SARS-CoV-2 RBD-specific monoclonal antibodies and their applications

Abstract

The present invention belongs to the field of monoclonal antibody technology, and specifically discloses a novel coronavirus RBD-specific monoclonal antibody and the application of the novel coronavirus RBD-specific monoclonal antibody. The present invention has important scientific significance and application prospects for the prevention, clinical treatment and development of diagnostic reagents for diseases caused by the novel coronavirus SARS-CoV-2.

Description

[0001] This application is a divisional application of the patent with application date of August 19, 2020, application number 202210564961.X, and patent name "Coronavirus RBD-specific monoclonal antibodies and applications". Technical Field

[0002] The present invention belongs to the field of monoclonal antibody technology, and in particular relates to novel coronavirus RBD-specific monoclonal antibodies and applications. Background Art

[0003] Antibodies are immunoglobulin molecules composed of four polypeptide chains, including two heavy chains (H chains) and two light chains (L chains). The H chain consists of a heavy chain variable region (VH) and a heavy chain constant region, which consists of three regions: CH1, CH2, and CH3. The L chain consists of an L chain variable region (VL) and a light chain constant region, which consists of a CL region. VH and VL can be further divided into hypervariable regions called complementarity determining regions (CDRs) and alternately distributed conserved regions called framework regions (FRs).

[0004] Current research has found that the new coronavirus (SARS-CoV-2) has four main structural proteins, namely spike protein (S protein), nucleocapsid protein (N protein), membrane protein (M protein) and envelope protein (E protein). The S protein has two subunits: S1 and S2. The receptor binding site (RBD) is located on the S1 subunit. Its main function is to recognize host cell surface receptors and mediate fusion with host cells.

[0005] Currently, there is no specific drug for the treatment of the emerging pathogen COVID-19, and the development of a vaccine will take some time. The plasma of patients who have been cured and discharged recently contains high concentrations of specific antigen neutralizing antibodies, which can neutralize the new coronavirus pathogen and mediate an effective immune response after being injected into the patient's body. Therefore, the use of convalescent plasma is expected to provide an effective treatment for patients infected with the new coronavirus, reduce mortality, and protect the lives of patients.

[0006] The Chinese invention patent application with application publication number CN111303280A discloses a fully human monoclonal antibody with high neutralizing activity against SARS-CoV-2. The above patent provides a fully human monoclonal antibody whose recognition region is the S1 non-RBD region. However, since the new coronavirus invades host cells by binding to the host cell's ACE2 through RBD, the fully human monoclonal antibody obtained in the above patent has limited blocking effect on the virus. In addition, the above patent obtains antibody cDNA by labeling plasma cells, but compared with plasma cells, memory B cells respond quickly after activation, so memory B cells can induce a faster and stronger humoral immune response than the primary reaction, while the humoral immune response induced by plasma cells is limited. Summary of the invention

[0007] The purpose of the present invention is to provide a novel coronavirus RBD-specific monoclonal antibody and application that targets RBD and can induce a stronger humoral immune response.

[0008] In order to achieve the above-mentioned object, the present invention provides a novel coronavirus RBD-specific monoclonal antibody, specifically, the heavy chain variable region amino acid sequence of the antibody is as shown in SEQ ID NO: 1; the light chain variable region amino acid sequence can be as shown in SEQ ID NO: 2 (monoclonal antibody 11-CQTS011). The heavy chain variable region amino acid sequence can also be as shown in SEQ ID NO: 3; the light chain variable region amino acid sequence can also be as shown in SEQ ID NO: 4 (monoclonal antibody 12-CQTS012). The heavy chain variable region amino acid sequence can also be as shown in SEQ ID NO: 5; the light chain variable region amino acid sequence can also be as shown in SEQ ID NO: 6 (monoclonal antibody 13-CQTS013). The heavy chain variable region amino acid sequence can also be as shown in SEQ ID NO: 7; the light chain variable region amino acid sequence can also be as shown in SEQ ID NO: 8 (monoclonal antibody 14-CQTS014). The heavy chain variable region amino acid sequence can also be as shown in SEQ ID NO: 9; the light chain variable region amino acid sequence can also be as shown in SEQ ID NO: 10 (monoclonal antibody 15-CQTS015). The heavy chain variable region amino acid sequence may also be shown as SEQ ID NO: 11; the light chain variable region amino acid sequence may also be shown as SEQ ID NO: 12 (monoclonal antibody 16-CQTS016). The heavy chain variable region amino acid sequence may also be shown as SEQ ID NO: 13; the light chain variable region amino acid sequence may also be shown as SEQ ID NO: 14 (monoclonal antibody 17-CQTS017). The heavy chain variable region amino acid sequence may also be shown as SEQ ID NO: 15; the light chain variable region amino acid sequence may also be shown as SEQ ID NO: 16 (monoclonal antibody 18-CQTS018). The heavy chain variable region amino acid sequence may also be shown as SEQ ID NO: 17; the light chain variable region amino acid sequence may also be shown as SEQ ID NO: 18 (monoclonal antibody 19-CQTS019). The heavy chain variable region amino acid sequence may also be shown as SEQ ID NO: 19; the light chain variable region amino acid sequence may also be shown as SEQ ID NO: 20 (monoclonal antibody 20-CQTS020).

