A KASP marker primer set linked to the yield traits of cauliflower curds and its application
By developing a KASP marker primer group linked to the yield traits of cauliflower spheres, the problem of lack of effective genetic localization and molecular marking in cauliflower breeding was solved, and early efficient screening of high-yield materials for cauliflower was achieved, and breeding efficiency was improved.
Patent Information
- Application Number
- CN202311854360.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-29
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2043-12-29
AI Technical Summary
The lack of effective genetic localization and linkage molecular markers for the yield traits of cauliflower spheres in the prior art leads to inefficient cauliflower breeding.
A KASP marker primer set linked to the yield trait of cauliflower spheres was developed. The KASP marker KCY363, which is closely related to the weight of cauliflower spheres, was genotyped by KASP technology.
The early, rapid and accurate detection of high-yield materials of cauliflower spheres has been achieved, which improves the accuracy and efficiency of breeding selection, and significantly reduces the later workload of field management and phenotypic identification.
Smart Images

Figure CN117660689B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a KASP marker linked to the yield trait of cauliflower heads, and more specifically to a set of KASP marker primers linked to the yield trait of cauliflower heads and their applications. Background Art
[0002] Cauliflower (Brassica oleracea var. botrytis) is a type of specialty vegetable crop belonging to the Brassica genus (CC, 2n = 18), with its flower head as the product organ. It is highly favored by people because it is rich in vitamin C, minerals, and the anti-cancer active substance sulforaphane.
[0003] Unlike other cruciferous vegetables, cauliflower develops a unique curd-like organ during flower development. This organ, composed of numerous inflorescence meristems and a short, fleshy pedicel, is known in production as the "flower head." The flower head serves as both a reproductive and a product organ, and its weight is a crucial factor in cauliflower yield. Increasing cauliflower yield has always been a key objective in cauliflower breeding research, as flower head yield directly determines the economic value of cauliflower.
[0004] Crop yield is a complex agronomic trait controlled by multiple genes. Numerous studies have been conducted on this trait in field crops such as rice, wheat, and maize, identifying a number of important genes controlling yield traits such as thousand-grain weight and single-ear weight. However, in Brassica oleracea vegetables, there are few reports on the genetic mapping of yield traits. To date, no studies have been reported on the genetic mapping of cauliflower head yield traits and the development of linkage molecular markers.
[0005] Therefore, developing KASP markers for identifying cauliflower head yield will provide effective auxiliary selection molecular markers for breeding high-yielding cauliflower varieties and improve their breeding efficiency, which is of great strategic significance for promoting the healthy and sustainable development of the cauliflower industry. Summary of the Invention
[0006] The purpose of this invention is to provide a KASP marker primer set linked to the yield trait of cauliflower heads and its application, which can detect cauliflower materials at the seedling stage, enabling early, rapid, and accurate detection of high-yielding cauliflower heads, and using KASP technology to perform genotyping of the developed KASP markers.
[0007] To achieve the above objectives, the present invention provides a primer set of KASP markers linked to the cauliflower head yield trait, the primer set comprising: a forward primer FAM, a forward primer HEX, and a reverse primer; wherein the nucleotide sequence of the forward primer FAM is shown in SEQ ID NO.1; the nucleotide sequence of the forward primer HEX is shown in SEQ ID NO.2; and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.3.
[0008] Preferably, the 5' end of the nucleotide sequence of the forward primer FAM is supplemented with a universal adapter sequence as shown in SEQ ID NO.4.
[0009] Preferably, the 5' end of the nucleotide sequence of the forward primer HEX is supplemented with a universal adapter sequence as shown in SEQ ID NO.5.
[0010] Another object of the present invention is to provide a KASP marker kit linked to the yield trait of cauliflower heads, wherein the primers in the kit are the primer set described above.
[0011] Preferably, the PCR premix in the kit comprises: universal FRET cassette fluorescent primers, ROX internal control dye, KlearTaq DNA polymerase, dNTPs, and MgCl2.
[0012] Another object of the present invention is to provide an application of the said primer set or the said kit, the application being selected from any of the following:
[0013] (1) Application in assisting the breeding of cauliflower with different head yields;
[0014] (2) Application in detecting major QTL loci and gene mapping of cauliflower head yield trait.
[0015] Preferably, PCR is performed using the primer set or the kit, and the weight of a single head of cauliflower is determined based on the genotype of the PCR product; if the genotype of the PCR product is AA, then the cauliflower is a low-head-weight cauliflower; if the genotype of the PCR product is CC, then the cauliflower is a high-head-weight cauliflower.
