A method for preparing a hierarchical anti-fouling polypeptide chip and application thereof

Abstract

The application discloses a preparation method of a hierarchical structure anti-fouling polypeptide chip and application thereof, and the preparation method comprises the following steps: flowing a zwitterionic polypeptide mixed solution through a chip to form hierarchical structure polypeptides on the surface of the chip; and fixing recognition molecules on the surface of the hierarchical structure polypeptides by using an activated ester method to obtain the hierarchical structure anti-fouling polypeptide chip. The application comprises the following steps: measuring the surface plasmon resonance sensor signal response value of a test solution / standard solution, drawing a standard curve; measuring the surface plasmon resonance sensor signal response value of a sample to be measured, and substituting the response value into the standard curve to obtain / calculating the concentration of the sample to be measured. The application constructs polypeptides with different hierarchical structures on the surface of the chip, and improves the anti-non-specific adsorption interference ability of the surface plasmon resonance sensor by using the anti-fouling characteristics of the hierarchical structure polypeptides and the binding characteristics between antigens and antibodies, so that the problem of non-specific adsorption of proteins in the traditional surface plasmon resonance technology is solved.

Description

Technical Field

[0001] This invention relates to the field of antifouling chip fabrication, specifically to a method for fabricating a hierarchical antifouling polypeptide chip and its application. Background Technology

[0002] Surface plasmon resonance (SPR) is an optical, label-free detection technique. When incident light travels from a high-refractive-index medium to a low-refractive-index medium, total internal reflection occurs. If a thin metal film (gold or silver) is deposited at the interface between the media, the incident light generates an evanescent wave, which causes collective oscillations of free electrons on the metal surface, thus forming plasma. Resonance occurs when the frequency and wavenumber of the evanescent wave match those of the surface plasma oscillations. Biosensors developed based on SPR technology are label-free, highly sensitive, and enable rapid detection, making them ideal tools for food safety and medical diagnosis.

[0003] However, food and biological sample matrices are complex, and components such as proteins or polysaccharides can easily and non-specifically adsorb onto the sensor chip surface, causing severe signal interference, affecting target identification, reducing sensor accuracy and sensitivity, and leading to false positives. Furthermore, most experiments require complex sample pretreatment, further reducing sensor detection efficiency. Therefore, developing efficient, anti-fouling sensing surfaces is a prerequisite for improving sensor detection efficiency and sensitivity. Summary of the Invention

[0004] To address the problems existing in the prior art, one objective of this invention is to provide a method for preparing a hierarchical antifouling peptide chip that simplifies the sample pretreatment process. The prepared hierarchical antifouling peptide chip exhibits strong resistance to non-specific adsorption interference and high sensitivity.

[0005] Another objective of this invention is to provide the application of the hierarchical antifouling peptide chip prepared by the above method in surface plasmon resonance detection.

[0006] Therefore, the present invention adopts the following technical solution:

[0007] A method for preparing a hierarchical antifouling polypeptide chip, characterized by comprising the following steps:

[0008] Step 1, Immobilization of hierarchical antifouling peptides: A zwitterionic peptide mixture is passed through a chip to form a hierarchical peptide structure on the chip surface, resulting in a chip with a hierarchical peptide structure. The zwitterionic peptide mixture is a mixture of zwitterionic peptides of different chain lengths, tris(2-carboxyethyl)phosphonic acid hydrochloride, and PBS buffer. In the zwitterionic peptide mixture, the concentration of zwitterionic peptides of different chain lengths is 0.4–1 mg / mL, and the concentration of tris(2-carboxyethyl)phosphonic acid hydrochloride is 2–4 mg / mL.

[0009] Step 2, coupling recognition molecules: The EDC / NHS mixed solution is passed through a chip with a hierarchical structure peptide, and then a solution with specific recognition molecules is passed through the chip through which the EDC / NHS mixed solution has passed. The specific recognition molecules are immobilized on the surface of the hierarchical structure peptide using the activated ester method to obtain a hierarchical structure antifouling peptide chip, wherein the recognition molecules are antigens, antibodies or aptamers.