[0009] The present invention also provides the above-mentioned novel coronavirus RBD-specific monoclonal antibody, and its use in the preparation of a reagent, vaccine or drug for detecting or diagnosing SARS-CoV-2, wherein the drug comprises the above-mentioned novel coronavirus RBD-specific monoclonal antibody and a pharmaceutically acceptable excipient, diluent or carrier; also provides a nucleic acid molecule encoding the above-mentioned novel coronavirus RBD-specific monoclonal antibody; also provides an expression cassette, a recombinant vector, a recombinant bacterium or a transgenic cell line containing the above-mentioned nucleic acid molecule; and also provides the use of the above-mentioned expression cassette, recombinant vector, recombinant bacterium or transgenic cell line in the preparation of a product.

[0010] The present invention also provides a product, including the above-mentioned novel coronavirus RBD-specific monoclonal antibody; the product has any of the following uses (b1)-(b4): (b1) binding to the novel coronavirus SARS-CoV-2; (b2) detecting the binding to the novel coronavirus SARS-CoV-2; (b3) binding to the S protein of the novel coronavirus SARS-CoV-2; (b4) detecting the S protein of the novel coronavirus SARS-CoV-2.

[0011] Preferably, the above-mentioned SARS-CoV-2 RBD-specific monoclonal antibodies are prepared by sorting RBD-specific memory B cells, and then obtaining the antibody variable region cDNA through the mRNA of RBD-specific memory B cells.

[0012] The principles and beneficial effects of the present invention are:

[0013] (1) The monoclonal antibody provided by the present invention has RBD specificity. Compared with the monoclonal antibody targeting the non-RBD region of S1, the monoclonal antibody provided by the present invention binds to RBD, providing a wider application value for antibody drug screening, diagnosis, prevention and treatment of new coronary pneumonia.

[0014] (2) The monoclonal antibody provided by the present invention is obtained by sorting RBD-specific memory B cells. Compared with the prior art by sorting plasma cells, the monoclonal antibody prepared by the present invention can induce a stronger humoral immune response. In addition, the present invention only conducts subsequent RT-PCR, nested PCR and antibody function analysis on RBD-specific memory B cells, which greatly improves the specific binding ability of monoclonal antibodies to RBD. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Figure 2 shows the cell sorting of memory B cells analyzed by flow cytometry.

[0016] Figure 2 Figure 2 shows the cell sorting of RBD-specific memory B cells analyzed by flow cytometry.

[0017] Figure 3 This is the gel electrophoresis diagram of the PCR product of single cell antibody gene;

[0018] Figure 4 It is the agarose gel electrophoresis image after PCR amplification of the antibody gene expression cassette containing CMV promoter, WPRE-γ or WPRE-κ element;

[0019] Figure 5 This is a graph showing RBD-specific experimental results. DETAILED DESCRIPTION

[0020] The following will be combined with the accompanying drawings of the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0021] Example 1

[0022] This embodiment provides a novel coronavirus RBD-specific monoclonal antibody, the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO: 1; the amino acid sequence of the light chain variable region is shown in SEQ ID NO: 2.

