SNP molecular markers associated with lamb size in sheep and their application

Abstract

The present invention discloses a SNP molecular marker related to the lambing number trait of sheep. The SNP molecular marker is a T>G base mutation at the 29461739bp position of chromosome 6 of the sheep genome Oar_v4.0 version. The molecular marker can be applied to the fields of lambing trait selection and breeding of sheep, breeding of high lambing sheep strains, improving the lambing number trait of sheep groups, and evaluating the lambing performance of sheep. In this way, the lambing trait of sheep can be improved, the genetic breeding progress of sheep lambing performance can be accelerated, and the reproductive capacity and production efficiency of sheep can be effectively improved.

Description

Technical Field

[0001] The invention relates to the field of molecular markers and genetic breeding, and in particular to a SNP molecular marker associated with the lambing number trait of sheep and its application in breeding. Background Art

[0002] Mutton is popular among consumers due to its unique flavor, high protein, low cholesterol and other advantages. In recent years, the shortage of sheep products, mainly mutton, has led to an upward trend in the price of mutton in my country. The contradiction between the rapid increase in demand for mutton in my country and the low production capacity of mutton has become increasingly prominent. Therefore, improving the reproductive performance of ewes and mutton production has become a major industrial demand at this stage. One lamb per litter is the biggest bottleneck limiting the productivity of ewes, and increasing the number of lambs is the most direct way to increase mutton production. The number of lambs is the most important economic trait of sheep, and it is a low-heritability limited trait that is difficult to improve quickly using conventional breeding techniques. Molecular marker-assisted breeding is suitable for improving the trait of lamb number. Therefore, it is urgent to find new SNP molecular markers related to the trait of lamb number in sheep and apply them to the genetic improvement of the trait of lamb number. Summary of the invention

[0003] The purpose of the present invention is to provide a new SNP molecular marker related to the lamb number trait of sheep, and to apply the marker to sheep breeding and genetic improvement.

[0004] According to the first aspect of the present invention, a SNP molecular marker related to the lambing number trait of sheep is provided, and the SNP molecular marker is a T>G base mutation at the 29461739bp position of chromosome 6 of the sheep genome Oar_v4.0 version. Therefore, the lambing trait of sheep can be selected and genetically improved by the SNP molecular marker to improve the lambing performance of sheep, accelerate the genetic selection and breeding progress of lambing performance of sheep, and effectively improve the reproductive efficiency of sheep.

[0005] According to a second aspect of the present invention, there is provided an application of a SNP molecular marker for improving the lambing number trait of sheep, wherein the SNP molecular marker is a T>G base mutation at the 29461739bp position of chromosome 6 of the sheep genome Oar_v4.0 version. Thus, the lambing performance of sheep can be effectively improved through the application, and the reproductive efficiency of sheep can be improved.

[0006] In some embodiments, the application comprises the following steps:

[0007] 1) Detecting the SNP molecular markers in the reserve ewes;

[0008] 2) Selecting the individuals with the GG genotype detected in step 1) as breeding ewes and eliminating the individuals with the TG and TT genotypes can effectively increase the number of lambs produced by the ewes.

[0009] According to the third aspect of the present invention, there is provided an application of a SNP molecular marker in breeding a sheep strain with a high lambing number trait, wherein the SNP molecular marker is a T>G base mutation at the 29461739bp position of chromosome 6 of the sheep genome Oar_v4.0 version. Thus, a breeding sheep strain with high lambing performance can be obtained, the lambing number and reproductive efficiency of sheep can be improved, and the economic value of sheep can be improved.

[0010] In some embodiments, the application comprises the following steps:

[0011] 1) Detecting the SNP molecular markers in the reserve ewes;

[0012] 2) selecting the individuals with the GG genotype detected in step 1) as breeding ewes, and breeding the breeding ewes;

[0013] 3) The SNP molecular markers are detected in the ewes born from mating in step 2), the individuals with GG genotype are retained, the individuals with TG and TT genotypes are eliminated, and the individuals are bred again to cultivate a sheep strain with a high lambing number.

