Mtspg9 gene, protein and application

Abstract

The application discloses a Medicago truncatula MtSPG9 gene, protein and application, and the nucleotide sequence of the MtSPG9 gene is shown as SEQ ID NO. 1. The application is started from the whole genome sequence of the Medicago truncatula, and sequences encoding proteins less than 150 amino acids in the Medicago truncatula are screened, and the MsSPG9 gene with an obviously increased expression amount under drought stress is selected from the sequences, and molecular and physiological functions of the MsSPG9 gene in response to the drought stress are analyzed, and the MsSPG9 gene and the protein thereof are positioned on the cell membrane and the cytoplasm. It is found through functional verification analysis of Arabidopsis thaliana transgenes that the MsSPG9 gene has a remarkable effect in improving the resistance of plants, and the stress resistance of the transgenic plants is improved, and in particular, under the drought stress, the tolerance of the transgenic plants is stronger than that of wild type, so it can be seen that the MsSPG9 gene is related to drought resistance, and the MsSPG9 gene can improve the drought resistance of plants, and is beneficial to cultivating plant varieties with stronger stress resistance or modifying the stress resistance of other plants.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the MsSPG9 gene and protein of alfalfa and its use in improving plant drought resistance. Background Technology

[0002] Drought stress is a multidimensional stress that can induce a series of changes in plants at the phenotypic, physiological, biochemical, and molecular levels. Drought initially causes water loss in plant leaves, leading to wilting. Plants respond by curling their leaves or closing stomata to reduce water loss, and they also secrete plant hormones in response. These processes are regulated by genes. While my country has abundant total freshwater resources, its per capita freshwater resources are insufficient, classifying it as a country with a shortage of freshwater. With global warming and the degradation of soil and water resources, drought stress has become a major limiting factor for the growth, distribution, and yield of crops and forage crops.

[0003] Medicago truncatula possesses advantages such as high genetic transformation efficiency, a small genome (470 Mb), and a short growth period. Furthermore, it shares high genetic similarity with most leguminous plants, making it a novel model plant for leguminous biology and genomics research. Exploring the MtSPG gene in Medicago truncatula and its function in responding to drought / salt stress can provide a theoretical basis for subsequent research on alfalfa (Medicago sativa) and other leguminous plants.

[0004] Small signaling peptides (SSPs) are another important signaling molecule discovered in plants after plant hormones. They were first discovered in 1991 by Pearce et al., who extracted systemins from tomato (Solanum lycopersicum). Small peptides have a wide range of applications. For example, Stührwohldt et al. found that signal transduction between the plant sulfonatin (PSK) precursor SBT3.8 and PSK can improve the drought tolerance of Arabidopsis thaliana. Antimicrobial peptides exhibit broad-spectrum resistance to pathogens; for instance, transgenic tobacco (Nicotiana tabacum) overexpressing barley sulfadiazine, carotene defensin RsAFP2, Chinese cabbage defensin BSD1, and barley translipoprotein significantly enhanced resistance to fungi and bacteria. These research results indicate that small peptides, as important intercellular signaling molecules, play a crucial role in plant responses to both biotic and abiotic stresses. In this invention, the MsSPG9 gene we screened plays an important role in the response of alfalfa to drought stress, and can provide new ideas and new gene resources for enriching the theory of drought resistance in legumes and creating highly drought-resistant germplasm through genetic engineering technology. Summary of the Invention

[0005] One of the objectives of this invention is to provide the MtSPG9 gene of alfalfa, which is a gene encoding small peptide molecules.

[0006] The second objective of this invention is to provide the use of the above-mentioned MtSPG9 gene in alfalfa. By analyzing the physiological and molecular functions of MtSPG9 in response to drought stress, the provided MtSPG9 gene and the protein of the recombinant MtSPG9 gene are located on the cell membrane and cytoplasm, and can be expressed under the induction of mannitol and salt, and can improve the drought resistance of plants.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] This invention uses a small peptide gene screening method to first determine the length of the encoded amino acid, find the gene encoding the small peptide protein, and then study the gene with the help of transcriptome, gene probe and other types of data to find an MtSPG9 gene of alfalfa, whose nucleotide sequence is shown in SEQ ID NO.1, and the nucleotide sequence consists of 231 bases.