[0023] This embodiment also provides the use of the above-mentioned novel coronavirus RBD-specific monoclonal antibody in the preparation of reagents or drugs for detecting or diagnosing SARS-CoV-2.

[0024] In actual production, the RBD-specific monoclonal antibody obtained in this embodiment can be used to prepare a nucleic acid molecule, or to prepare an expression cassette, a recombinant vector, a recombinant bacterium or a transgenic cell line containing the nucleic acid molecule, or to prepare a pharmaceutical composition, which includes the above-mentioned novel coronavirus RBD-specific monoclonal antibody and a pharmaceutically acceptable excipient, diluent or carrier.

[0025] When used, the related products prepared by the RBD-specific monoclonal antibody obtained in this embodiment can have any of the following uses (b1)-(b4): (b1) binding to the new coronavirus SARS-CoV-2; (b2) detecting the binding to the new coronavirus SARS-CoV-2; (b3) binding to the S protein of the new coronavirus SARS-CoV-2; (b4) detecting the S protein of the new coronavirus SARS-CoV-2.

[0026] Embodiment 2-10

[0027] The difference between Example 2-10 and Example 1 is that the amino acid sequences of the variable regions of the RBD-specific monoclonal antibodies are different. The amino acid sequences of the variable regions of Example 2-10 are shown in the following table:

[0028]

[0029]

[0030] The RBD-specific monoclonal antibodies provided in the above Examples 1-10 were all obtained by the following method: first, single RBD-specific memory B cells were sorted from the peripheral blood of recovered patients with COVID-19, and then the mRNA of RBD-specific memory B cells was obtained. Then, an antibody variable region gene expression cassette was constructed by RT-PCR and nested PCR, and then the antibody variable region gene expression cassette was transduced into 293T cells to express antibodies and the supernatant was collected. The RBD specificity of the supernatant was detected by ELISA to screen for RBD-specific monoclonal antibodies.

[0031] The specific steps include:

[0032] S1. Collect peripheral blood from several recovered COVID-19 patients, separate PBMCs, and freeze them in a -80℃ refrigerator for later use.

[0033] S2. First, use Dead Dye to remove dead cells from the PBMC obtained in S1, and then use CD19, mIg-G, mIg-D and S-RBD to stain and mark the live RBD-specific and highly binding memory B cells in the PBMC to screen out RBD-specific memory B cells; use a flow cytometer to sort the specific memory B cells into a 96-well plate, with one specific memory B cell in each well, and freeze them in a -80°C refrigerator for later use.

[0034] Specifically, the preferred Dead Dye staining concentration range of this embodiment is 1-2μg / mL, and the preferred Dead Dye staining concentration of this embodiment is 1.5μg / mL; CD19 is a B cell marker produced by Biolegend, and the concentration range of staining is 1-2μg / mL, and the preferred CD19 staining concentration in this embodiment is 1.5μg / mL. mIg-G is a B cell surface receptor produced by Biolegend, and the concentration range of staining is 1-2μg / mL, and the preferred mIg-G staining concentration in this embodiment is 1.5μg / mL; mIg-D is a B cell surface receptor produced by Biolegend, and the concentration range of staining is 1-2μg / mL, and the preferred mIg-D staining concentration in this embodiment is 1.5μg / mL; S-RBD is a protein receptor domain of the new coronavirus produced by sinobiological, and the concentration range of staining is 1-2μg / mL, and the preferred S-RBD staining concentration in this embodiment is 1.5μg / mL.

[0035] RBD-specific memory B cells were sorted by flow cytometry, and PBMCs were sorted by CD19, mIg-G, mIg-D, and S-RBD to obtain S-RBD-specific memory B cells. Figure 1 and Figure 2 As shown, Figure 2 Batch ID 0428, 0505, 0522, 0528 in the example are screening batches. The principle of using CD19, mIg-G, mIg-D and S-RBD to screen out RBD-specific memory B cells is as follows: PBMCs are stained with dead cell dye (Dead Dye), B cell marker CD19, memory B cell marker mIg-G positive and mIg-D negative, and RBD-specific IgG-expressing memory B cells, and then the CD19 cell population is separated from the cell population using a flow cytometer, and then the mIg-G positive cell population is separated from the CD19 positive cell population. + mIg-D - Cell population, then from mIg-G + mIg-D - The cell population is divided into RBD-positive memory B cells, and then the RBD-positive memory B cells are sorted by flow cytometry.

