A Nocardia aurea strain and its application

Abstract

The present invention provides a Nocardia seriola strain and its application. The Nocardia seriola strain is Nocardia seriola B20200724, with a deposit number of CCTCC M 20231950. A nano-immersion vaccine prepared using this strain can prevent largemouth bass nodular disease caused by Nocardia seriola. The vaccine itself is non-toxic and has a relative immune protection rate of 73.3%. It can be used to prevent nocardiosis in largemouth bass during aquaculture, reducing the incidence of the disease and minimizing economic losses during production.

Description

Technical Field

[0001] The invention belongs to the technical field of vaccine preparation, and particularly relates to a Nocardia seriola strain and application thereof. Background Art

[0002] Nocardiosis is a common disease in aquaculture, characterized by superficial ulcers and granulomatous lesions in the internal organs. It can be seen in many common commercial fish species. The pathogen is Nocardia seriola. A conditionally pathogenic bacterium, Nocardia seriola has a long incubation period and subtle initial symptoms, making it difficult to detect in its early stages. Currently, control measures primarily include antibiotics and chemical agents, but these can increase the risk of drug-resistant bacteria, environmental contamination, and food residues, leading to serious problems.

[0003] Vaccine immunization is an effective and environmentally friendly means of preventing and controlling bacterial infections. However, there is currently no vaccine against Nocardia spp. on the market. Therefore, it is very necessary to develop a nocardiosis vaccine that can be used in actual production. Summary of the Invention

[0004] One of the objects of the present invention is to provide a fast-growing Nocardia seriolae strain, which was sent to the China Center for Type Culture Collection for preservation on October 20, 2023, with classification name: Nocardia seriolae B20200724, preservation number: CCTCC M 20231950, address: Wuhan University, Wuhan, China.

[0005] The present invention also provides the use of the Nocardia sphenotype B20200724 or its bacterial suspension or culture fluid or fermentation product or crushed product or a composition containing the same in preparing a vaccine.

[0006] The present invention also provides a Nocardia aurea vaccine, wherein the vaccine uses Nocardia aurea B20200724 as an active ingredient.

[0007] The present invention also provides a method for preparing the Nocardia aurea vaccine, comprising the following steps:

[0008] S1. Reproduction of primary seed fungi,

[0009] S2. Secondary bacterial species reproduction,

[0010] S3. Preparation and crushing of the vaccine solution,

[0011] S4. Preparation of chitosan nanoparticles loaded with disrupted Nocardia septempunctata cells.

[0012] S5. Emulsified seedling preparation.

[0013] Furthermore, step S1 includes taking the frozen strain of Nocardia sphenotype B20200724 to inoculate blood agar culture medium, culturing at 26-30°C for 72 to 96 hours, picking more than 5 typical single colonies, inoculating blood agar culture medium, culturing at 26-30°C for 72 to 96 hours, and testing the purity to be qualified as the first-level seed.

[0014] Furthermore, step S2 includes taking the first-level seed bacteria and inoculating it into BHI liquid culture medium, culturing it at 26-30° C. and 100-200 rpm for more than 150 hours, and testing its purity to use it as the second-level strain.

[0015] Furthermore, step S3 includes taking the secondary seed bacteria and inoculating BHI liquid medium at a volume ratio of 6%-10%, culturing at 26-30°C and 100-200 rpm for more than 72 hours, centrifuging at 5000 rpm for 15 minutes, resuspending in PBS, counting with a hemocytometer, and diluting to 10 9 The prepared bacterial suspension was further disrupted at a pressure of 1300 bar using a high-pressure cell disruptor for 30 min, and the disrupted bacterial suspension was stored statically.

[0016] Furthermore, step S4 includes slowly adding the crushed immunization bacterial liquid into the prepared chitosan solution at a ratio of 1:1, stirring for 10 minutes, slowly adding the TPP solution into the above solution at a ratio of 1:2-4, and continuing to stir for more than 15 minutes to obtain chitosan nanoparticles loaded with crushed bacteria of Nocardia septempunctata.

[0017] Furthermore, the preparation method of the chitosan solution includes using a 1% acetic acid solution to dissolve chitosan to prepare a chitosan solution with a concentration of 1 mg / ml, stirring it on a constant temperature magnetic stirrer overnight, and adjusting the pH of the solution with a sodium hydroxide solution the next day to a final value of 5, and then filtering the resulting solution using a sterile filter membrane with a pore size of 0.45 μm.