[0009] An MtSPG9 protein from alfalfa, the amino acid sequence of which is shown in SEQ ID NO.2. The sequence consists of 76 amino acid residues.

[0010] The primer pair for amplifying the MtSPG9 gene is shown in SEQ ID NO.3, and the reverse primer pair is shown in SEQ ID NO.4.

[0011] Overexpression vectors containing the MtSPG9 gene of the aforementioned alfalfa also fall within the scope of protection of this invention. The overexpression vector selected in this invention is the Agrobacterium overexpression vector.

[0012] The primary objective of this invention is to clone and identify the MtSPG9 gene of alfalfa at the molecular level, thereby elucidating its physiological and molecular functions in response to drought stress.

[0013] The present invention also discloses the use of the MtSPG9 gene of the above-mentioned alfalfa.

[0014] Studies have found that the proteins of the MtSPG9 gene and the recombinant MtSPG9 gene are located on the cell membrane and cytoplasm, and are expressed under the induction of mannitol and salt, which can improve plant drought resistance.

[0015] The present invention also discloses a method for cultivating transgenic plants, wherein the MtSPG9 gene is introduced into a target plant to obtain a transgenic plant, and the transgenic plant has stronger drought resistance than the target plant.

[0016] Specifically, in order to improve the superior traits of plants, this invention also protects a novel plant breeding method, comprising the following steps (1) and / or (2):

[0017] (1) By exogenously applying MtSPG9 protein to the target plant, a plant phenotype with stronger drought resistance than the target plant was obtained;

[0018] (2) By promoting the expression of the MtSPG9 gene in the target plant, plants with stronger drought resistance than the target plant were obtained;

[0019] The methods to achieve "promoting the expression of the MtSPG9 gene in the target plant" can be as follows (1) or (2) or (3):

[0020] (1) Introduce the MtSPG9 gene into the target plant;

[0021] (2) Introduce strong promoters and / or enhancers;

[0022] (3) Other common methods in this field.

[0023] In this invention, there are no particular limitations on the plants suitable for gene transformation, as long as they are suitable for gene transformation operations, such as various crops, flowering plants, or forestry plants. The plants may be (but are not limited to): dicotyledons, monocotyledons, or gymnosperms.

[0024] As a preferred approach, the "plants" mentioned include, but are not limited to, alfalfa and Arabidopsis thaliana; any plant possessing this gene or a homologous gene is applicable. This approach is particularly suitable for plants requiring improved drought tolerance. In practical applications, for plants requiring improved drought tolerance, strains incorporating this gene can be developed through transgenic methods.

[0025] The term "plant" as used in this invention includes the whole plant, its parent and offspring plants, and different parts of the plant, including seeds, fruits, buds, stems, leaves, roots (including tubers), flowers, tissues, and organs, all of which contain our target gene or nucleic acid. The term "plant" also includes plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen, and microspores; similarly, each of these objects contains the target gene / nucleic acid.

[0026] This invention includes any plant cell, or any plant obtained or obtainable by the methods described herein, as well as all plant parts and their propagules. This patent also includes transfected cells, tissues, organs, or whole plants obtained by any of the foregoing methods. The only requirement is that the offspring exhibit the same genotype or phenotypic characteristics, and that offspring obtained using the methods of this patent have identical characteristics.

[0027] This invention also extends to the harvestable parts of the plants as described above, but is not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers, and bulbs. It further relates to other derivatives of the plant after harvest, such as dried granules or powders, oils, fats and fatty acids, starches, or proteins. This invention also relates to foods or food additives obtained from the relevant plants.