[0036] S3. Sorting and obtaining the mRNA of a single RBD-specific memory B cell, and using RT-PCR amplification to obtain the antibody variable region cDNA. Specifically, when using RT-PCR to amplify the antibody variable region cDNA, the primers designed in this embodiment are designed with a universal leader in the front section (see Primer Sequence Table 1 and Primer Sequence Table 2), which effectively improves the amplification rate of the antibody gene. The experimental results are as follows: Figure 3 shown.

[0037] S4. Amplify the antibody variable region cDNA obtained from S1-S3 using nested PCR to construct an antibody variable region gene expression cassette.

[0038] S3 and S4 are carried out in total through the following six parts: (1) extraction of RBD-specific memory B cell mRNA; (2) reverse transcription (RT) of single cell mRNA; (3) addition of G tail (TDT); (4) first round of PCR (1st PCR); (5) second round of PCR (2nd PCR); (6) BCR-ORF PCR amplification to construct a gene expression cassette; (7) CMV, WPRE-γ / κ / l fragment amplification and CMV, BCR-Vγ / κ / l (product of (6)), WPRE-γ / κ / l overlap PCR (Overlap PCR) pre-connection; (8) BCR-γORF, BCR-κORF, BCR-l PCR amplification.

[0039] The preparation of each reaction solution and the reaction conditions are as follows:

[0040] (1) Using Dynabeads TM mRNA DIRECT TM Purification Kit (Thermo Fisher Scientific) was used to extract single-cell mRNA, which specifically included the following steps:

[0041] ① Centrifugation: After taking out the 96-well plate with single RBD-specific memory B cells from the -80°C refrigerator, centrifuge at 600×g for 30 seconds to centrifuge the cells to the bottom of the well;

[0042] ② Washing: Take out the Dynabeads oligo(dT)25 microsphere bottle and vortex to mix, aspirate enough microspheres at 2μl / well, place on the magnet block, let stand for 30s, discard the supernatant, and resuspend with 500μl Lysis Buffer;

[0043] ③ Preparation: Add 9 μl / well Lysis Buffer into a 50 mL centrifuge tube, add the above 500 μl microsphere suspension, and blow evenly with a gun;

[0044] ④ Dispensing: Dispense the microspheres using eight-tube tubes, and then use a dispenser to add them to the cell plate at 9 μl / well;

[0045] ⑤ Rinse: Apply the film to the 96-well plate, then rinse the tube wall for 2 cycles;

[0046] ⑥ Incubation: Let stand at room temperature for 5 minutes to allow the mRNA of RBD-specific memory B cells to be fully released and bound to the microspheres. After the incubation, centrifuge at 600×g to centrifuge the microspheres to the bottom of the wells. Place the 96-well plate on the DynaMag TM - On the 96sideMagnet magnetic plate, discard the supernatant with a pipette;

[0047] ⑦Wash A: Add 8 μl / well of Washing Buffer A, move the plate back and forth 7-8 times to fully wash the microspheres, and discard the supernatant;

[0048] ⑧ Wash B: Add 8 μl / well of Washing Buffer B, and wash the microspheres back and forth 7-8 times. Discard the supernatant, and then add 10 μl / well of the pre-prepared reverse transcription (RT) reaction solution. The reagent preparation and reaction conditions are described in (2) below.

[0049] (2) Reverse transcription (RT) (10 μl system): The reagents required are shown in Table 1 below.

[0050] Reagent name volume <![CDATA[DEPC-H2O]]> 4.5μl 5×primerscript Buffer 2.0μl 2.5mM dNTP 2.0μl RNase Inhibitor 1μl Sample beads PrimerScript Ⅱ RTase 0.5μl Total volume 10μl

[0051] Reaction conditions: 42°C for 60 min (mixing every 20 min).

[0052] After the reaction, the 96-well plate was centrifuged at 600 × g and then placed on the DynaMag TM -96 sideMagnet magnetic plate, discard the supernatant with a pipette, and then add the pre-prepared TDT reaction solution at 10 μl / well. The reagent preparation and reaction conditions are as described below (3).