[0018] Furthermore, step S5 includes adding 6% by volume of Tween 20 and 2% by volume of medium chain triglycerides to the prepared solution, homogenizing the solution with an ultrasonic disruptor at an amplitude of 40% for 5 minutes to fully emulsify the solution and prepare seedlings.

[0019] Compared with the prior art, the present invention is beneficial in that:

[0020] 1. The vaccine has low preparation cost and low technical threshold, and the vaccine strain grows fast, which can be amplified in large quantities in a short period of time, allowing for rapid and efficient vaccine production.

[0021] 2. This vaccine can prevent nocardiosis in largemouth black bass caused by Nocardia spp., with a relative immune protection rate of 73.3%. It has good safety and will not stimulate pathological changes in the body. It can be used in actual production to prevent nocardiosis in largemouth black bass and reduce economic losses in the production process. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 : Colony morphology of Nocardia seriola strain B20200724.

[0023] Figure 2 : Gram staining of Nocardia septempunctata strain B20200724.

[0024] Figure 3 : Growth curves of Nocardia seriola B20200724 strain and the control Nocardia seriola B20200819 strain.

[0025] Figure 4 : The relationship between the ratio of TPP to chitosan solution and the particle size of the obtained nanoparticles.

[0026] Figure 5 : Preparation of chitosan nanoparticles loaded with disrupted Nocardia sphenotype cells.

[0027] Figure 6 : Particle size distribution of chitosan nanoparticles, ultrasonically crushed Nocardia septempunctata cells and their prepared nanovaccines.

[0028] Figure 7 : Transmission electron microscopy (TEM) images of intact bacteria, chitosan nanoparticles, ultrasonically crushed Nocardia sphenocardia bacteria, chitosan-broken bacteria complexes, and nanovaccines prepared from them. DETAILED DESCRIPTION

[0029] The technical solutions of the present invention will be described clearly and completely below in conjunction with specific embodiments. The following examples are preferred embodiments of the present invention, but do not limit the scope of protection of the present invention in any form. The replacement of simple parameters in the embodiments of the present invention cannot be described one by one in the examples, but the present invention is not limited thereto. Any other modification, substitution, combination, or simplification that does not deviate from the theoretical essence and principle of the present invention should be regarded as an equivalent replacement method and should be included within the scope of the present invention.

[0030] Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0031] Example 1 Isolation and Identification of Nocardia seriola B20200724 Strain

[0032] 1.1 Strain Isolation

[0033] The diseased material came from sick largemouth bass from a farm in Wuhan on July 24, 2020, with an average body length of 25 to 35 cm. Liver, spleen, and kidney specimens of the deceased individuals were collected and inoculated on blood agar medium. After incubation at 28°C for 48 hours, single colonies were picked for secondary separation and purification. The purified colonies were white, with a rough and uneven surface and a dot-like distribution. Microscopic examination after Gram staining showed that the bacteria were Gram-positive bacteria, which appeared as long rod-branched and non-motile under a microscope. Subsequently, a single colony was inoculated into BHI liquid culture medium for further subculture.

[0034] 1.2 Strain identification:

[0035] Physiological and biochemical identification and 16S rRNA sequencing were used for identification.

[0036] The isolated strain was physiologically and biochemically characterized using a physiological and biochemical assay kit (hopebio, China). Eleven parameters related to enzyme production, hydrolytic activity, and specific carbon source utilization were evaluated. The results showed that the strain was unable to produce urease, hydrogen sulfide, or acetamide; it was unable to hydrolyze esculin, gelatin, starch, tyrosine, and ornithine; and in terms of sole carbon source utilization, it was unable to utilize mannose, xylose, fructose, sorbitol, or citrate as a sole carbon source, essentially identical to the two reference Nocardia strains.

[0037] For 16S rRNA sequencing, 1 μL of bacterial suspension was used as a template using universal bacterial primers (16S-27f: AGAGTTTGATCCTGGCTCAG; 16S-1492r: GGTTACCTTGTTACGACTT). The resulting PCR product of the expected size was submitted to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Subsequently, BLAST analysis using the NCBI database revealed that the isolate shared the highest similarity, 100%, with the 16S rRNA of Nocardia seriolae strain NI (NCBI accession number MT367731.1). Combined with the physiological and biochemical identification results, the isolate was confirmed to be Nocardia seriolae.

