A molecular marker ax-110119937 for detecting zinc content of wheat kernels and application thereof

Abstract

This invention discloses the molecular marker AX-110119937 for detecting zinc content in wheat grains and its applications, belonging to the field of SNP molecular markers. The AX-110119937 locus is an SNP site in the wheat genome, such as nucleotide 36 of SEQ ID No. 1, and its nucleotide type is G or A. This invention also provides a method for identifying or assisting in the identification of the zinc content trait in wheat grains. The method includes detecting the genotype of the AX-110119937 locus in the wheat to be tested. Wheat with the genotype GG at the AX-110119937 locus is zinc-rich wheat, and its grain zinc content is higher than or candidate to be higher than that of wheat with the genotype AA at the AX-110119937 locus. The molecular marker provided by this invention can be used to detect the genotype of QGZnzx.caas-6DL and for molecular breeding of zinc-rich wheat.

Description

Technical Field

[0001] This invention belongs to the field of SNP molecular marker technology, specifically relating to a molecular marker AX-110119937 for detecting zinc content in wheat grains and its applications. Background Technology

[0002] Micronutrient deficiencies, also known as "hidden hunger," particularly zinc deficiency, pose serious health risks and are a pressing global problem. Wheat, as one of the world's major food crops, plays a vital role in ensuring food security and nutritional status. However, due to historical selection factors, modern wheat varieties generally have low zinc content in their grains. To meet human health needs, genetic improvement efforts for grain zinc content are progressing both domestically and internationally. In recent years, the rapid development of molecular markers has provided an opportunity for the genetic improvement of wheat grain zinc content. Molecular markers can effectively identify genetic loci related to grain zinc content and utilize marker-assisted selection strategies for genetic improvement, increasing selection efficiency and significantly shortening breeding cycles. Summary of the Invention

[0003] The technical problem to be solved by this invention is: how to screen or assist in the screening of zinc-rich wheat.

[0004] To solve the above-mentioned technical problems, in a first aspect, the present invention provides a method for identifying or assisting in the identification of zinc content traits in wheat grains, the method comprising using a substance for detecting the genotype of the AX-110119937 locus to detect the genotype of the wheat to be tested, and identifying or assisting in the identification of the zinc content traits in the grains of the wheat to be tested based on the genotype of the wheat to be tested.

[0005] The AX-110119937 site is a SNP site in the wheat genome, such as nucleotide 36 of SEQ ID No. 1, and its nucleotide type is G or A.

[0006] The grain zinc content of the wheat sample with genotype GG at the AX-110119937 locus is higher or higher than that of the wheat sample with genotype AA at the AX-110119937 locus.

[0007] Wherein, the genotype GG indicates that the nucleotide type at the AX-110119937 site in the wheat genome is G; the genotype AA indicates that the nucleotide type at the AX-110119937 site in the wheat genome is A.

[0008] Furthermore, in the above method, the substance used to detect the AX-110119937 locus genotype is as follows: A1), A2), or A3):

[0009] A1) The substance used to detect the genotype of the AX-110119937 locus is a PCR primer composition for amplifying wheat genomic DNA fragments including the AX-110119937 locus;

[0010] A2) The substance used to detect the AX-110119937 locus genotype is a PCR reagent containing the PCR primer composition described above;

[0011] A3) A kit containing the PCR primer composition described in A1) or the PCR reagent described in A2).

[0012] Furthermore, in the above method, the PCR primer composition comprises single-stranded DNA with nucleotide sequence of positions 22-40 of SEQ ID No. 2, single-stranded DNA with nucleotide sequence of positions 22-40 of SEQ ID No. 3, and single-stranded DNA with nucleotide sequence of SEQ ID No. 3.

[0013] Furthermore, in the above method, the PCR primer composition includes primer A with the nucleotide sequence shown in SEQ ID No. 2, primer B with the nucleotide sequence shown in SEQ ID No. 3, and primer C with the nucleotide sequence shown in SEQ ID No. 4.

[0014] Furthermore, in the above method, the molar ratio of primer A, primer B and primer C in the PCR primer composition is 2:2:5.