[0010] In step 1, the zwitterionic polypeptides of different chain lengths are two or three of CKEKE (CKE2) to CKEKEKEKEKEKEKEKEKE (CKE8); or two or three of CEKEK (CEK2) to CEKEKEKEKEKEKEKEKE (CEK8); or two or three of KEKEC (KE2C) to KEKEKEKEKEKEKEKEC (KE8C); or two or three of EKEKC (EK2C) to EKEKEKEKEKEKEKEKEKC (EK8C); wherein C is cysteine, K is lysine, and E is glutamic acid.

[0011] In step 2, the concentration of antigen and antibody in the solution with specific recognition function is 5-20 μg / mL, and the concentration of aptamer is 20-50 nmol / L. The solution with specific recognition function is a PBS solution of antigen, antibody, or aptamer.

[0012] In step 2, the molar ratio of EDC to NHS in the EDC / NHS mixed solution is (1-4):1.

[0013] In step 1, the chip is a bare gold chip.

[0014] The flow rate of zwitterionic peptide mixtures, EDC / NHS mixtures, and solutions with specific recognition functions through the chip is 5–20 μL / min, and the flow time is 5–20 min.

[0015] The application of the hierarchical antifouling peptide chip obtained by the preparation method in surface plasmon resonance detection includes the following steps:

[0016] S1, Mix the target analyte with PBS buffer to obtain a standard sample stock solution, wherein the concentration of the target analyte in the standard sample stock solution is 0.1-1 mg / mL;

[0017] S2, Measure the surface plasmon resonance sensor signal response values ​​of test solutions / standard stock solutions with different target analyte concentrations, plot the standard curve, and perform polynomial curve fitting to obtain the equation of the regression curve.

[0018] When the target analyte is a small molecule, the standard sample stock solution is mixed with PBS buffer to prepare a standard stock solution. The standard stock solution is then mixed with its corresponding recognition molecule to obtain a test solution.

[0019] When the target analyte is not a small molecule, the standard sample stock solution is mixed with PBS buffer to prepare the standard stock solution;

[0020] S3, when the analyte is a small molecule, the unknown amount of the analyte and its corresponding recognition molecule are mixed to obtain the sample to be tested. The surface plasmon resonance sensor signal response value of the sample to be tested is measured, and the response value is substituted into the standard curve to obtain the concentration of the analyte in the sample to be tested. When the analyte is not a small molecule, the sample to be tested with an unknown amount of analyte is directly injected for testing, the surface plasmon resonance sensor signal response value is obtained, and the response value is substituted into the standard curve to obtain the concentration of the analyte.

[0021] After the test, the hierarchical antifouling peptide chip is eluted with a regeneration solution, thus realizing both the detection of the analyte and chip regeneration.

[0022] Preferably, the regenerated solution is a hydrochloric acid solution with a concentration of 0.01-0.02 mol / L.

[0023] Compared with the prior art, the present invention has the following advantages:

[0024] (1) The present invention constructs polypeptides with different hierarchical structures on the chip surface. By utilizing the anti-fouling properties of the hierarchical structure polypeptides and the binding characteristics between antigens and antibodies, the surface plasmon resonance sensor’s ability to resist non-specific adsorption interference is improved, effectively simplifying the sample pretreatment process and solving the problem of non-specific protein adsorption in traditional surface plasmon resonance technology.

[0025] (2) This invention achieves highly sensitive and rapid detection of analytes in food or biological matrix by binding antigens, antibodies or aptamers to PBS solutions on a chip;

[0026] (3) The present invention can remove the analyte bonded to the surface of the surface plasmon resonance sensor by means of regeneration liquid elution, thereby realizing the reuse of the surface plasmon resonance sensor. Attached Figure Description

[0027] Figure 1 This is a schematic diagram illustrating the preparation method and application of the hierarchical antifouling polypeptide chip in Example 1.

[0028] Figure 2 The bar chart shows the surface plasmon resonance sensor signal response values ​​induced by BSA (left) and lysozyme (right) in Comparative Example 1, Comparative Example 2, and Example 1.

[0029] Figure 3 This is the standard curve for peanut allergen in Example 1. Detailed Implementation

[0030] The technical solution of the present invention will be described in detail below with reference to the accompanying drawings and embodiments.

[0031] In the following examples, C in CKEKE (CKE2) and CKEKEKEKE (CKE4) represents cysteine, K represents lysine, and E represents glutamic acid; the chip used is a bare gold chip; the molar ratio of EDC (1-ethyl-(3-dimethylaminopropyl)carbodiimide) to NHS (N-hydroxysuccinimide) in the EDC / NHS mixed solution is 4:1.