[0038] The strain was sent to the China Center for Type Culture Collection for preservation on October 20, 2023, with classification name: Nocardia seriolae B20200724, preservation number: CCTCC M 20231950, address: Wuhan University, Wuhan, China.

[0039] Example 2 Growth experiment of Nocardia septempunctata B20200724 strain

[0040] In order to prepare an inactivated vaccine for Nocardia spp., it is necessary to culture Nocardia spp. in large quantities. Strains with faster growth rates can effectively reduce the time required for culture, thereby reducing the cost of vaccine production.

[0041] To evaluate the growth rate of the strains, strains of Nocardia sphenotype B20200724 and Nocardia sphenotype B20200819, also isolated and identified in our laboratory, were inoculated at an 8% inoculum concentration into 70 mL of BHI liquid culture medium in a 100 mL Erlenmeyer flask. Three replicates were set up for each group, and the bacteria were cultured on a shaker at 28°C. Samples were collected every 6 hours after inoculation, and the absorbance of the bacterial culture at a wavelength of λ = 600 nm was measured using a spectrophotometer (Shimadzu, Japan) using BHI liquid culture medium without bacteria as a negative control. Data were collected and analyzed using GraphPad Prism 8 software, and bacterial growth curves were plotted.

[0042] Growth experiments showed that B20200724 and B20200819 exhibited similar exponential growth trends under the same conditions. B20200724 exhibited a lag phase from 0 to 72 hours, a logarithmic phase from 72 to 120 hours, a stable phase from 120 to 138 hours, and a gradual decline phase after 138 hours. B20200819 exhibited a lag phase from 0 to 96 hours, a logarithmic phase from 96 to 156 hours, a stable phase from 156 to 178 hours, and a gradual decline phase after 178 hours. Furthermore, B20200724 exhibited superior growth rate and growth pattern compared to B20200819. In summary, the Nocardia seriola strain B20200724 exhibits a faster growth rate, making it a more suitable vaccine candidate.

[0043] Example 3: Application of Nocardia aurea B20200724 strain in nano-immersion vaccine

[0044] 1.1 Preparation of seed fungi for production

[0045] 1.1.1 Propagation and testing of primary seed fungi

[0046] Inoculate blood agar with frozen Nocardia seriola B20200724 strains and culture at 28°C for 72-96 hours. Select five representative colonies and inoculate them on blood agar. Culture at 28°C for 72-96 hours. After testing for purity, use them as primary seed. Store at 2-8°C for no more than 7 days and subculture on culture medium for no more than 5 generations.

[0047] 1.1.2 Secondary bacterial species reproduction and testing

[0048] Inoculate the primary seed bacteria into BHI liquid medium and culture at 28°C with shaking at 150 rpm for 150 hours. After testing its purity, use it as the secondary strain. Store at 2-8°C for no more than 7 days.

[0049] 1.2 Preparation and crushing of vaccine solution

[0050] 1.2.1 The culture medium for seedling production is BHI liquid medium

[0051] 1.2.2 Preparation of vaccine solution

[0052] Take the secondary seed bacteria and inoculate 8% by volume of BHI liquid medium, culture at 28℃, 150 rpm and shaking for 72 hours, centrifuge at 5000 rpm for 15 minutes, resuspend in PBS, count with a hemocytometer and dilute to 10 9 cfu / .ml for future use.

[0053] 1.2.3 Crushing of the vaccine solution

[0054] The prepared bacterial suspension was further disrupted using a high-pressure cell disruptor at 1300 bar for 30 minutes. The disrupted bacterial suspension was then stored at 4°C for 24 hours. If no significant precipitation occurred, the preparation was successful. The product was then plated on blood agar for 96 hours, and no colonies grew, indicating successful inactivation.

[0055] 1.3 Exploration of preparation conditions of chitosan nanoparticles

[0056] Chitosan nanoparticle carriers were prepared using an ionic crosslinking method. First, chitosan was dissolved in a 1% acetic acid (glacial acetic acid) solution to prepare a 1 mg / ml chitosan solution. The solution was stirred overnight on a thermostatic magnetic stirrer. The next day, the pH of the solution was adjusted to a final value of 5 using a 10 mol / L sodium hydroxide solution. The resulting solution was then filtered through a sterile filter membrane with a pore size of 0.45 μm and set aside.