[0016] Preferably, the PCR reaction system comprises: PCR premix, the primer set, and template DNA.
[0017] Preferably, the PCR reaction conditions are as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, annealing and extension at 61-55℃ for 60 s, with the annealing temperature decreasing by 0.6℃ in each cycle, for a total of 10 cycles; 94℃ denaturation for 20 s, 55℃ annealing and extension for 60 s, for a total of 26 cycles.
[0018] The KASP marker primer set linked to cauliflower head yield trait of the present invention and its application have the following advantages:
[0019] This invention constructed two high-density genetic linkage maps. Combined with phenotypic and genotypic data of individual plants in the population, it was found that major QTLs were located on chromosome C6 in both populations. The results showed that the physical locations of the two QTLs overlapped, indicating that the co-located QTLs play a stable regulatory role in the cauliflower head weight trait under different genetic backgrounds.
[0020] This invention, based on the obtained major-effect QTL loci, selects SNP loci with genotypic differences and extracts their flanking sequences according to the resequencing results of the parents, developing them into KASP markers. Through further screening and verification of the genetic population, the KASP marker KCY363, which showed good genotyping results and was closely related to the single head weight of cauliflower, was selected as a molecular marker for linkage to the cauliflower head yield trait, for rapid and accurate screening of single head weight phenotypes. This SNP is located at position C or A on chromosome C6 of the broccoli HDEM (verson 1.0) reference genome. When the base sequence is mutated from A to C, the corresponding single head weight of cauliflower is significantly increased.
[0021] This invention utilizes KASP markers linked to cauliflower head yield traits, which can be applied to assisted selection for high-yield cauliflower head traits. It allows for early-stage batch testing of breeding materials, enabling the early elimination of many suboptimal materials. The testing is convenient and inexpensive, significantly reducing the workload of later stages such as transplanting, field management, and phenotypic identification. Traditional breeding methods rely entirely on phenotypic surveys of head yield traits, which are influenced by plant development and external environmental factors, resulting in low selection accuracy and efficiency. The method of this invention can identify genotypes at specific loci, enabling high-throughput screening of target populations and directly determining whether plants contain genes for high head yield, making it both efficient and accurate. Attached Figure Description
[0022] Figure 1 The present invention constructs three parents for two F2 populations; parent C4101 has a single pellet weight of approximately 1.25 kg; parent R06 has a single pellet weight of approximately 0.32 kg.
[0023] Figure 2 The following are high-density genetic maps of the two F2 populations of this invention: (A) CJ-F2 population map; (B) CR-F2 population map.
[0024] Figure 3 To identify F using the KASP marker KCY363 of this invention 2:3 Genotyping diagrams of individual plants (A) and core germplasm materials (B). Detailed Implementation
[0025] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0026] Development of KASP markers linked to cauliflower head yield trait in Experiment 1
[0027] 1. Genetic mapping of cauliflower head yield trait
[0028] This invention utilizes the compact cauliflower parent C4101, which has a relatively high single-head weight (approximately 1.25 kg), as a common female parent, and crosses it with the broccoli parent R06 (approximately 0.32 kg per head) and the kale parent J1401 (without a flower head) (see [link to relevant documentation]). Figure 1 Two F2 genetic segregating populations were constructed: CR-F2 (containing 212 individual plants) and CJ-F2 (containing 218 individual plants).
[0029] Genotyping of this population was performed using a previously developed 10K SNP liquid-phase chip for Brassica napus, resulting in two high-density genetic linkage maps containing 3685 (CR-F2) and 3569 (CJ-F2) markers, respectively (see [link to relevant documentation]). Figure 2 The flower head weight phenotype of individual plants in a population is obtained through the corresponding F... 2:3 The average yield of flower heads is used to define the F2 population: that is, the number of F2 plants obtained by self-pollination of each individual plant in two F2 genetic segregating populations. 2:3 System; then through sowing and transplanting, utilizing F 2:3 The average weight of the flower heads from multiple plants (at least 6 plants per line) was used to define the single head weight of the corresponding F2 generation individual plants. Combining phenotypic and genotypic data of individual plants in the populations, and using WinQTL2.5 software, major QTLs were located on chromosome C6 in both the CR-F2 and CJ-F2 populations. Alignment to the HDEM reference genome revealed that the physical locations of these two QTLs were C6:34248283-39724151 (CR-F2) and C6:35002802-38478401 (CJ-F2), respectively. The major QTL physical location in the CJ-F2 population was within the major QTL interval of CR-F2, indicating that this co-located QTL plays a stable regulatory role in the cauliflower flower head weight trait under different genetic backgrounds.