[0014] According to the fourth aspect of the present invention, there is provided an application of a SNP molecular marker for improving the lambing number trait of ewes, wherein the SNP molecular marker is a T>G base mutation at the 29461739bp position of chromosome 6 of the sheep genome Oar_v4.0 version. In this way, the lambing performance of sheep can be improved, the genetic breeding progress of lambing performance of sheep can be accelerated, and the production efficiency of high-fertility sheep can be effectively improved.

[0015] In some embodiments, the application comprises the following steps:

[0016] 1) Detecting the SNP molecular markers in the reserve ewes;

[0017] 2) selecting the individuals with the GG genotype detected in step 1) as breeding ewes, and breeding the breeding ewes;

[0018] 3) Detecting the SNP molecular markers in the ewes born from mating in step 2), retaining the GG genotype individuals, breeding and selecting the GG genotype individuals again, retaining the GG genotype individuals in the offspring ewes, eliminating the TG and TT genotypes, so as to increase the frequency of the dominant allele G generation by generation, thereby improving the lambing number trait of the ewe group, and improving the lambing number and fertility of the offspring ewe group.

[0019] According to a fifth aspect of the present invention, there is provided an application of a SNP molecular marker in evaluating the lambing number trait of ewes, wherein the SNP molecular marker is a T>G base mutation at the 29461739bp position of chromosome 6 of the sheep genome Oar_v4.0 version. Compared with the current KASP genotyping method, when evaluating the lambing performance of sheep for non-diagnostic purposes, this scheme only needs to detect the genotype of the sheep to be tested, and has the outstanding advantages of being simple, fast, highly sensitive and specific.

[0020] In some embodiments, the application includes the following steps: detecting the SNP molecular markers in the ewe to be evaluated, when the detected genotype is GG, the ewe to be evaluated has high lambing performance; when the genotype is TG and TT, the ewe to be evaluated has low lambing performance.

[0021] According to a sixth aspect of the present invention, there is provided an application of a SNP molecular marker for screening the trait of lamb number in ewes, wherein the SNP molecular marker is a T>G base mutation at the 29461739bp position of chromosome 6 in the sheep genome Oar_v4.0 version. Thus, by genotyping the molecular marker gene, ewes with high lambing performance can be screened simply, quickly and efficiently.

[0022] In certain embodiments, the application comprises the following steps: detecting the SNP molecular markers in the ewe to be screened; when the detected genotype is GG, the lambing performance of the ewe to be screened is high and is retained as a reserve ewe; when the genotype is TG and TT, the lambing performance of the ewe to be screened is low and is eliminated.

[0023] According to the seventh aspect of the present invention, a nucleotide sequence containing a SNP molecular marker related to the lamb number trait of sheep is provided, the sequence containing the nucleotide sequence shown in SEQ ID No: 1, and M in the sequence represents a T>G base mutation. Thus, through the sequence, the detection primer of the molecular marker can be efficiently and conveniently designed, and the molecular marker can be detected to determine the genotype of the site of the ewe to be detected, and the dominant genotype can be screened.

[0024] According to the eighth aspect of the present invention, there is provided an application of a nucleotide sequence containing a SNP molecular marker associated with the sheep lamb number trait in the preparation of a SNP molecular marker product for detecting the sheep lamb number trait, wherein the sequence contains a nucleotide sequence as shown in SEQ ID No: 1, and M in the sequence represents a T>G base mutation. Thus, through this application, the detection primers of the SNP molecular marker can be efficiently and conveniently designed, and the molecular marker can be detected to determine the genotype of the site of the ewe to be detected, and the dominant genotype can be screened.

[0025] According to the ninth aspect of the present invention, there is provided a primer for detecting SNP molecular markers for use in sheep lambing trait selection, wherein the primer sequences are shown in SEQ ID No: 2 and SEQ ID No: 3. Thus, the molecular marker can be efficiently detected by the primer, and the genotype of the site of the ewe to be detected can be determined, and the dominant genotype can be screened.

