2 mm, the intermediate layer is composed of gravel with a particle size of 8 mm to 10 mm, the cathode layer is composed of activated carbon with a particle size of 1 mm to 2 mm, and the plant layer (26) is composed of aquatic plants; The aquatic plants are selected from one or both of Houttuynia cordata and mint, and the aquatic plants further include one or both of water hyacinth or canna; The method of use comprises the following steps: S1, water pretreatment: taking surface water containing antibiotics and heavy metals as water to be treated, and conveying the water to be treated from the first water inlet (13) to the electrochemical oxidation-reduction cell (1) for preliminary degradation, wherein the antibiotics in the surface water are oxidized by the first anode and the heavy metals in the surface water are reduced by the first cathode, thereby achieving preliminary decoupling of the antibiotic-heavy metal complex pollution and obtaining pretreated water; S2, secondary degradation: The pretreated water is transported to the water distribution pool (3) via the first water outlet (14), and then transported to the power-generating artificial wetland (2) via the second water inlet (23), and flows through the anode layer, the middle layer and the cathode layer in sequence, completing secondary degradation and power generation.

2. The method for using the electrochemical redox-coupled power-generating artificial wetland system according to claim 1, characterized in that: The distance between the first anode (11) and the first cathode (12) is 10 mm-20 mm, the first anode (11) is made of a nickel-iron alloy material, and the first cathode (12) is made of a nickel-iron alloy material.

3. The method for using the electrochemical redox-coupled power-generating artificial wetland system according to claim 1, characterized in that: The distance between the second anode (21) and the second cathode (22) is 5 cm-10 cm, and the second anode (21) and the second cathode (22) both include: A first fixed net (5); a second fixing net (6), the second fixing net being connected to the first fixing net (5), the second fixing net (6) cooperating with the first fixing net (5) to enclose a containing cavity, the first fixing net (5) and the second fixing net (6) both being made of metal material; Graphite carbon felt (7), the graphite carbon felt (7) is arranged in the accommodating cavity, and the graphite carbon felt (7) is respectively in contact with the first fixed net (5) and the second fixed net (6).

4. The method for using the electrochemical redox-coupled power-generating constructed wetland system according to claim 1, characterized in that: It also includes a water distribution pool (3), wherein the water distribution pool (3) is arranged between the electrochemical oxidation-reduction pool (1) and the power-generating artificial wetland (2); The electrochemical redox tank (1) is provided with a first water inlet (13) and a first water outlet (14); the first water inlet (13) and the first water outlet (14) are arranged on two opposite sides of the electrochemical redox tank (1); in a first direction, the first water inlet (13) is located below the first water outlet (14); and the first water outlet (14) is connected to the water distribution tank (3); The power-generating artificial wetland (2) is provided with a second water inlet (23) and a second water outlet (24); the second water inlet (23) and the second water outlet (24) are arranged on two opposite sides of the power-generating artificial wetland (2); in the first direction, the second water inlet (23) is located below the second water outlet (24); the second water inlet (23) is located below the first water outlet (14); and the second water inlet (23) is connected to the water distribution pool (3).

5. The method for using the electrochemical redox-coupled power-generating artificial wetland system according to claim 1, characterized in that: The residence time of the water to be treated in the electrochemical oxidation-reduction tank (1) is 35-45 hours, and the residence time of the pretreated water in the power-generating artificial wetland (2) is 70-75 hours.

Images