[0032] In the following examples, the PBS buffer was 0.01 mol / L and the pH was 7.4.

[0033] Example 1

[0034] In this embodiment, peanut allergens in typical foods are selected as the detection target; peanut antibodies, namely hierarchical structured polypeptides-peanut antibodies, are selected as the recognition molecules; and peanut allergens are selected as the antigens.

[0035] The method for preparing the hierarchical antifouling peptide chip in this embodiment includes the following steps:

[0036] Step 1, Immobilization of hierarchical antifouling peptides:

[0037] First, zwitterionic peptides CKEKE (CKE2) and CKEKEKEKE (CKE4) of different chain lengths were mixed with tris(2-carboxyethyl)phosphonic acid hydrochloride and PBS buffer to obtain a zwitterionic peptide mixture. In the zwitterionic peptide mixture, the concentrations of CKE2 and CKE4 were 0.4 mg / mL, and the concentration of tris(2-carboxyethyl)phosphonic acid hydrochloride was 4 mg / mL. The zwitterionic peptide mixture was then flowed online through a chip at a rate of 10 μL / min for 10 min to modify the chip surface, resulting in a chip with a hierarchical peptide structure.

[0038] Step 2, Couple recognition molecules:

[0039] Inject the EDC / NHS mixed solution at a flow rate of 5 μL / min for 20 min, allowing it to flow through the chip in step 1 to activate the carboxyl groups on the surface of the hierarchical peptides;

[0040] Then, a PBS solution containing peanut antibody with specific recognition function is injected at a rate of 5 μL / min for 20 min to couple the peanut antibody to the surface of the hierarchical structure peptide. The concentration of peanut antibody in the PBS solution is 10 μg / mL.

[0041] Finally, the chip was blocked with ethanolamine at pH 8.5 to obtain a hierarchical antifouling peptide chip.

[0042] The antifouling resistance of the surface of the above-mentioned hierarchical antifouling peptide chip was evaluated:

[0043] A 1 mg / mL contaminant protein solution was prepared using PBS buffer and contaminant protein. BSA (bovine serum albumin) and lysozyme were used as the contaminant proteins. The BSA and lysozyme solutions were flowed through the hierarchical antifouling peptide chip prepared in step 2 at a flow rate of 20 μL / min for 5 min each. Changes in the surface plasmon resonance sensor signal response values ​​induced by BSA and lysozyme were recorded to confirm the antifouling performance of the hierarchical antifouling peptide chip. The detection results are as follows: Figure 2 As shown.

[0044] As can be seen from the figure, the response value of the hierarchical antifouling peptide chip prepared in this embodiment with BSA as the pollutant protein is 3.5 ng / cm. 2 This proves that the chip has good anti-fouling properties.

[0045] The application of the hierarchical antifouling peptide chip prepared by the above method in surface plasmon resonance detection includes the following steps:

[0046] S1, mix peanut allergen (non-small molecule) and PBS buffer to prepare a standard sample stock solution with a concentration of 1 mg / mL;

[0047] S2, the standard sample stock solution is mixed with PBS buffer to prepare standard stock solutions with concentrations of 0.1, 0.5, 1, 5, 10, and 20 μg / mL. Each standard stock solution is continuously injected at a flow rate of 20 μL / min for 5 minutes to ensure sufficient layering of the hierarchical structure. The changes in the response signal of the surface plasmon resonance sensor are recorded. As the peanut concentration changes, the response value also changes. The relationship between peanut concentration and its response value is recorded, a standard curve is plotted, and curve fitting is performed to obtain the curve equation.

[0048] S3. The unknown amount of peanut allergen test sample (confirmed) is injected continuously at a flow rate of 20 μL / min for 5 minutes. The response value of the surface plasmon resonance sensor is recorded, and this response value is substituted into the standard curve to obtain the test concentration of peanut allergen.

[0049] Preferably, a hydrochloric acid solution with a concentration of 0.01 mol / L (pH 1.2) is introduced to wash away the peanut allergens remaining on the surface of the hierarchical anti-fouling polypeptide chip, thereby completing the regeneration of the sensor chip.

[0050] Example 2

[0051] Gentamicin was selected as the antibiotic to be tested. The selected recognition molecule was the gentamicin coating agent, namely bovine serum albumin-gentamicin. The selected antibody was a gentamicin antibody.