[0015] Furthermore, the above method is characterized in that: the method includes detecting the genotype of the wheat at the AX-110119937 locus, identifying or assisting in the identification of the zinc content of wheat grains based on the genotype, and the zinc content of the wheat grains of the wheat with the genotype GG at the AX-110119937 locus is higher or candidate higher than that of the wheat with the genotype AA at the AX-110119937 locus.

[0016] Furthermore, in the above method, the method for detecting the genotype of the AX-110119937 locus of the wheat to be tested includes using the genomic DNA of the wheat to be identified as a template, performing KASP using the above-mentioned PCR primer composition to obtain PCR products; and determining the genotype based on the fluorescence signal of the PCR products.

[0017] The above method specifically includes the following operational steps:

[0018] S1) Extract genomic DNA from the wheat to be tested;

[0019] S2) Using the genomic DNA extracted in S1) as a template, and the above-mentioned PCR primer combination as amplification primers, PCR amplification is performed to obtain PCR amplification products;

[0020] S3) Determine or assist in determining the zinc content trait of the wheat grains to be tested based on the genotype of the AX-110119937 locus in the PCR amplification product.

[0021] The grain zinc content of the tested wheat with genotype GG at the AX-110119937 locus is higher or candidate higher than that of the tested wheat with genotype AA at the AX-110119937 locus.

[0022] Furthermore, in the above method, the primer composition described in S2) includes primer A, primer B, and primer C.

[0023] Furthermore, in the above method, step S3) determines the genotype of the AX-110119937 SNP site based on the fluorescence color development of the PCR product.

[0024] Furthermore, the 5' ends of primers A and B are specific fluorescent tag sequences.

[0025] Furthermore, the specific fluorescent tag sequences at the 5' ends of primer A and primer B are different, allowing them to bind to fluorescent probes of different luminescent types.

[0026] In one embodiment of the present invention, the first 21 nucleotides of primer A are specific fluorescent tag sequences FAM, and the first 21 nucleotides of primer B are specific fluorescent tag sequences HEX.

[0027] More specifically, the genotype of the AX-110119937 SNP site of the amplification products of primers A and C is GG, carrying the FAM fluorescent adapter sequence, and the PCR amplification products show blue fluorescence when irradiated.

[0028] The AX-110119937 SNP genotype of the amplification products of primers B and C is AA, carrying the HEX fluorescent adapter sequence. The PCR amplification products show red color when exposed to fluorescence.

[0029] The genotype of the AX-110119937 SNP site in the amplification products of primers A, B, and C is GA; the PCR amplification products show a green color when illuminated by fluorescence. That is:

[0030] If the PCR product turns blue when illuminated by fluorescence, then the genotype at the AX-110119937 locus is GG.

[0031] The PCR product turns red when irradiated with fluorescence, therefore the genotype of the AX-110119937 SNP site is GG;

[0032] If the PCR product shows a green color when illuminated by fluorescence, then the genotype of the AX-110119937 SNP site is GA.

[0033] The genotype GG indicates a homozygous wheat genome with nucleotides of type G at the AX-110119937 locus; the genotype AA indicates a homozygous wheat genome with nucleotides of type A at the AX-110119937 locus; and the genotype GA indicates a heterozygous wheat genome with nucleotides of both G and A at the AX-110119937 locus.

[0034] Specifically, in step S2), using the DNA obtained in step S1) as a template, the PCR primer set (primer A, primer B, and primer C) is used for PCR amplification to obtain amplification products. The PCR reaction system is as follows: 2.0 μL dried DNA, 0.056 μL KASP primer working solution, 2.5 μL 2×KASP master Mix (LGC Genomics, https: / / www.lgcgroup.com / ), and 2.5 μL sterile water. The concentrations of the two competing primers (primer A and primer B) in the KASP primer working solution are 12 μM, and the concentration of the universal primer (primer C) is 30 μM, i.e., the molar ratio of primer A, primer B, and primer C in the primer working solution is 2:2:5. The 2×KASP master Mix contains two universal fluorescent probes and two universal quenching probes synthesized for the upstream primer tag sequences (FAM and HEX).