[0028] The present invention has the following advantages:

[0029] This invention is the first to screen for small peptide genes unique to Alfalfa tribulus, obtaining two drought-related genes, named MtSPG6 and MtSPG9 (to avoid the problem of single genes, the two genes are patented separately). The physiological and molecular functions of MtSPG6 and MtSPG9 in response to drought stress were analyzed. The results show that the provided MtSPG6 and MtSPG9 genes and their proteins are located on the cell membrane and cytoplasm, and their expression under the induction of mannitol and salt can improve plant drought resistance. The DNA sequence of the stress-resistance-related protein and the protein it encodes are enhanced in stress resistance (especially drought resistance) compared to the original protein and its encoding gene sequence, providing a theoretical basis for artificially controlling the expression of stress-resistance-related genes, which is beneficial for breeding more stress-resistant plant varieties or modifying the stress resistance of other plants. Attached Figure Description

[0030] Figure 1 This is a map showing the subcellular localization of the MtSPG9 gene in onion epidermis;

[0031] The image shows, from left to right, superimposed images of the target gene's green fluorescent protein, bright field, and three channels; the empty GFP vector serves as a control.

[0032] Figure 2 These are PCR test results from MtSPG9 transgenic Arabidopsis thaliana positive plants;

[0033] In the figure, the leftmost part is the 2000bp Marker, 1-16 are 16 overexpression lines of transgenic Arabidopsis thaliana, and WT is wild-type Arabidopsis thaliana.

[0034] Figure 3 This is an identification of the expression level of MtSPG9 transgenic Arabidopsis thaliana.

[0035] Figure 4 This is an evaluation of the root length phenotype of MtSPG9 transgenic Arabidopsis thaliana in flat plates;

[0036] The figure shows: A. Root length phenotype of MtSPG9 transgenic Arabidopsis thaliana on plates with different concentrations of mannitol and ABA; B. Root length statistics of MtSPG9 transgenic Arabidopsis thaliana on plates with different concentrations of mannitol and ABA. The error bars represent the standard errors of four biological replicates.

[0037] Figure 5 This is a soil drought phenotype diagram of Arabidopsis thaliana overexpressing MsSPG9. Detailed Implementation

[0038] The present invention will now be described in detail through specific embodiments. These embodiments are provided to enable a more thorough understanding of the present invention and to fully convey the scope of the invention to those skilled in the art. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the reagents and materials used are commercially available.

[0039] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0040] Unless otherwise stated, the implementation of this invention will utilize conventional botanical techniques, microbiological techniques, tissue culture techniques, molecular biology techniques, chemical techniques, biochemical techniques, DNA recombination techniques, and bioinformatics techniques that are readily apparent to those skilled in the art. These techniques have been fully explained in published literature. Furthermore, the methods employed in this invention, including DNA extraction, phylogenetic tree construction, gene editing methods, gene editing vector construction, and the acquisition of gene-edited plants, except for those used in the examples below, can all be implemented using methods already disclosed in existing literature.

[0041] As used herein, the terms “nucleic acid,” “nucleic acid sequence,” “nucleotide,” “nucleic acid molecule,” or “polynucleotide” mean, but are not limited to, isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), naturally occurring, mutant, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, and single-stranded or double-stranded structures. These nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences of non-coding regions. These terms include a gene. “Gene” or “gene sequence” is broadly used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in a genomic sequence, and / or include coding sequences in cDNA, and / or include cDNA and its regulatory sequences. In particular embodiments, such as concerning isolated nucleic acid sequences, cDNA is preferred by default.

[0042] In addition, to provide a more intuitive understanding of the technical solution of this invention, some technical terms involved in this invention are explained as follows:

[0043] "Expression vectors" are vectors that add expression elements (such as promoters, RBS, terminators, etc.) to the basic skeleton of a cloning vector, enabling the target gene to be expressed.