[0052] The method for preparing the hierarchical antifouling peptide chip in this embodiment includes the following steps:

[0053] Step 1, Immobilization of hierarchical antifouling peptides: This step is the same as Step 1 in Example 1.

[0054] Step 2, Couple recognition molecules:

[0055] An EDC / NHS mixed solution was injected at a flow rate of 5 μL / min to flow through the chip in step 1 to activate the carboxyl groups on the surface of the hierarchical structure peptides for 20 min. Then, a PBS solution containing gentamicin coating agent (i.e., a solution with specific recognition function) was injected at a flow rate of 5 μL / min for 20 min to couple the gentamicin coating agent to the surface of the hierarchical structure peptides. The concentration of the gentamicin coating agent in the PBS solution was 10 μg / mL. Finally, the chip was blocked with ethanolamine at pH 8.5 to obtain the hierarchical structure antifouling peptide chip.

[0056] The antifouling resistance of the surface of the above-mentioned hierarchical antifouling peptide chip was evaluated:

[0057] The specific method is the same as in Example 1.

[0058] Testing showed that the hierarchical antifouling peptide chip prepared in this embodiment had a response value of 3.9 ng / cm³ when BSA was used as the pollutant protein. 2 This proves that the chip has good anti-fouling properties.

[0059] The application of the above-mentioned hierarchical antifouling peptide chip in surface plasmon resonance detection includes the following steps:

[0060] S1. Mix 10 mg of gentamicin (small molecule) with PBS buffer (0.01 mol / L, pH 7.4) and bring the volume to 10 mL to obtain the standard sample stock solution.

[0061] S2, the standard sample stock solution is mixed with PBS buffer to prepare a standard stock solution with a concentration of 100 ng / mL. Different volumes of this standard stock solution are mixed with gentamicin antibody (100 μg / mL, 10 μL) and diluted to 100 μL with PBS buffer to obtain test solutions with gentamicin concentrations of 0, 1, 2.5, 5, 7.5, and 10 ng / mL. The test solutions are continuously injected at a flow rate of 20 μL / min for 5 minutes to ensure that the test solutions are fully integrated with the hierarchical antifouling peptide chip of Example 2. The changes in the response signal of the surface plasmon resonance sensor are recorded. As the concentration of gentamicin changes, the response value also changes. The relationship between the concentration of gentamicin and its response value is recorded, a standard curve is plotted, and polynomial curve fitting is performed to obtain the regression curve equation.

[0062] S3. Add the unknown amount of gentamicin sample solution to gentamicin antibody (100 μg / mL, 10 μL) and mix to 100 μL to obtain the test sample. Inject continuously at a flow rate of 20 μL / min for 5 minutes, record the response value of the surface plasmon resonance sensor, and substitute this response value into the standard curve to obtain the concentration of gentamicin in the test sample.

[0063] Preferably, a hydrochloric acid solution with a concentration of 0.01 mol / L (pH 1.2) is introduced to elute the gentamicin antibody remaining on the surface of the hierarchical antifouling polypeptide chip, thereby completing the regeneration of the sensor chip.

[0064] In this embodiment, 10 μL of gentamicin antibody was added in excess. The specific excess amount of gentamicin antibody relative to the antigen was determined based on experience.

[0065] Example 3

[0066] In this embodiment, β-lactoglobulin is used as the detection target; β-lactoglobulin aptamer is used as the recognition molecule; and the nucleic acid sequence 5′-NH2-C6-CGACGATCGGACCGCAGTACCCACCCACCAGCCCCAACATCATGCCCATCCGT GTGTG-3′ is used as the recognition molecule.

[0067] The method for preparing the hierarchical antifouling peptide chip in this embodiment includes the following steps:

[0068] Step 1, Immobilization of hierarchical antifouling peptides: This step is the same as Step 1 in Example 1.

[0069] Step 2, Couple recognition molecules:

[0070] An EDC / NHS mixed solution was injected at a flow rate of 5 μL / min through the chip in step 1 to activate the carboxyl groups on the surface of the hierarchical structure peptides for 20 min. Then, a solution with specific recognition function (PBS solution of β-lactoglobulin aptamer) was injected at a rate of 5 μL / min for 20 min to couple the aptamer to the surface of the hierarchical structure peptides (the aptamer was directly modified on the chip surface). The concentration of β-lactoglobulin aptamer (recognition molecule) in the PBS solution was 50 nmol / L. Finally, the chip was blocked with ethanolamine at pH 8.5 to obtain the hierarchical structure antifouling peptide chip.