[0026] Beneficial effects of the present invention:

[0027] 1. A SNP molecular marker related to the lamb number trait of sheep is provided. The dominant allele G of the SNP molecular marker can accelerate the genetic breeding progress of sheep lambing performance through the selection and breeding of this molecular marker, and effectively improve the production efficiency of high-fertility sheep.

[0028] 2. SNP molecular markers related to the lamb number trait of sheep are used in the breeding of sheep lambing traits, effectively improving the lambing performance of sheep and improving the reproductive efficiency of sheep.

[0029] 3. The SNP molecular markers related to the sheep lamb number trait are used to breed high lamb number sheep strains, which can obtain breeding sheep strains with high lamb production performance, improve the lamb number and reproductive efficiency of sheep, and improve the economic value of sheep.

[0030] 4. The SNP molecular markers related to the lamb number trait of sheep are used to improve the lamb number trait of sheep populations, which can improve the lambing performance of sheep, accelerate the progress of genetic selection and breeding of lambing performance of sheep, and effectively improve the production efficiency of high-fertility sheep.

[0031] 5. When SNP molecular markers related to the lamb number trait of sheep are used to evaluate the lambing performance of sheep, compared with the current KASP genotyping method, when evaluating the lambing performance of sheep for non-diagnostic purposes, this scheme only needs to detect the genotype of the sheep to be tested, which has the outstanding advantages of being simple, fast, highly sensitive and specific.

[0032] 6. Contains the nucleotide sequence of the SNP molecular marker related to the lamb number trait of sheep. Through this sequence, the detection primer of the molecular marker can be designed efficiently and conveniently. By detecting the molecular marker, the genotype of the site of the ewe to be tested can be determined and the dominant genotype can be screened.

[0033] 7. When primers for detecting SNP molecular markers are used for sheep lambing trait breeding, they can quickly, efficiently and accurately detect sheep genotypes in order to screen out dominant genotypes. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 It is the scatter plot of KASP typing markers of g.29461739T>G SNPs;

[0035] Figure 2 It is the scatter plot of KASP typing markers of g.29461868G>A SNPs;

[0036] Figure 3 It is the scatter plot of KASP typing markers of g.29315643A>G SNPs;

[0037] Figure 4 This is a hybrid map of three-way hybrid sheep. DETAILED DESCRIPTION

[0038] The invention will be further described in detail below in conjunction with the accompanying drawings.

[0039] Example 1: Association analysis between lamb number trait and SNP in sheep

[0040] The experimental animals in this study were derived from the Sanyuan hybrid sheep of Inner Mongolia Dumei Animal Husbandry Biotechnology Co., Ltd. in Zhalaid Banner, Xing'an League. The Sanyuan hybrid sheep were obtained by crossing the East Frisian sheep as the male parent and the Small Tailed Han sheep as the female parent to obtain the F1 generation, and then the F1 generation ram was used as the male parent and the Hu sheep as the female parent to obtain the F2 generation, which is the Sanyuan hybrid sheep (such as Figure 4 The three-way hybrid sheep has the genetic advantages of three high-fertility breeds at home and abroad (25% of East Frisian sheep, 25% of Small Tail Han sheep, and 50% of Hu sheep). The number of lambs born by ewes (250) in the three-way hybrid sheep with more than 2 litters was recorded, and blood samples were taken from the ewes to extract DNA for subsequent research.

[0041] 1. PCR amplification:

[0042] The PCR amplification reaction system was 20 μL: mixed DNA template, 0.5 μL of upstream and downstream primers, 10 μL of 2×Taq PCR MasterMix, 8 μL of DDH2O, and PCR amplification conditions: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 30 s, annealing for 30 s (annealing temperature see Table 1), extension at 72°C for 1 min, for a total of 34 cycles; finally extension at 72°C for 5 min and storage at 4°C.