[0057] TPP powder was dissolved in sterile distilled water to prepare a TPP stock solution with a concentration of 0.5 mg / mL, which was also filtered through a sterile filter membrane with a pore size of 0.45 μm. In a constant temperature magnetic stirrer at a speed of 800 rpm / min, TPP solution was slowly added dropwise to the above solution at a ratio of 1:2, 1:3, 1:4, 1:5, and 1:6 to prepare chitosan nanoparticles. The particle size data of the obtained nanoparticles were measured using a Malvern particle size measuring instrument. It was found that when the ratio of TPP to chitosan solution was 1:4, the particle size of the obtained nanoparticles was the smallest ( Figure 4 ).

[0058] 1.4 Preparation of chitosan nanoparticles loaded with disrupted Nocardia septempunctata cells

[0059] First, the crushed immunization solution was slowly added dropwise to the prepared chitosan solution at a ratio of 1:1. After stirring for 10 minutes, the TPP solution was slowly added dropwise to the above solution at ratios of 1:2, 1:3, 1:4, 1:5, and 1:6, respectively. Stirring was continued for 15 minutes to obtain chitosan nanoparticles loaded with crushed Nocardia seriola. The particle size data of the obtained nanoparticles were measured using a Malvern particle size measuring instrument. It was found that when the ratio of TPP to the chitosan solution loaded with crushed Nocardia seriola was 1:4, the particle size of the obtained nanoparticles was the smallest ( Figure 5 ).

[0060] 1.5 Characterization and determination of chitosan nanoparticles loaded with disrupted Nocardia septempunctata cells

[0061] Vaccines were prepared using the aforementioned 1:2, 1:3, 1:4, 1:5, and 1:6 groups. Taking the 1:4 group as an example, the particle size, PDI, and zeta potential of the chitosan nanoparticles, broken bacterial solution, and prepared nanovaccine were measured using a Malvern particle size analyzer. The results showed that after the broken Nocardia aurea cells and chitosan nanoparticles were complexed into the vaccine, the particle size and dispersion index increased slightly, and the zeta potential increased from -31.8 mV to 5.21 mV (Table 1), indicating that the nanovaccine was successfully prepared.

[0062] Table 1 Characterization results of particle size, PDI and zeta potential of chitosan solution, broken bacterial solution and prepared nanovaccine

[0063]

[0064] 1.6 Emulsified seedling preparation

[0065] To the prepared solution, 6% (w / w) Tween 20 and 2% (w / w) medium chain triglycerides were added respectively, and homogenized at 40% amplitude for 5 minutes using an ultrasonic disruptor to fully emulsify the solution and prepare seedlings.

[0066] Example 4: Safety Experiment

[0067] 1.1 Selection and temporary rearing of experimental fish

[0068] 120 largemouth bass of the same size, 10 cm in length, and 20 g in weight were selected and divided into six groups: Group 1 was a blank control, and Groups 2-6 were vaccinated with TPP and chitosan solutions containing crushed Nocardia seriola at ratios of 1:2, 1:3, 1:4, 1:5, and 1:6, respectively. The fish were reared for 7 days.

[0069] 1.2 Safety Experiment

[0070] 2L of water was added to a bucket, along with 50ml of the prepared vaccine. Largemouth bass in the vaccine group were then immersed in the water for 45 minutes for immunization. A control group was immersed in the same amount of water alone. Mortality in the six groups was observed over a 28-day period. The results showed no significant pathological changes or mortality in any of the six groups within 28 days, demonstrating the safety of the vaccine at this dose.

[0071] Example 5: Vaccine (Nocardia aurea B20200724) immune efficacy experiment

[0072] 1 Materials and Methods

[0073] 1.1 Vaccine

[0074] Example 3: The ratio of TPP to chitosan solution containing Nocardia septoria broken cells is 1:4.

[0075] 1.2 Test strains

[0076] Nocardia spp. strain, used for challenge experiments

[0077] 1.3 Experimental animals

[0078] They were purchased from Yichen Aquatic Products Co., Ltd., Zhijiang City, Hubei Province, with the same specifications, body length of 10 cm and weight of 20 g.