[0044] "Agrobacterium-mediated transformation" refers to the technique of inserting a target gene into a modified T-DNA region, using Agrobacterium infection to transfer and integrate the foreign gene into plant cells, and then regenerating transgenic plants through cell and tissue culture techniques.

[0045] Target plant: Arabidopsis thaliana.

[0046] Target gene: In genetic engineering design and manipulation, the gene used for gene recombination, altering the traits of recipient cells, and obtaining the desired expression product. It can be from the organism itself or from different organisms.

[0047] Example

[0048] First, using the whole genome of alfalfa, genes encoding less than 150 amino acids were selected. Then, using transcriptome data under drought stress, genes whose expression levels significantly increased under drought stress were selected. Finally, using probe data, an alfalfa MtSPG9 gene was obtained. The full-length coding frame of this gene is 231 bp in length and consists of 76 amino acids. Its nucleotide sequence is as follows (SEQ ID NO.1), and its protein sequence is as follows (SEQ ID NO.2).

[0049] I. Cloning and Vector Construction of MtSPG9

[0050] Based on the MtSPG9 gene, specific primers with restriction enzyme sites were designed using DNAMAN to clone the full length of the gene. The forward primer sequence is: GAGTAGGAGTTCCAATATGCGTG (SEQ ID NO.3), and the reverse primer sequence is: GATGACCCATGATTCTGCGA (SEQ ID NO.4). The primers were synthesized by Shanghai Sangon Biotech Co., Ltd., and purified using the HAP method.

[0051] The reaction system for cloning DNA sequences is as follows: cDNA 2 μL, kod DNA polymerase 0.5 μL, forward primer / 10 μM 0.8 μL, reverse primer / 10 μM 0.8 μL, 2 mM dNTPs 2 μL, 10× buffer 2 μL, DMSO 1 μL, ddH2O 10.9 μL, total volume 20 μL.

[0052] PCR amplification reaction program: 94℃ for 4 min; 94℃ for 30 s, 60℃ for 30 s, 68℃ for 45 s, 40 cycles; 68℃ for 8 min.

[0053] Add an appropriate amount of 10× loading buffer to each reaction tube and perform electrophoresis on a 1.5% agarose gel. Electrophoresis is performed in 0.5× TBE buffer at 5–10 V / cm. After electrophoresis, take a picture using a gel imaging system. The target fragment is recovered using the Jereh Biotech Agarose Gel DNA Recovery Kit (GK2042): Carefully cut the target DNA band and place it in a 1.5 ml EP tube. Add 400 μl of banding B to the tube and place it in a 70°C water bath until the gel is completely dissolved. Add 100 μl of isopropanol to the tube, incubate at room temperature for 1 min, and centrifuge at 5000 rpm for 1 min to pass through the column. Repeat step 3. Add 500 μl of wash buffer and wash twice at 12000 rpm, centrifuge at 10000 rpm for 1 min. Add 40 μl of double-distilled water to the column, incubate at 37°C for 2 min, and centrifuge at 12000 rpm for 1 min to collect the sample. The purified target fragment and PHG vector were digested separately with single enzymes to obtain target fragments and vector fragments with the same digestion sites. Hind III / PST I 6 μL, 10× digestion buffer 4 μL, 10× BSA 4 μL, plasmid template ≤1 ng, ddH2O to a final volume of 40 μL, the entire system was incubated for PCR at 37℃ for 1 h. The PC fragment was recovered by agarose gel electrophoresis and mixed with the digested empty vector, then ligated into the EasyGeno DNA recombination system. A 10 μl recombination system consisted of: 2×EasyGeno Assembly Mix 5 μL, digested vector DNA 2.5 μL, and fragment DNA 2.5 μL. The reaction system was added to 250 μl EP tubes, incubated at 50℃ for 30 minutes, transformed into E. coli, plated, and incubated at 37℃ for 16 hours. Bacteria were picked and sequenced. Plasmids with correct sequencing results were extracted and stored at -20℃ for long-term preservation. II. Agrobacterium transformation and subcellular localization of onion epidermal cells.