[0071] The antifouling resistance of the surface of the above-mentioned hierarchical antifouling peptide chip was evaluated:

[0072] The specific method is the same as in Example 1.

[0073] Testing showed that the hierarchical antifouling peptide chip prepared in this embodiment had a response value of 4.2 ng / cm³ when BSA was used as the pollutant protein. 2 This indicates that the hierarchical structure antifouling peptide chip has a good antifouling effect.

[0074] The application of the above-mentioned hierarchical antifouling peptide chip in surface plasmon resonance detection includes the following steps:

[0075] S1, mix β-lactoglobulin (non-small molecule) and PBS buffer to prepare a standard sample stock solution with a concentration of 1 mg / mL;

[0076] S2, standard sample stock solutions were mixed with PBS buffer to prepare standard stock solutions with concentrations of 0.1, 0.5, 1, 5, 10, and 20 μg / mL. Each standard stock solution was continuously injected at a flow rate of 20 μL / min for 5 minutes to ensure sufficient integration of the standard stock solution with the hierarchical antifouling peptide chip of Example 3. Changes in the response signal of the surface plasmon resonance sensor were recorded. As the concentration of β-lactoglobulin changed, the response value also changed. The relationship between the concentration of β-lactoglobulin and its response value was recorded, a standard curve was plotted, and polynomial curve fitting was performed to obtain the regression curve equation.

[0077] S3. The unknown amount of β-lactoglobulin sample to be tested is continuously injected at a flow rate of 20 μL / min for 5 minutes. The response value of the surface plasmon resonance sensor is recorded, and this response value is substituted into the standard curve to obtain the test concentration of β-lactoglobulin.

[0078] Preferably, a hydrochloric acid solution with a concentration of 0.01 mol / L (pH 1.2) is introduced to elute the β-lactoglobulin remaining on the surface of the hierarchical anti-fouling polypeptide chip, thereby completing the regeneration of the sensor chip.

[0079] Comparative Example 1

[0080] The preparation method of a hierarchical antifouling peptide chip is basically the same as that in Example 1, except that the concentration of zwitterionic peptide in the zwitterionic peptide mixture in this comparative example is 0.4 mg / mL, and the zwitterionic peptide is CKEKE (CKE2).

[0081] Depend on Figure 2 It can be seen that the surface plasmon resonance sensor signal response value induced by BSA as the contaminant protein in Comparative Example 1 is 16.7 ng / cm. 2 The response value was larger than that of Example 1, and the antifouling performance of CKEKE was significantly weaker than that of the zwitterionic peptides (CKEKE and CKEKEKEKE) in Examples 1-3.

[0082] Comparative Example 2

[0083] The preparation method of a hierarchical antifouling peptide chip is basically the same as that in Example 1, except that the concentration of zwitterionic peptide in the zwitterionic peptide mixture in this comparative example is 0.4 mg / mL, and the zwitterionic peptide is CKEKEKEKE (CKE4).

[0084] Depend on Figure 2 It can be seen that the surface plasmon resonance sensor signal response value induced by BSA as the contaminant protein in Comparative Example 2 is 10.9 ng / cm². 2 The response value was larger than that of Example 1, and the antifouling performance of CKEKEKEKE was significantly weaker than that of the zwitterionic peptides (CKEKE and CKEKEKEKE) in Examples 1-3.

[0085] For the sake of accuracy and convenience, this invention uses peanut allergens as an example for detailed description in the embodiments. However, this invention is also applicable to other harmful substances in food, such as pesticide and veterinary drug residues, and the analysis and detection of disease markers in biomedical matrices. Therefore, the above-mentioned contents are all within the protection scope of this invention. Furthermore, sample testing according to the method of Example 1 simplifies the sample pretreatment process compared to existing surface plasmon resonance (SPR) detection technology, increases detection efficiency by more than 2 times, reduces detection costs by more than 2 times, and allows the chip to be reused dozens of times. The method of this invention solves the problem of reduced sensitivity caused by interference from other impurities in traditional SPR sensors, and can be used for the detection of peanut allergens, antibiotics, and other substances.