[0043] 2. Primer design

[0044] Primers were designed based on the published sheep genome reference sequence in the NCBI database, and specific amplification primers were designed using PrimerPremier 5.0 (Table 1). The primers were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0045] Table 1 Primer sequence list

[0046]

[0047] 3. First generation sequencing results of PCR products

[0048] Three SNP sites were found by sequencing. Among them, with reference to the sheep genome Oar_v4.0 version sequence published in NCBI, the three SNP sites were located at the T>G mutation at the 29461739bp position of chromosome 6 (hereinafter referred to as "g.29461739T>G"), the G>A mutation at the 29461868bp position of chromosome 6 (hereinafter referred to as "g.29461868G>A"), and the A>G mutation at the 29315643bp position of chromosome 6 (hereinafter referred to as "g.29315643A>G").

[0049] 4. Genotyping:

[0050] This study used competitive allele-specific PCR (KASP) technology for typing. KASP genotyping was completed by Sichuan JELAME Technology Co., Ltd. and BIO-RAD instrument. The primers were synthesized by Guangzhou GOOD Biotechnology Co., Ltd. The specific primer information is shown in Table 2.

[0051] Table 2 KASP primer information of three SNP sites

[0052]

[0053]

[0054] Prerequisites for genotyping: The sample DNA concentration was homogenized, and ordinary PCR was performed to find the optimal primer temperature for the next experiment. KASP genotyping reaction system (10 μL): 3 ul DNA template, 5 μL FLU-ARMS 2×Mix, 0.5 μL upstream and downstream primers, 1.5 μL DDH2O, and KASP amplification used a two-step touchdown PCR: first, pre-denaturation at 94°C for 15 min; then, touchdown PCR was run with a program of 94°C denaturation for 20 s, 65°C annealing for 60 s, for a total of 10 cycles (starting from the second cycle, each cycle decreased by 0.6°C); then, ordinary PCR reaction was performed with a program of 94°C denaturation for 20 s, 57°C annealing for 60 s, for a total of 30 cycles; finally, it was stored at 4°C.

[0055] The scatter plot results of KASP genotyping markers are as follows Figure 1-3 As shown: Figure 1 Scatter plot showing g.29461739T>G typing markers, where yellow circles represent TT genotype, green triangles represent TG genotype, blue squares represent GG genotype, and black diamonds represent blank control group; Figure 2Scatter plot representing the g.29461868G>A typing markers, where the yellow circle represents the GG genotype, the green triangle represents the AG genotype, the blue square represents the AA genotype, and the black diamond represents the blank control group; Figure 3 Scatter plot showing g.29315643A>G typing markers, where yellow circles represent AA genotype, green triangles represent AG genotype, blue squares represent GG genotype, and black diamonds represent the blank control group.

[0056] The obtained lambing number trait records of Sanyuan hybrid sheep were associated with the above three SNP loci. The base type frequency, allele frequency, heterozygosity (He), polymorphic information content (PIC), effective number of alleles (Ne) and other parameters of the three SNP loci of Sanyuan hybrid sheep were calculated using Microsoft Excel 2019 software, and the Hardy-Weinberg equilibrium state of the SNP loci in this population was detected by chi-square test. When P>0.05, it was considered to be in Hardy-Weinberg equilibrium.

[0057] 5. Population genetics analysis

[0058] The results of population genetics analysis of the three SNP loci are shown in Tables 3-5: Table 3 shows the population genetic parameters of the g.29461739T>G locus. The results show that the g.29461739T>G locus has three genotypes, TT, TG, and GG, in the Sanyuan hybrid sheep population; the heterozygosity distribution of the SNPs locus is 0.506, and the g.29461739T>G locus has a higher heterozygosity in the Sanyuan hybrid sheep population, indicating that the above locus has a higher genetic variation and a large selection potential; the number of effective alleles is 1.973, indicating that the alleles are evenly distributed in the population (1<NeS2)。g.29461739T> The G SNP locus was highly polymorphic in the three-way hybrid sheep population (P>0.05). In addition, the g.29461739T>G locus was in Hardy-Weinberg equilibrium in the three-way hybrid sheep population (P>0.05), which can be used for subsequent correlation analysis with the number of lambs.