[0054] The plasmids that were correctly sequenced in the previous step were transformed into Agrobacterium tumefaciens GV3101 cells using electroporation. The instruments used included an Olympus laser confocal microscope, a Thermo Sorvall ST16R centrifuge, an HH-S3 digital display constant temperature water bath, and a DYY-8D constant voltage and constant current electrophoresis apparatus.

[0055] (1) Transient transformation protocol for onion epidermal cells:

[0056] a. Onion epidermal pre-culture: Use tweezers to peel off 1cm of the inner epidermis of the onion. 2 Place the small pieces on MS medium and pre-incubate at 28°C for 5 hours.

[0057] b. Preparation of infection solution: Add the bacterial solution to LB medium containing antibiotics and incubate overnight. Centrifuge at 5000 rpm for 5 minutes, collect the bacterial cells, resuspend in LB medium, and measure the bacterial concentration using a spectrophotometer. Adjust the concentration to about OD=1.

[0058] c. Inoculation: Pour the above bacterial solution into the pre-culture medium and soak for 30 minutes, shaking several times during this period. Discard the bacterial solution and blot the surface of the onion skin dry on sterile filter paper. Inoculate it into co-culture medium (MS medium with AS), and observe after incubation at 28°C in the dark for 2 days.

[0059] (2) Confocal microscopy observation:

[0060] a. Turn on the computer.

[0061] b. Turn on the laser.

[0062] c. Turn on the power switch of the mercury lamp.

[0063] d. Open the software.

[0064] e. Turn on the white light switch, place the target image, and adjust the focus.

[0065] f. Turn on the laser light switch and click the photo button to take a picture.

[0066] g. Add rulers and export .tif image.

[0067] To investigate the subcellular localization and potential function of the MsSPG9 gene, the coding sequence of MsSPG9 was fused with an enhanced GFP gene to form the MsSPG9:eGFP vector under the control of the constitutive CaMV35S promoter. This vector was transiently transformed into onion epidermal cells via Agrobacterium-mediated transformation, with an empty vector PHG-eGFP used as a control. Confocal microscopy, combined with results before and after plasmolysis, revealed that the eGFP fluorescence signal in the empty vector cells was distributed in the cell wall, cytoplasm, and nucleus, while the eGFP fluorescence signal in the MsSPG9 fusion cells was mainly distributed in the cytoplasm and intercellular spaces. Figure 1 The presence of MtSPG9 in the cell nucleus indicates that it is located on the cell membrane. III. Functional Identification of the MtSPG9 Gene

[0068] 1. Genetic transformation of Arabidopsis thaliana using the flower dipping method

[0069] Transformation and identification of Agrobacterium tumefaciens using the heat shock method. Competent Agrobacterium cells stored at -80℃ were partially thawed at room temperature or in the palm of the hand, and then placed in ice while in an ice-water mixture. 0.1 μg (no more than 10 μl) of plasmid DNA was added to every 100 μl of competent cells, and the mixture was stirred by hand at the bottom of the tube. The tube was then incubated sequentially on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37℃ water bath for 5 minutes, and on ice for 5 minutes. 700 μl of antibiotic-free LB broth was added, and the tube was incubated at 28℃ with shaking at 200 rpm for 2–3 hours. The cells were harvested by centrifugation at 6000 rpm for one minute. Approximately 100 μl of the supernatant was collected, gently resuspended, and spread onto an LB agar plate containing 50 μg / ml kanamycin. The plate was inverted and incubated at 28℃ for 2–3 days. One single colony was randomly selected for colony PCR. Correctly identified Agrobacterium clones were labeled for later use. Using a sterile pipette tip, a labeled Agrobacterium single clone was inoculated into 1.5 ml of LB liquid medium containing the appropriate antibiotic and cultured at 30°C with shaking at 200 rpm for 24 hours. At a ratio of 1%, the slightly shaken Agrobacterium culture was added to 100 ml of LB liquid medium containing antibiotics and cultured at 30°C with shaking until OD600 = 1.0. The culture was then centrifuged at 20°C, 4000 rpm for 15 min, and the cells were collected. The cells were then resuspended in transformation buffer until OD600 = 1.0. Arabidopsis thaliana cultivation was then performed.