[0035] The PCR amplification program was performed using an S1000™ Thermal Cycler 384-well PCR instrument. The reaction program consisted of three stages: (1) denaturation at 95℃ for 15 min; (2) denaturation at 95℃ for 20 s, annealing / extension at 65-55℃ for 1 min, 10 descending cycles, with each cycle decreasing by 1℃; (3) denaturation at 95℃ for 20 s, annealing / extension at 57℃ for 1 min, 32 cycles.

[0036] Step S3) Result reading: After the PCR reaction is completed, the fluorescence value is read using the PHERAstar Plus autofocus fluorescence multifunctional microplate reader (BMG LABTECH), and then the data is imported into Klustercaller v3.4 software (LGC, Hoddesdon, UK) for genotyping.

[0037] To address the aforementioned technical problems, in a second aspect, the present invention provides a DNA molecule containing the AX-110119937 site or a substance for detecting the AX-110119937 site genotype, wherein the nucleotide sequence of the DNA molecule containing the AX-110119937 site is the 36th nucleotide of SEQ ID No. 1, and its nucleotide type is G or A; the substance for detecting the AX-110119937 site genotype is the aforementioned PCR primer composition.

[0038] To address the aforementioned technical problems, in a third aspect, the present invention also provides a kit containing the aforementioned PCR primer composition.

[0039] To address the aforementioned technical problems, in a fourth aspect, the present invention provides the use of the AX-110119937 locus or a substance for detecting the AX-110119937 locus genotype in any of the following:

[0040] C1) Identification or auxiliary identification of zinc content in wheat grains;

[0041] C2) Screening or assisted screening of wheat plants, lines, strains or varieties with high zinc content in wheat grains;

[0042] C3) Wheat-assisted breeding.

[0043] To solve the above-mentioned technical problems, in a fifth aspect, the present invention provides a method for wheat breeding, the method comprising using wheat with the genotype GG at the above-mentioned AX-110119937 locus as a parent for breeding, wherein the GG genotype represents a homozygous wheat genome in which the nucleotide type at the AX-110119937 locus is G.

[0044] In this invention, the purpose of the above-mentioned breeding includes cultivating or selecting wheat with high zinc content in the grains.

[0045] In this invention, the zinc content of wheat grains refers to the zinc content of wheat grains after the wheat plant has matured. The AX-110119937 site is the 36th position of the nucleotide sequence shown in Sequence 1 on the long arm of wheat chromosome 6D.

[0046] This invention utilizes the Zhongmai 175 / Xiaoyan 60 population to locate the grain zinc content QTL QGZnzx.caas-6DL from Xiaoyan 60 on chromosome 6DL, with a corresponding physical region of 458.8–473.0 Mb in the Chinese Spring Reference Genome (IWGSC RefSeq v1.1). Based on this research, the SNP marker AX-110119937 of this region is converted into the high-throughput, low-cost, and low-error-rate KASP marker K_AX-110119937. Experiments demonstrate that the KASP molecular marker K_AX-110119937 described in this invention can be used to detect the genotype of the grain zinc content QTL QGZnzx.caas-6DL and for marker-assisted selection breeding of zinc-enriched wheat. Attached Figure Description

[0047] Figure 1 A 6DL genetic linkage map was constructed for SNP markers in a 55K chip, and the position of the AX-110119937 locus was found on the genetic linkage map.

[0048] Figure 2 The results of the K-AX-110119937 primer set on the detection of Zhongmai 175, Xiaoyan 60 and 250 families.

[0049] Figure 3 The results of testing the K-AX-110119937 primer set on Jingdong 8, Aikang 58 and 254 families. Detailed Implementation

[0050] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0051] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0052] The wheat materials used in the following examples were all provided by the National Wheat Improvement Center.

[0053] The Zhongmai 175 used in the following examples was preserved in this experiment and is described in the following literature: He Zhonghu, Chen Xinmin, Wang Desen, et al. Analysis of the high-yield, high-efficiency and wide-adaptability characteristics of Zhongmai 175 and thinking on breeding methods [J]. Chinese Agricultural Science, 2015, 48(17):3394-3403. The public can obtain the above-mentioned biological materials from the applicant. The above-mentioned biological materials are only used to repeat the experiments of this invention and cannot be used for other purposes.