[0059] Table 3g. Population genetic parameters of 29461739T>G locus

[0060]

[0061] Table 4 shows the population genetic parameters of the g.29461868G>A locus. The results show that the g.29461868G>A locus has three genotypes: AA, GA, and GG in the Sanyuan hybrid sheep population; the SNPs locus heterozygosity distribution is 0.503, and the g.29461868G>A locus has a higher heterozygosity in the Sanyuan hybrid sheep population, indicating that the above locus has a higher genetic variation and a large selection potential; the effective allele number is 1.985, indicating that the allele is evenly distributed in the population (1<NeS2)。g.29461868G> The A SNP locus was highly polymorphic in the three-way hybrid sheep population (P>0.05). In addition, the g.29461868G>A locus was in Hardy-Weinberg equilibrium in the three-way hybrid sheep population (P>0.05), which can be used for subsequent correlation analysis with the number of lambs.

[0062] Table 4g. Population genetic parameters of the 29461868G>A locus

[0063]

[0064] Table 5 shows the population genetic parameters of the g.29315643A>G locus. The results show that the g.29315643A>G locus has three genotypes: AA, GA, and GG in the Sanyuan hybrid sheep population; the SNPs locus heterozygosity distribution is 0.545, and the g.29315643A>G locus has a higher heterozygosity in the Sanyuan hybrid sheep population, indicating that the above locus has a higher genetic variation and a large selection potential; the effective allele number is 1.834, indicating that the allele is evenly distributed in the population (1<NeS2)。g.29315643A> The G SNP locus was highly polymorphic in the three-way hybrid sheep population (P>0.05). In addition, the g.29315643A>G locus was in Hardy-Weinberg equilibrium in the three-way hybrid sheep population (P>0.05), which can be used for subsequent correlation analysis with the number of lambs.

[0065] Table 5g. Population genetic parameters of the 29315643A>G locus

[0066]

[0067] 6. Correlation analysis with the number of lambs born by sheep:

[0068] The general linear model (One-way ANOVA) in SPSS26.0 was used to conduct the association analysis between SNP and lambing number in three-way hybrid sheep. The model of lambing trait is as follows: Y ij k=u+LS i +G j +e ijkAmong them, Y ij k is the phenotypic value of lambing size, u is the population mean, LS i is the fixed effect of lambing size, G j is the fixed effect of genotype, e ijk Refers to random residuals. The data are expressed as mean ± standard error, and the results are shown in Table 6-8:

[0069] Table 6 shows the results of the association analysis between the g.29461739T>G locus and the number of lambs. As shown in Table 6, the results show that the genotypes of the g.29461739T>G marker are significantly different from the number of lambs (P<0.05). Among them, the number of lambs born by ewes with the GG genotype is significantly higher than that of the TT and TG genotypes (P<0.05), among which the number of lambs per litter of the GG genotype is 0.416 more than that of the TG genotype, and 0.143 more than that of the TT genotype. However, there is no significant difference between the TG genotype and the TT genotype (P>0.05). This shows that the G allele at this locus is the dominant allele for increasing the number of lambs, and the GG genotype is the dominant genotype. Therefore, the g.29461739T>G marker can be used for the subsequent breeding of the number of lambs.

[0070] Table 6g.29461739T>G SNPs and the results of association analysis on the number of lambs

[0071]

[0072] Note: Data with different letters on the shoulders indicate significant differences (P<0.05); data with the same letters on the shoulders indicate no significant differences (P>0.05).

[0073] Table 7 shows the results of the association analysis between the g.29461868G>A locus and the number of lambs. As shown in Table 7, there is no significant difference between the genotypes of the g.29461868G>A marker and the number of lambs (P>0.05). Therefore, the g.29461868G>A marker is not suitable for subsequent breeding of the number of lambs.