Claims

1. A method for preparing a hierarchical structure antifouling polypeptide chip, characterized in that, Includes the following steps: Step 1, Immobilization of hierarchical antifouling peptides: A zwitterionic peptide mixture is passed through a chip to form a hierarchical peptide structure on the chip surface, resulting in a chip with a hierarchical peptide structure. The zwitterionic peptide mixture is a mixture of zwitterionic peptides of different chain lengths, tris(2-carboxyethyl)phosphonic acid hydrochloride, and PBS buffer. In the zwitterionic peptide mixture, the concentration of zwitterionic peptides of different chain lengths is 0.4–1 mg / mL, and the concentration of tris(2-carboxyethyl)phosphonic acid hydrochloride is 2–4 mg / mL. Step 2, coupling recognition molecules: The EDC / NHS mixed solution is passed through a chip with a hierarchical structure peptide, and then a solution with specific recognition molecules is passed through the chip through which the EDC / NHS mixed solution has passed. The specific recognition molecules are immobilized on the surface of the hierarchical structure peptide using the activated ester method to obtain a hierarchical structure antifouling peptide chip, wherein the recognition molecules are antigens, antibodies or aptamers.

2. The method according to claim 1, characterized in that, In step 1, the zwitterionic polypeptides of different chain lengths are two or three of the following: CKEKE~CKEKEKEKEKEKEKEKEKE; or CEKEK~ Two or three of CEKEKEKEKEKEKEK; or two or three of KEKEC~KEKEKEKEKEKEKEKEC; or two or three of EKEKC~EKEKEKEKEKEKEKEKC; wherein C is cysteine, K is lysine, and E is glutamic acid.

3. The preparation method according to claim 1, characterized in that, In step 2, the concentration of antigen and antibody in the solution with specific recognition function is 5-20 μg / mL, and the concentration of aptamer is 20-50 nmol / L. The solution with specific recognition function is a PBS solution of antigen, antibody, or aptamer.

4. The preparation method according to claim 1, characterized in that, In step 2, the molar ratio of EDC to NHS in the EDC / NHS mixed solution is (1-4):

1.

5. The preparation method according to claim 1, characterized in that, In step 1, the chip is a bare gold chip.

6. The preparation method according to claim 1, characterized in that, The flow rate of zwitterionic peptide mixtures, EDC / NHS mixtures, and solutions with specific recognition functions through the chip is 5–20 μL / min, and the flow time is 5–20 min.

7. The application of the hierarchical structure antifouling polypeptide chip obtained by the preparation method according to any one of claims 1 to 6 in surface plasmon resonance detection.

8. The application according to claim 7, characterized in that, The application includes the following steps: S1, Mix the target analyte with PBS buffer to obtain a standard sample stock solution, wherein the concentration of the target analyte in the standard sample stock solution is 0.1-1 mg / mL; S2, Measure the surface plasmon resonance sensor signal response values ​​of test solutions / standard stock solutions with different target analyte concentrations, plot the standard curve, and perform polynomial curve fitting to obtain the equation of the regression curve. When the target analyte is a small molecule, the standard sample stock solution is mixed with PBS buffer to prepare a standard stock solution. The standard stock solution is then mixed with the antigen, antibody, or aptamer that binds to the recognition molecule to obtain the test solution. When the target analyte is not a small molecule, the standard sample stock solution is mixed with PBS buffer to prepare the standard stock solution; S3, when the analyte is a small molecule, the unknown amount of the analyte and its corresponding recognition molecule are mixed to obtain the sample to be tested. The surface plasmon resonance sensor signal response value of the sample to be tested is measured, and the response value is substituted into the standard curve to obtain the concentration of the analyte in the sample to be tested. When the analyte is not a small molecule, the sample to be tested with an unknown amount of analyte is directly injected for testing, the surface plasmon resonance sensor signal response value is obtained, and the response value is substituted into the standard curve to obtain the concentration of the analyte.

9. The application according to claim 7, characterized in that, After the test, the hierarchical antifouling peptide chip is eluted with a regeneration solution, thus realizing both the detection of the analyte and chip regeneration.

10. The application according to claim 9, characterized in that, The regenerated solution is a hydrochloric acid solution with a concentration of 0.01-0.02 mol / L.

Images