[0054] The Xiaoyan 60 in the following examples was donated by Zheng Qihui of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and is described in the following literature: LUO QL, ZHENG Q, HU P, LIU LQ, YANG GT, LI HW, LI B, LI Z S. Mapping QTL for agronomic traits under two levels of salt stress in a new constructed RILwheat population[J]. Theoretical and Applied Genetics, 2020, 134(1):1-19. The above-mentioned biological materials can be obtained from the applicant by the public. The above-mentioned biological materials are only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0055] The Jingdong 8 and Aikang 58 used in the following examples were preserved in this experiment and are described in the following literature: Wang Y, Xu X, Hao Y, et al. QTL mapping for grain zinc and iron concentrations in bread wheat[J]. Frontiers in nutrition, 2021, 8: 680391. The public can obtain the above-mentioned biological materials from the applicant. The above-mentioned biological materials are only used to repeat the experiments of this invention and cannot be used for other purposes.

[0056] Example 1: Discovery of Zinc Content QTL (QGZnzx.caas-6DL) and Closely Linked SNPs in Wheat Grains

[0057] 1. Test materials: Zhongmai 175 (female parent) and Xiaoyan 60 (male parent) were crossed to obtain the F1 generation of the cross between Zhongmai 175 and Xiaoyan 60. The F1 generation was self-crossed to obtain the F2 population; the SSD single-seed transfer method was used to obtain the F7 recombinant inbred line (RIL) population containing 250 families.

[0058] 2. Field Trials: A total of 250 families of the Zhongmai 175 / Xiaoyan 60F7 RIL population were planted in Gaoyi and Gaocheng in 2018–2019, and in Gaoyi, Gaocheng, and Beijing in 2019–2020, covering a total of 5 environments. Field planting employed a completely randomized block design with two replicates, single-row plots, 1m row length, 0.2m row spacing, and 30 seeds evenly sown per row. For several consecutive years, the experimental fields were treated with zinc fertilizer before sowing, applying ZnSO4·7H2O at a rate of 25kg / hm2 as basal fertilizer. Field management practices followed local wheat production field management standards.

[0059] 3. Determination of zinc content in grains: (1) First, use high vacuum grease to seal a 4μm thick Poly 4 sample film on the inner wall and bottom of an aluminum cup with a diameter of about 40mm; (2) Take about 15g of cleaned grains and put them into the aluminum cup with the sealed Poly 4 sample film, and gently shake to distribute the grains evenly; (3) Load the sample onto the instrument and use X-Supreme 8000 (Oxford Instruments plc, Abingdon, UK) to determine the zinc content. The analysis model established by Paltridge et al. (2012) was used to analyze the zinc and iron content of the grains. The total analysis time for each sample was 186s, including 60s of zinc collection time and 66s of dead zone time.

[0060] 4. Genetic Map Construction: Genotyping analysis was performed on 250 families from the Zhongmai 175, Xiaoyan 60, and Zhongmai 175 / Xiaoyan 60 populations using the wheat 55K SNP chip. After obtaining the genotyping data, markers with non-polymorphism, deletion genotypes higher than 1%, heterozygous genotypes higher than 10%, and minimum allele frequencies less than 40% were screened. The genetic distance between markers was calculated using the "nntwoopt" algorithm in IciMapping v4.1.

[0061] 5. QTL mapping and discovery of linkage marker AX-110119937: Complete composite interval mapping (ICIM) was used in IciMapping v4.1 software to map grain zinc content in 250 families of RIL populations under different conditions. The LOD threshold was set to 2.5. The mapping results showed that a QTL controlling grain zinc content exists on the long arm of chromosome 6D (AX-110119937). Figure 1 The left and right markers are AX-110482347 and AX-111540231, respectively, and their enhancing alleles are from Xiaoyan 60. After extensive sequence analysis, alignment, and preliminary experiments, it was found that the flanking sequence of the SNP marker AX-110119937 in the QTL region is specific on chromosome 6D. Therefore, it was converted into a KASP marker for molecular marker-assisted selection breeding.