[0074] Table 7g.29461868G>A SNPs and the results of association analysis on the number of lambs

[0075]

[0076] Note: Data with different letters on the shoulders indicate significant differences (P<0.05); data with the same letters on the shoulders indicate no significant differences (P>0.05).

[0077] Table 8 shows the results of the association analysis between the g.29315643A>G locus and the number of lambs. As shown in Table 8, there is no significant difference between the genotypes of the g.29315643A>G marker and the number of lambs (P>0.05). Therefore, the g.29315643A>G marker is not suitable for subsequent breeding of the number of lambs.

[0078] Table 8g.29315643A>G SNPs and the results of association analysis on the number of lambs

[0079]

[0080] Note: Data with different letters on the shoulders indicate significant differences (P<0.05); data with the same letters on the shoulders indicate no significant differences (P>0.05).

[0081] In summary, according to the results of association analysis between the three SNPs and the trait of lambing number in Tables 6-8, the three genotypes of the g.29461739T>G marker were significantly different in the association analysis of the trait of lambing number (P<0.05), and can be used for subsequent breeding research.

[0082] Example 2: Upstream and downstream nucleotide sequences of g.29461739T>G marker in the sheep genome

[0083] According to the position of the g.29461739T>G marker in the sheep genome, primers were designed for PCR amplification to obtain the upstream and downstream nucleotide sequences of the g.29461739T>G marker in the sheep genome, as shown in SEQ ID No: 1:

[0084] AGCTGGCTAATTACTTACCTTCTACGTATGACAGGCTTGCTTGTTTAACTTTTTGTATCCTCTTGTCATAGCTCAACGGAAAATGCTTGTGATTCAGCAGAAGTTTGAACCTGACAATCAAAAAGAATGTTTTAAGAAAAAAAACCTGGGAAATTAAAGTTCCCTCCAGTACAGTCTTTCTTTCCCTGCCCTCTGTGT M[T / G]CGTGTTTCTCTCGTTTTCTCTCTCTGCAAGGCAGCTACGTAGTGGTCTATAAATATTGACCCTGACACTTGCTCAGTGCTTTACTTGCTCATGGCACAGGTCCGTGTTACTGAACACCGTGGTAATGCTCCGGCAAAGTTCTCAGCTGCTCAGACAAAGCTGTGGATTGGCTCACTACCCAGCAACCCTGTGCCTGCC

[0085] For example, the M at the 201st base in the sequence shown in SEQ ID No: 1 represents a T>G base mutation. Based on the nucleotide sequence, primers can be designed to detect the genotype of the g.29461739T>G marker, and then sheep lambing traits can be further selected based on the detection results; or primers can be designed based on the nucleotide sequence to make corresponding detection kits that are directly used for the detection of the sheep g.29461739T>G marker, and then sheep lambing traits can be selected based on the detected genotype.

[0086] Example 3 Application of g.29461739T>G marker in improving lamb number in sheep

[0087] 1) Detect g.29461739T>G marker in replacement ewes;

[0088] 2) Selecting the individuals with the GG genotype detected in step 1) as breeding ewes and eliminating the individuals with the TG and TT genotypes can effectively increase the number of lambs produced by the ewes.

[0089] Example 4 Application of g.29461739T>G marker in breeding high lamb production sheep strain

[0090] 1) Detect g.29461739T>G marker in replacement ewes;

[0091] 2) selecting the individuals with the GG genotype detected in step 1) as breeding ewes, and breeding the breeding ewes;

[0092] 3) The g.29461739T>G marker is detected in the ewes born from mating in step 2), the individuals with GG genotype are retained, the individuals with TG and TT genotypes are eliminated, and then breeding is performed to cultivate a sheep strain with a high lamb number.