[0079] 1.4 Experimental Design

[0080] The experimental fish were divided into two groups, group 1 as blank control and group 2 as vaccine group. After 7 days of temporary rearing, 2L of water was added to a small bucket, and 50ml of the prepared vaccine was added. The largemouth black bass in the vaccine group were soaked in the water for 45 minutes for immunization, while the control group was only soaked in the same amount of water.

[0081] 28 days after immunization, a lethal dose (8*10 7 The mortality of the two groups of largemouth bass was observed within 60 days after infection, and the relative protection rate was calculated.

[0082] 2 Results

[0083] Twenty-eight days after immunization with the nano-soaked vaccine provided by the present invention, a challenge protection experiment was conducted on all immunized largemouth bass, including a blank control. After challenge, the incidence and mortality were observed, and the protection rate of each batch of vaccine was calculated.

[0084] As shown in Table 2, all largemouth bass in the unimmunized control group became ill and died within 60 days after the challenge, indicating that the challenge experiment was successful. The survival rate of largemouth bass in the vaccine group was 73.3%, and the relative immune protection rate was 73.3% (Table 2).

[0085] Table 2 Protection test results of Nocardia spp. B20200724 nanoparticle vaccine against largemouth bass (28 days after immunization)

[0086]

[0087] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details of the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

Claims

1. A strain of Nocardia seriolae B20200724, characterized in that: The Nocardia sphenanthera is deposited in the China Culture Collection with the deposit number CCTCC M 20231950 and the deposit date being October 20, 2023.

2. Use of the Nocardia seriola B20200724 according to claim 1 or its bacterial suspension or culture fluid or fermentation product or crushed product or composition containing the same in the preparation of an immersion vaccine.

3. A Nocardia seriola soaked vaccine, characterized in that: The vaccine contains the Nocardia seriola B20200724 described in claim 1 as an active ingredient.

4. The method for preparing the Nocardia aurea soaked vaccine according to claim 3, characterized in that: The steps include: S1. Reproduction of primary seed fungi, S2. Secondary bacterial species reproduction, S3. Preparation and crushing of the vaccine solution, S4. Preparation of chitosan nanoparticles loaded with disrupted Nocardia seriola cells, comprising: slowly adding the disrupted bacterial solution to a chitosan solution at a ratio of 1:1, stirring, slowly adding the TPP solution to the solution at a ratio of 1:4, and continuing to stir to obtain chitosan nanoparticles loaded with disrupted Nocardia seriola cells; S5. Emulsified seedling preparation.

5. The method according to claim 4, characterized in that Step S1 includes taking frozen strains of Nocardia sphenotype B20200724 and inoculating the strain into a blood agar medium, culturing the strain at 26-30° C. for 72 to 96 hours, picking a typical single colony, inoculating the strain into a blood agar medium, culturing the strain at 26-30° C. for 72 to 96 hours, and testing the strain for purity to determine if the strain is qualified, and then using the strain as a first-level seed.

6. The method according to claim 4, characterized in that Step S2 includes taking the first-level seed bacteria and inoculating the BHI liquid culture medium, culturing the culture medium at 26-30° C. and 100-200 rpm for more than 150 hours, and testing the purity of the culture medium as the second-level strain.

7. The method according to claim 4, characterized in that Step S3 includes taking the secondary seed bacteria and inoculating BHI liquid medium at a volume ratio of 6%-10%, culturing at 26-30°C and 100-200 rpm for more than 72 hours, centrifuging at 5000 rpm for 15 minutes, resuspending, counting with a hemocytometer, and diluting to 10 9 The prepared bacterial suspension was further disrupted at a pressure of 1300 bar using a high-pressure cell disruptor for 30 min, and the disrupted bacterial suspension was stored statically.

8. The method according to claim 4, characterized in that In step S4, the preparation method of the chitosan solution includes: using acetic acid solution to dissolve chitosan to prepare a chitosan solution with a concentration of 1 mg / ml, stirring it on a constant temperature magnetic stirrer overnight, adjusting the pH of the solution the next day to a final value of 5, and then filtering the resulting solution using a sterile filter membrane with a pore size of 0.45 μm.

9. The method according to claim 4, characterized in that 6% by volume of Tween 20 and 2% by volume of medium chain triglycerides were added to the prepared solution, and homogenized for 5 minutes at an amplitude of 40% using an ultrasonic disruptor to fully emulsify and prepare seedlings.

Images