[0070] Culture medium preparation: For Arabidopsis thaliana, use 1 / 2 MS medium (0.8% agar powder, 1% sucrose, pH 5.8). Seed sterilization: Sterilize with 1 ml of 7% sodium hypochlorite solution, invert and mix for 15 minutes, then rinse 5 times with sterile water. After sterilization, dispense the seeds into portions, mix with medium at 40-50℃, pour into petri dishes, and spread evenly (approximately 4-5 ml of medium is needed for small petri dishes). Seal the petri dishes and vernalize at 4℃ for 2-3 days, then place them in an artificial climate chamber to begin germination and growth. The plant growth environment is: relative humidity 60%; constant temperature 21-23℃; photoperiod of 16 hours of light followed by 8 hours of darkness.

[0071] Preparation of planting soil: Mix peat moss and vermiculite in a 2:1 ratio and set aside. Soaking the soil: Fill the planting pot with soil to about 1cm from the rim, and soak it completely with Flower Fertilizer (N, P, K = 20%, 20%, 20%). Transplanting: 7-12 days after germination, select healthy seedlings with uniform growth and transplant them into the potting soil that has been soaked with Flower Fertilizer. Cover with plastic wrap and remove it once the seedlings are growing vigorously.

[0072] For Arabidopsis thaliana transformation, water the flowering plants thoroughly one day in advance. Invert the small pot and immerse all the inflorescences in a bacterial solution pre-suspended with transformation buffer for about 30 seconds. Repeat the transformation process once after 7 days. After 2-3 weeks, minimize nutrient solution application to accelerate aging. Collect mature seeds in paper bags and dry for 7 days.

[0073] 2. Detection of positive transgenic Arabidopsis plants

[0074] After the transgenic Arabidopsis thaliana matured, T0 generation seeds were harvested. These seeds were then screened on plates containing HYB (50 μg / mL) resistance. Seedlings with HYB activity were transplanted into pots, and T1 generation seeds were harvested. Resistance screening continued until seeds of homozygous T2 generation lines were obtained. After obtaining homozygous transgenic lines, DNA was extracted from leaves of wild-type Col-0 and different transgenic Arabidopsis thaliana lines using the SDS method. Positive plants were detected using 2×Taq Master Mix enzyme amplification with primers 35S-F and MsSPG9-R, and HPT-F and HPT-R.

[0075] HPT-F:GGTCGCCGGAGGCTATGGATGC;

[0076] HPT-R:GCTTCTGCGGGCGATTTGTGT;

[0077] The reaction mixture consisted of: 2 μL cDNA, 10 μL 2×Taq Master Mix, 0.8 μL forward primer (10 μM), 0.8 μL reverse primer (10 μM), 6.4 μL ddH2O, and a total volume of 20 μL. The PCR amplification program was as follows: 94℃ for 3 min; 94℃ for 30 s, 60℃ for 30 s, 72℃ for 1 min, 35 cycles; 72℃ for 5 min.

[0078] After overexpressing the MtSPG9 gene in Arabidopsis thaliana, a total of 16 transgenic lines were obtained. PCR identification revealed that 6 lines contained the 231 bp HPT fragment of the hygromycin resistance gene amplified by HPT-F / HPT-R. Figure 2 The expression level of MsSPG9 in these six transgenic lines was then detected by qPCR. The results showed that the expression level of MsSPG9 in all six transgenic lines was higher than that in the wild type. Figure 3 The lowest expression level was in strain 3, and the highest expression level was in strain 6, which was 6 times higher than that of strain 6. Strains 1, 5, and 6, which had relatively high expression levels, can be selected as research subjects.