[0062] 6. Obtaining the KASP marker K-AX-110119937 specific primer set: Sequence 1 is a flanking sequence of the SNP marker AX-110119937, where position 36 of Sequence 1 represents one of the two polymorphic single nucleotides of this SNP marker, G or A. Sequence 1 was uploaded to the Polymarker website (http: / / www.polymarker.info / ) for primer design. The obtained primer set includes two competing primers (primer A and primer B) and one universal primer (primer C). The 5′ ends of the two competing primers were respectively supplemented with universal fluorescent adapter sequences FAM and HEX. The specific sequences are as follows:

[0063] K-AX-110119937:AGCGACCAACGGTAAGCGCATCTCTGGGAAGGCAC[G / A]GTCAGGCTCCTCCACGCCTCGGGAATTGGTGGTGC;

[0064] According to Appendix 1, Table 1 of the nucleotide and / or amino acid sequence listing and electronic sequence listing standard (ZC 0003-2001), when the nucleotide sequence is G or A, it is represented by the symbol "r", that is, the nucleotide sequence of sequence 1 is:

[0065] AGCGACCAACGGTAAGCGCATCTCTGGGAAGGCACrGTCAGGCTCCTCCACGCCTCGGGAATTGGTGGTGC (sequence 1);

[0066] Primer A: (Sequence 2, the single underlined part is the specific fluorescent tag sequence FAM, and the double underlined letters are polymorphic sites);

[0067] Primer B: (Sequence 3, the single underlined part is the specific fluorescent tag sequence HEX, and the double underlined letters are polymorphic sites);

[0068] Primer C: 5'-CCACCAATTCCCGAGGCG-3' (Sequence 4).

[0069] The nucleotide sequences of the amplification products of primers A and C are as follows:

[0070] 5'-GAAGGTGACCAAGTTCATGCTGCATCTCTGGGAAGGCACGGTCAGGCTCCTCCACCGCCTCGGGAATTGGTGG-3' (Sequence 5).

[0071] The nucleotide sequences of the amplification products of primers B and C are as follows:

[0072] 5'-GAAGGTGACCAAGTTCATGCTGCATCTCTGGGAAGGCACAGTCAGGCTCCTCCACGCCTCGGGAATTGGTGG-3' (Sequence 6).

[0073] The genotype of the AX-110119937 SNP site of the amplification products of primers A and C is GG, carrying the FAM fluorescent adapter sequence. The PCR amplification products show blue fluorescence after irradiation.

[0074] The AX-110119937 SNP genotype of the amplification products of primers B and C is AA, carrying the HEX fluorescent adapter sequence. The PCR amplification products show red color when exposed to fluorescence.

[0075] The genotype of the AX-110119937 SNP site in the amplification products of primers A, B, and C is GA; the PCR amplification products show a green color when irradiated with fluorescence.

[0076] The genotype GG at the AX-110119937 SNP locus indicates a homozygous genotype of G at the AX-110119937 SNP locus in the wheat genome.

[0077] The genotype AA at the AX-110119937 SNP locus indicates that the genotype A at the AX-110119937 SNP locus in the wheat genome is homozygous.

[0078] The genotype GA at the AX-110119937 SNP locus indicates that the genotype at the AX-110119937 SNP locus in the wheat genome is heterozygous for both G and A.

[0079] Example 2: Establishment of a method for detecting the AX-110119937 genotype using specific primer set K_AX-110119937

[0080] The parents and 250 families of the Zhongmai 175 / Xiaoyan 60RIL population described in Example 1 were tested using K_AX-110119937.

[0081] 1. Obtaining genomic DNA: Genomic DNA was extracted from the parents and all families of the Zhongmai 175 / Xiaoyan 60RIL population and diluted to obtain a template solution with a DNA concentration of approximately 50 ng / μL.