[0030] 2. Development of molecular markers linked to the weight trait of cauliflower heads
[0031] This invention, within the physical region of the HDEM reference genome corresponding to the major QTL loci obtained above, selects SNP loci with genotypic differences based on the resequencing results of the parents and extracts their flanking sequences to develop KASP markers, designing 5 pairs of KASP markers. Through further screening and verification of the genetic population, the KASP marker KCY363, which has good genotyping results and is closely related to the single head weight of cauliflower, was selected as the molecular marker for linkage to the cauliflower head yield trait. The KASP marker KCY363 showed the best genotyping results and the highest correlation with the single head weight phenotype, and was used for rapid and accurate screening of the single head weight phenotype in plants. This SNP is located at position C or A on chromosome C6 of the broccoli HDEM (verson 1.0) reference genome. When the base sequence is mutated from A to C, the corresponding single head weight of cauliflower is significantly increased.
[0032] KASP-labeled primers for KCY363 are as follows:
[0033] The nucleotide sequence (SEQ ID NO.1) of the forward primer FAM (X-axis) is as follows:
[0034] CATCTGATCGTTCGATCTGGAGTGC;
[0035] The nucleotide sequence (SEQ ID NO.2) of the forward primer HEX (Y axis) is as follows:
[0036] CATCTGATCGTTCGATCTGGAGTGA;
[0037] Reverse primer (SEQ ID NO.3):
[0038] TCGATCACTTATGGTTTCTCGG.
[0039] Universal adapter sequences were added to the 5' ends of the two upstream primers, as follows:
[0040] The universal adapter sequence (SEQ ID NO.4) added by the forward primer FAM is:
[0041] GAAGGTGACCAAGTTCATGCT;
[0042] The universal adapter sequence (SEQ ID NO.5) added by the forward primer HEX is:
[0043] GAAGGTCGGAGTCAACGGATT.
[0044] The two forward primers in the above primer pair have a base difference at the 3' end, which can competitively bind to the target site and show corresponding FAM or HEX fluorescence. After signal amplification, the genotype of the target site can be determined.
[0045] Experiment 2: Validation of the KASP marker KCY363 in a segregating population
[0046] 1. Extraction and purification of DNA from the isolated population to be tested
[0047] In the CR-F2 population, individuals with heterozygous target QTL intervals were selected for self-pollination to construct the CR-F2 population. 2:3 Separate populations. One hundred individual plants were randomly selected, and leaves were taken from each plant when it had 1-2 true leaves. DNA was extracted from the leaves using the CTAB method, and the quality and concentration of the DNA were detected using a Nano-400A ultra-micro nucleic acid analyzer.
[0048] 2. Genotyping of individual plants in secondary segregating populations using KCY363
[0049] Add specific KASP Primermix and universal KASP Mastermix to the extracted DNA template and perform PCR amplification.
[0050] The KASP Mastermix contains the following components: universal FRET cassette fluorescent primers, ROX internal control dye, KlearTaq DNA polymerase, dNTPs, and MgCl2.
[0051] The PCR reaction system for KASP detection consisted of: 5 μL of PCR premix, 0.14 μL of KASP primer mixture (with each primer having a final concentration of 5 nM), and 5 μL of 20 ng / μL template DNA.
[0052] The reaction conditions for PCR detection using KASP were: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, annealing and extension at 61–55℃ for 60 s, with the annealing temperature decreasing by 0.6℃ per cycle, for a total of 10 cycles; 94℃ denaturation for 20 s, 55℃ annealing and extension for 60 s, for a total of 26 cycles.
[0053] The results showed that among the 100 individual plants, 27 had the genotype AA, 22 had the genotype CC, and 51 had the genotype AC (see Table 1). Figure 3 ).
[0054] Table 1F 2:3 Genotypes and single bulb weights of 100 individual plants marked with KCY363
[0055]
[0056]
[0057] 3. Genotyping of core germplasm materials using KCY363
[0058] To further verify the universality of the KCY363 marker in identifying the single-head weight trait in cauliflower, 28 core germplasm materials, including cauliflower, were selected from our group. After sowing, seedling cultivation, and numbering, single leaves were collected at the 1-2 true-leaf stage. Genomic DNA was extracted from each plant using the standard CTAB method, and the quality and concentration of the DNA were detected using a Nano-400A ultra-micro nucleic acid analyzer. The DNA was stored at -20℃ for later use. Genotyping of the 28 core germplasm materials was performed using KCY363 primers and the same KASP marker PCR amplification and detection system described above.