[0053] (3) Adding G-tail (TDT) (10 μl system): The reagents required are shown in Table 2 below.

[0054] Reagent name volume <![CDATA[H2O]]> 6.4μl 5×TdT buffer 2.0μl 10mM dGTP 0.5μl 0.1% BSA 1.0μl Sample beads TdT 0.1μl Total volume 10μl

[0055] Reaction conditions: 37°C for 40 min (mixing every 20 min).

[0056] After the reaction, the 96-well plate was centrifuged at 600 × g and then placed on the DynaMag TM -96 side Magnet plate, discard the supernatant with a pipette, and then add the pre-prepared first round PCR (1st PCR) reaction solution at 10 μl / well. The reagent preparation and reaction conditions are as described below (4).

[0057] (4) 1st PCR (10 μl system) (primer sequences refer to the primer sequence table): the reagents required for preparation are shown in Table 3 below:

[0058] Reagent name volume <![CDATA[H2O]]> 1.9μl 2×GC Buffer 5μl 2.5mM dNTP 1μl FP:AP3-dC (10 μM) 0.5μl RP1:Cg-1st (10μM) 0.5μl RP2:Ck-1st (10 μM) 0.5μl RP3:CI-RT (10 μM) 0.5μl PrimesTAR 0.1μl sample beads Total volume 10μl

[0059] Based on the PCR principle, the experimental reaction conditions of the 1st PCR are: ① pre-denaturation at 95°C for 3 min; ② denaturation at 95°C for 15 sec, annealing at 60°C for 5 sec, extension at 72°C for 1 min, 30-35 cycles, 30 cycles are preferred in this embodiment; ③ cyclic extension at 72°C for 5 min, and storage at 4°C.

[0060] (5) Second round of PCR (2nd PCR) (10 μl system) (primer sequences refer to Primer Sequence Table 1 and Primer Sequence Table 2): The reagents required for preparation are shown in Table 4 below:

[0061] Reagent name volume <![CDATA[H2O]]> 1.5μl 2×GC Buffer 5μl 2.5mM dNTP 1μl FP:MAC-AP3 / AP3 (10 μM) 0.5μl RP:Cg-nest / K20 / CI-nest (10 μM) 0.5μl PrimesTAR 0.5μl sample 1μl Total volume 10μl

[0062] Based on the PCR principle, the experimental reaction conditions of 2nd PCR are: ① pre-denaturation at 95°C for 3 min; ② denaturation at 95°C for 15 sec, annealing at 60°C for 5 s, extension at 72°C for 1 min, 30-35 cycles, 35 cycles are preferred in this embodiment; 72°C external extension for 5 min, and storage at 4°C.

[0063] After PCR, 4 μl of each well was taken for 1.5% agarose gel electrophoresis. The wells with the Gamma chain paired with the Kappa chain or Lamada chain were sent for sequencing.

[0064] (6) Amplification and construction of antibody expression cassette (BCR-ORF): PCR amplification of promoter region (CMV promoter), WPRE-γ (antibody gamma chain) and WPRE-κ (antibody kappa chain). The PCR amplification system is shown in Table 5 below.

[0065]

[0066] PCR amplification conditions were as follows: ① pre-denaturation at 95°C for 3 min; ② denaturation at 95°C for 15 sec, annealing at 56°C for 15 sec, extension at 72°C for 1 min, 30 cycles; ③ cyclic extension at 72°C for 5 min, storage at 12°C.

[0067] (7) Amplification of CMV and WPRE-γ / κ / 1 fragments and pre-ligation of CMV, BCR-Vγ / κ / 1, and WPRE-γ / κ / 1 by overlapping PCR. The experimental system is shown in Table 6 below.

[0068]

[0069] PCR amplification conditions were as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 50°C for 15 sec, extension at 72°C for 1.5 min, 10 cycles; extra-cyclic extension at 72°C for 5 min, and storage at 12°C.

[0070] (8) PCR amplification of BCR-γORF, BCR-κORF, and BCR-1: The experimental system is shown in Table 7 below.

[0071]

[0072]

[0073] PCR amplification program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 58°C for 15 sec, extension at 72°C for 1.5 min, 30 cycles; extra-cyclic extension at 72°C for 5 min, storage at 12°C.