[0079] 3. Determination of drought resistance evaluation indicators for transgenic Arabidopsis thaliana

[0080] To analyze the stress resistance characteristics of transgenic Arabidopsis thaliana, the obtained transgenic Arabidopsis thaliana were prepared in 1 / 2 MS plates containing 300 mM mannitol and control plates. The control plate contained no other added 1 / 2 MS medium. Col-0 Arabidopsis thaliana and transgenic lines were simultaneously placed on the same plate, with four lines (including wild-type Arabidopsis thaliana) in each plate, and each line containing four replicates. After root length measurement, the plates were immediately transferred to a walk-in incubator and germinated at 22°C for approximately 7 days under 16 h light / 8 h dark conditions. The seedling phenotype was photographed and the absolute root length of each seedling was measured. R plots were used, and SPSS 20 was used for significance analysis.

[0081] Based on the qPCR results, seedlings from the three homozygous transgenic lines with the highest expression levels (OE-1, OE-5, and OE-6) were selected to verify whether they exhibited stronger drought resistance than wild-type Arabidopsis thaliana. Arabidopsis thaliana seeds were germinated on 1 / 2 MS medium. Once the seedling roots reached approximately 1 cm in length, wild-type and transgenic seedlings with consistent root lengths were selected and transferred to the same 1 / 2 MS medium supplemented with 300 mM mannitol. Growth trends were observed, and the taproot length was measured after 7 days of growth. Figure 4On unstressed culture media, the growth of wild-type and MtSPG9 transgenic lines was similar with no significant difference; however, on drought stress plates with 300mM mannitol applied, the growth of transgenic lines was significantly better than that of wild-type, and the leaves were significantly less wrinkled and yellowed than those of wild-type. Therefore, MsSPG9 transgenic lines have higher drought tolerance.

[0082] From the perspective of plant growth phenotype ( Figure 5 After 14 days of withholding water, the wild-type WT almost died from drought. While the leaves of the three MsSPG9 transgenic lines with high expression levels showed some curling and wilting, their growth was significantly better than that of the wild-type. Furthermore, after rehydration, the wild-type WT did not survive, while the MsSPG9 transgenic lines almost returned to their original growth state. This demonstrates that the MsSPG9 transgenic Arabidopsis seedlings possess stronger drought resistance than the wild-type Arabidopsis.

[0083] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. Tribulus terrestris alfalfa MsSPG9 Genes, characterized by, The MsSPG9 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The encoding as described in claim 1 MsSPG9 The protein of the gene is characterized by, The encoding MsSPG9 The amino acid sequence of the gene's protein is shown in SEQ ID NO.

2.

3. The alfalfa according to claim 1 MsSPG9 Genes, characterized by, The MsSPG9 The forward primer sequence for the gene is shown in SEQ ID NO.3, and the reverse primer sequence is shown in SEQ ID NO.

4.

4. The claim 1 MsSPG9 The use of genes to improve drought resistance in Arabidopsis thaliana.

5. A method for cultivating transgenic plants, characterized in that, The claim 1 MsSPG9 Genes are introduced into a target plant to obtain a transgenic plant. The transgenic plant has stronger drought resistance than the target plant. The plant is Arabidopsis thaliana.

6. A plant breeding method, characterized in that, The method involves: obtaining plants with stronger drought resistance than the target plant by promoting the expression of the MsSPG9 gene in the target plant; MsSPG9 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the target plant is Arabidopsis thaliana.

7. The plant breeding method according to claim 6, characterized in that, "Promote the target plant MsSPG9 The ways in which gene expression is achieved include the following (1) or (2): (1) MsSPG9 Genes are introduced into the target plant; (2) Introduce strong promoters and / or enhancers.

Images