[0082] 2. Using the DNA obtained in step 1 as a template, PCR amplification was performed using the K_AX-110119937 primer set (primer A, primer B, and primer C) described in Example 1 to obtain the amplification product. The PCR reaction system was as follows: 2.0 μL dried DNA, 0.056 μL KASP primer working solution, 2.5 μL 2×KASP master Mix (LGC Genomics, https: / / www.lgcgroup.com / ), and 2.5 μL sterile water. The concentrations of the two competing primers (primer A and primer B) in the KASP primer working solution were 12 μM, and the concentration of the universal primer (primer C) was 30 μM. The ratio of the amounts of primers A, B, and C in the primer working solution is 2:2:5. The 2×KASP master Mix (LGC Genomics, KBS-1016-002) contains two universal fluorescent probes and two universal quenching probes synthesized for the upstream primer tag sequences (FAM and HEX).

[0083] 3. PCR amplification program: PCR reaction was performed using an S1000™ Thermal Cycler 384-well PCR instrument. The reaction program consisted of three stages: (1) denaturation at 95℃ for 15 min; (2) denaturation at 95℃ for 20 s, annealing / extension at 65-55℃ for 1 min, 10 descending cycles, with each cycle decreasing by 1℃; (3) denaturation at 95℃ for 20 s, annealing / extension at 57℃ for 1 min, 32 cycles.

[0084] 4. Result reading: After the PCR reaction, the fluorescence value was read using the PHERAstar Plus autofocus fluorescence multi-functional microplate reader (BMG LABTECH), and then the data was imported into Klustercaller v3.4 software (LGC, Hoddesdon, UK) for genotyping.

[0085] The results are as follows Figure 2 As shown, the blue sample in the lower right corner represents the allele of the FAM fluorescent tag sequence (i.e., GG genotype, the same as Xiaoyan 60); the red sample in the upper left corner represents the allele of the HEX fluorescent tag sequence (i.e., AA genotype, the same as Zhongmai 175); the green sample represents the heterozygous genotype (i.e., GA genotype); the pink sample may have an unclear genotype due to poor genomic DNA quality. Comparing the genotyping results of the Zhongmai 175 / Xiaoyan 60 RIL population with the original microarray genotyping, the developed marker detection results were consistent with the microarray data, proving the effectiveness of the developed marker and indicating successful transformation of the AX-110119937 marker primer set K_AX-110119937.

[0086] Example 3: Application of K_AX-110119937 in the auxiliary identification of zinc content in wheat grains

[0087] 1. Test materials: 254 families and parents of the Jingdong 8 / Aikang 58F6 RIL population. Family names are shown in column 2 of Table 1. This population was planted in Beijing, Gaoyi and Shijiazhuang in 2016–2017, 2017–2018 and 2018–2019 respectively, and grains from 9 different environments were obtained.

[0088] 2. DNA extraction from wheat samples: Genomic DNA was extracted from the parents and all families of the Jingdong 8 / Aikang 58RIL population using a high-salt, low-pH method. The DNA was then diluted to obtain a template solution with a concentration of approximately 50 ng / μL.

[0089] 3. K_AX-110119937 marker detection: Following the method described in Example 2, the genotype of the wheat samples was analyzed using the high-throughput molecular marker detection system described above. The results are as follows: Figure 3 As shown: the blue sample in the lower right corner represents the allele type linked to the FAM fluorescent tag sequence (i.e., the GG genotype, the same as the Jingdong 8 genotype); the red sample in the upper left corner represents the allele type linked to the HEX fluorescent tag sequence (i.e., the AA genotype, the same as the Aikang 58 genotype); the green sample represents the heterozygous gene (i.e., the GA genotype); the pink sample may have an undetermined genotype due to poor genomic DNA quality, etc. The genotype results of the wheat samples are listed in column 3 of Table 1.

[0090] 4. Determination of zinc content in wheat grains: The zinc content of the grains from the above-mentioned test materials in nine different environments was analyzed using X-ray fluorescence spectrometry. The mean zinc content of the grains from the nine environments is listed in column 4 of Table 1.

[0091] Table 1. Mean zinc content and genotypes detected by primer set K_AX-110119937 in 254 families of the Jingdong 8 / Aikang 58RIL population.

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099] Note: NN indicates unknown genotype.