[0093] Example 5 Application of g.29461739T>G marker in improving the trait of lamb number in ewes

[0094] 1) Detect g.29461739T>G marker in replacement ewes;

[0095] 2) selecting the individuals with the GG genotype detected in step 1) as breeding ewes, and breeding the breeding ewes;

[0096] 3) The g.29461739T>G marker is detected in the ewes born from the mating in step 2), and the GG genotype individuals are retained. The ewes with the GG genotype individuals are bred and selected again, and the GG genotype individuals in the offspring ewes are retained, and the TG and TT genotypes are eliminated to increase the frequency of the dominant allele G from generation to generation, thereby increasing the lamb number trait of the ewe group, and improving the lamb number and fertility of the offspring ewe group.

[0097] Example 6 Application of g.29461739T>G marker in evaluating the trait of lamb number in ewes

[0098] The g.29461739T>G marker was detected in the ewe to be evaluated. When the detected genotype was GG, the ewe to be evaluated had high lambing performance; when the genotype was TG and TT, the lambing performance of the ewe to be evaluated was not high.

[0099] Example 7 Application of g.29461739T>G marker in screening the trait of lamb number in ewes

[0100] The g.29461739T>G marker is detected in the ewes to be screened. When the detected genotype is GG, the lambing performance of the ewe to be screened is high and it is retained as a reserve ewe; when the genotype is TG and TT, the lambing performance of the ewe to be screened is low and it is eliminated.

[0101] The above are only some embodiments of the present invention. For those skilled in the art, several modifications and improvements can be made without departing from the inventive concept of the present invention, which all belong to the protection scope of the invention.

Claims

1. Application of a product for detecting SNP loci in improving the lambing number trait of sheep, wherein: The SNP site is a T>G base mutation at the 29461739bp position of chromosome 6 in the sheep genome Oar_v 4.0 version. The product for detecting the SNP site refers to a primer that can detect the SNP site or a kit prepared by the primer.

2. The use according to claim 1, wherein: The application comprises the following steps: 1) Detecting the SNP loci in the reserve ewes; 2) Select the individuals with the GG genotype detected in step 1) as breeding ewes, and eliminate the individuals with the TG and TT genotypes, so as to effectively increase the number of lambs produced by the ewes.

3. Application of a product for detecting SNP loci in breeding sheep strains with high lamb yield traits, wherein: The SNP site is a T>G base mutation at the 29461739bp position of chromosome 6 in the sheep genome Oar_v 4.0 version. The product for detecting the SNP site refers to a primer that can detect the SNP site or a kit prepared by the primer.

4. The use according to claim 3, characterized in that The application comprises the following steps: 1) Detecting the SNP loci in the reserve ewes; 2) selecting the individuals with the GG genotype detected in step 1) as breeding ewes, and breeding the breeding ewes; 3) Detect the SNP sites of the ewes born from mating in step 2), retain individuals with GG genotype, eliminate individuals with TG and TT genotypes, and then breed them to cultivate sheep strains with high lamb numbers.

5. Application of a product for detecting SNP loci in improving the trait of lambing number in ewes, wherein: The SNP site is a T>G base mutation at the 29461739bp position of chromosome 6 in the sheep genome Oar_v 4.0 version. The product for detecting the SNP site refers to a primer that can detect the SNP site or a kit prepared by the primer.

6. Application of a product for detecting SNP loci in evaluating / screening the trait of lambing number in ewes, wherein: The SNP site is a T>G base mutation at the 29461739bp position of chromosome 6 in the sheep genome Oar_v 4.0 version. The product for detecting the SNP site refers to a primer that can detect the SNP site or a kit prepared by the primer.

7. Use of a nucleotide sequence containing a SNP site associated with the lamb number trait in sheep in the preparation of a product for detecting the lamb number trait in sheep, wherein: The sequence contains the nucleotide sequence shown in SEQ ID No: 1, and M in the sequence represents a T>G base mutation.

8. Application of primers for detecting SNP loci associated with sheep lambing number traits in sheep lambing number trait selection, wherein: The SNP site is a T>G base mutation at the 29461739bp position of chromosome 6 in the sheep genome Oar_v 4.0 version, and the primer sequences are shown in SEQ ID No: 2 and SEQ ID No: 3.

Images