[0059] The results showed that the genotype at this locus was AA in 17 samples and CC in 11 samples (see Table 2). Figure 3 ).
[0060] Table 228 Genotypes and Single Globule Weights of KCY363 Markers in Core Germplasm Materials
[0061]
[0062] 4. Determine the "single sphere weight" phenotype of secondary segregating populations and core germplasm materials.
[0063] Determination of CR-F 2:3 The head weight of 100 individual plants in the segregating population, combined with the KCY363 genotype data of each plant, showed that the head weight of AA genotype plants ranged from 0.11 kg to 0.53 kg, with an average of 0.34 kg; while the head weight of CC genotype plants ranged from 0.48 kg to 1.74 kg, with an average of 0.92 kg. t-tests showed a highly significant difference in phenotype between the two different genotypes (P < 0.001), indicating that this marker can be used efficiently and accurately to distinguish head yield in cauliflower.
[0064] Simultaneously, the single-ball weight phenotype of 28 core germplasm materials was measured. Combined with the KCY363 genotype data of each material, the average single-ball weight of the AA genotype materials was 0.33 kg, and the average single-ball weight of the CC genotype materials was 1.10 kg. The t-test showed that there was a highly significant difference between the phenotypes of the two different genotypes (P<0.001), indicating the universality of this marker in distinguishing the single-ball weight trait of cauliflower.
[0065] Although the present invention has been described in detail through the preferred embodiments above, it should be understood that the above description should not be considered as a limitation of the present invention. Various modifications and substitutions to the present invention will be apparent to those skilled in the art after reading the above description. Therefore, the scope of protection of the present invention should be defined by the appended claims.
Claims
1. A primer set of KASP markers linked to the yield traits of cauliflower curds, characterized in that, The primer set includes: forward primer FAM, forward primer HEX, and reverse primer; Among them, the nucleotide sequence of the forward primer FAM is shown as SEQ ID NO.1; The nucleotide sequence of the forward primer HEX is shown as SEQ ID NO.2; The nucleotide sequence of the reverse primer is shown as SEQ ID NO.
3.
2. The primer set according to claim 1, characterized in that, A universal linker sequence shown as SEQ ID NO.4 is added to the 5'-end of the nucleotide sequence of the forward primer FAM.
3. The primer set according to claim 1, wherein A universal linker sequence shown as SEQ ID NO.5 is added to the 5'-end of the nucleotide sequence of the forward primer HEX.
4. A KASP marker kit linked to the yield traits of cauliflower flower heads, characterized in that, The primers in the kit adopt the primer set described in any one of claims 1 to 3.
5. The kit according to claim 4, characterized in that, The components of the PCR premix in the kit include: a universal FRET cassette fluorescent primer, ROX internal reference dye, Klear Taq DNA polymerase, dNTP, and MgCl2.
6. Use of the primer set according to any one of claims 1 to 3 or the kit according to claim 4 or 5, characterized in that The application is: an application in assisting the breeding of cauliflower with different curd yields; Perform PCR using the primer set described in any one of claims 1 to 3 or the kit described in claim 4 or 5, and judge the single curd weight of cauliflower according to the genotyping of the PCR product; If the genotyping of the PCR product is AA, the cauliflower is a cauliflower with a low curd weight; If the genotyping of the PCR product is CC, the cauliflower is a cauliflower with a high curd weight.
7. The application according to claim 6, characterized in that, The reaction system of the PCR is: PCR premix, the primer set described in any one of claims 1 to 3, and template DNA.
8. The application according to claim 6, characterized in that, The reaction conditions of the PCR are: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing and extension at 61 - 55°C for 60 s, with the annealing temperature decreasing by 0.6°C for each cycle, for a total of 10 cycles; denaturation at 94°C for 20 s, annealing and extension at 55°C for 60 s, for a total of 26 cycles.
Citation Information
Patent Citations
SNP locus linked with broccoli ball flower lanatoside character and detecting method and primer set thereof
CN106434906A
SNP marker linked to branch angles of pedicels at bottom parts of cauliflower balls and method and application of SNP marker
CN111793710A