[0100] 5. The t-test was performed on the zinc content of grains from different genotypes of 254 wheat samples using the PROC TTEST model in the internationally used SAS 9.2 statistical software. The results are shown in Table 2. The results show that the zinc content of grains from GG genotype samples is significantly higher than that from AA genotype samples, indicating that the primer set and genotype detection system of K_AX-110119937 can be used for molecular-assisted selection breeding aimed at improving the zinc content of wheat grains.

[0101] Table 2. Zinc content t-test of 254 families in the Jingdong 8 / Aikang 58RIL population

[0102]

[0103] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for identifying or assisting in the identification of zinc content in wheat grains, characterized in that: Including the use of detection AX- 110119937 The material detection of locus genotypes is used to identify the genotype of the wheat to be tested, and to identify or assist in the identification of the grain zinc content trait of the wheat to be tested based on the genotype. The AX-110119937 The site is a SNP site in the wheat genome, such as nucleotide 36 of SEQ ID No. 1, whose nucleotide type is G or A. The AX-110119937 The grain zinc content of the tested wheat with the genotype GG at the locus was higher than or higher than that of the candidate locus. AX-110119937 The wheat sample with the genotype AA at the locus; Wherein, the genotype GG represents the wheat genome. AX-110119937 The nucleotide type at the site is homozygous for G; the genotype AA indicates that the nucleotide at the site is homozygous for G in the wheat genome. AX-110119937 The nucleotide type at the site is homozygous for A.

2. The method according to claim 1, characterized in that: The detection AX-110119937 The material for the locus genotype is as follows: A1), A2), or A3): A1) The detection AX-110119937 The material for amplifying the locus genotype includes the aforementioned AX-110119937 PCR primer composition for wheat genomic DNA fragments including loci; A2) The detection AX-110119937 The substance for the locus genotype is a PCR reagent containing the PCR primer composition described above; A3) A kit containing the PCR primer composition described in A1) or the PCR reagent described in A2).

3. The method according to claim 2, characterized in that: The PCR primer composition comprises single-stranded DNA with nucleotide sequence of positions 22-40 of SEQ ID No. 2, single-stranded DNA with nucleotide sequence of positions 22-40 of SEQ ID No. 3, and single-stranded DNA with nucleotide sequence of SEQ ID No.

3.

4. The method according to claim 2 or 3, characterized in that: The PCR primer composition includes primer A, whose nucleotide sequence is shown in SEQ ID No. 2; primer B, whose nucleotide sequence is shown in SEQ ID No. 3; and primer C, whose nucleotide sequence is shown in SEQ ID No.

4.

5. The method according to claim 4, characterized in that: In the PCR primer composition, the molar ratio of primer A, primer B and primer C is 2:2:

5.

6. The method according to any one of claims 1-5, characterized in that: The detection of wheat as described in claim 1 AX-110119937 The method for genotyping a locus includes using wheat genomic DNA to be identified as a template and performing KASP with the primer composition described in claim 4 to obtain PCR products; The genotype was determined based on the fluorescence signal of the PCR product.

7. AX-110119937 Site or detection AX-110119937 Application of substances with locus genotypes in any of the following: C1) Identification or auxiliary identification of zinc content in wheat grains; C2) Screening or assisted screening of wheat plants, lines, strains or varieties with high zinc content in wheat grains; C3) Assisted breeding of the zinc content trait in wheat grains; The AX-110119937 The site is a SNP site in the wheat genome, such as nucleotide 36 of SEQ ID No. 1, whose nucleotide type is G or A. The AX-110119937 The grain zinc content of the tested wheat with the genotype GG at the locus was higher than or higher than that of the candidate locus. AX-110119937 The wheat sample with the genotype AA at the locus; in, The genotype GG indicates that the wheat genome contains... AX-110119937 The nucleotide type at the site is homozygous for G; the genotype AA indicates that the nucleotide at the site is homozygous for G in the wheat genome. AX-110119937 The nucleotide type at the site is homozygous for A.

8. A method for breeding wheat grains with zinc content traits, characterized in that: The method includes selecting the method described in claim 1. AX-110119937 Wheat with the genotype GG at the locus was used as a parent for breeding, where the GG genotype represents the genotype at the locus described above. AX-110119937 The nucleotide type at the site is homozygous for G.

Images