[0074] After amplification, agarose gel electrophoresis and gel imaging were used to analyze whether the obtained antibody variable region gene size was correct. The experimental results were as follows: Figure 4 As shown, the marker is in the middle and the band is at 5000 bp.

[0075] BCR-γORF and BCR-κ / ORF ethanol precipitation: Take 30μl of the PCR products of BCR-γORF and BCR-κORF respectively and place them in 8-tube series, then add 120μl of anhydrous ethanol and 6μl of sodium acetate solution, mix thoroughly, and let stand at -80℃ for 30min; centrifuge at 10000rpm for 20min, discard the supernatant, rinse once with 200μl of 70% ethanol and anhydrous ethanol respectively, evaporate the ethanol completely at 56℃, add 40μl of sterile water, oscillate to fully dissolve the precipitate, and detect the concentration of the antibody variable region gene.

[0076] The leader primers used in S3 and S4 are shown in the following primer sequence table 1:

[0077]

[0078]

[0079]

[0080] The J-region primers used in S3 and S4 are shown in the following Primer Sequence Table 2:

[0081] primerID sequence IGHJ_01 GATGGGCCCTTGGTGGAGGGTGAGGAGACGGTGACCAGGGTGCCCTGGCCCCAGT IGHJ_02 GATGGGCCCTTGGTGGAGGGTGAGGAGACAGTGACCAGGGTGCCACGGCCCCAGA IGHJ_03 GATGGGCCCTTGGTGGAGGGTGAAGAGACGGTGACCATTGTCCCTTGGCCCCAGA IGHJ_04 GATGGGCCCTTGGTGGAGGGTGAGGAGACGGTGACCGTGGTCCCTTGCCCCCAGA IGKJ_01 GATGGTGCAGCCACAGTTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCC IGKJ_02 GATGGTGCAGCCACAGTTCGTTTGATTTCCACCTTGGTCCCTTGGCCGAACGTCC IGKJ_03 GATGGTGCAGCCACAGTTCGTTTTGATATCCACTTTGGTCCCAGGGCCGAAAGTGA IGKJ_04 GATGGTGCAGCCACAGTTCGTTTGATCTCCACCTTGGTCCCTCCGCCGAAAGTGA IGKJ_05 GATGGTGCAGCCACAGTTCGTTTAATCTCCAGTCGTGTCCCTTGGCCGAAGGTGA IGLJ_01 GGGGCAGCCTTGGGCTGACCTAGGACGGTGACCTTGGTCCCAGTTCCGAAGACAT IGLJ_02 GGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTTGGTCCCTCCGCCGAATACCA IGLJ_03 GGGGCAGCCTTGGGCTGACCTAAAATGATCAGCTGGGTTCCTCCACCAAATACAA IGLJ_04 GGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTCGGTCCCCTCACCAAACACCC IGLJ_05 GGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTCCGTCCCCTCACCAAACACCC IGLJ_06 GGGGCAGCCTTGGGCTGACCGAGGACGGTCACCTTGGTGCCACTGCCGAACACAT IGLJ_07 GGGGCAGCCTTGGGCTGACCGAGGACGGTCAGCTGGGTGCCTCCTCCGAACACAG IGLJ_08 GGGGCAGCCTTGGGCTGACCGAGGGCGGTCAGCTGGGTGCCTCCTCCGAACACAG

[0082] S5. The antibody variable region gene expression cassette obtained in S4 was transduced into 293T cells to express the antibody within 48 hours and the supernatant was collected. The RBD specificity of the supernatant was detected by ELISA to screen for RBD-specific fully human monoclonal antibodies.

[0083] (A) Dilute the antigen with PBS (final concentration 2 μg / mL), 10 μl / well, and coat the 384-well ELISA plate at 4°C overnight or 37°C for 2 hours (preferably at 4°C overnight in this example). NOTE: Centrifuge immediately after addition to ensure that the liquid is at the bottom.

[0084] The experimental system is shown in Table 8 below:

[0085] Reagent Name Catalog Number Original Concentration Final Concentration Dilution Ratio SARS-COV-2 RBD Cat:40592-V08H 200μg / mL 2μg / mL 1:100 Goat pab to Hu IgG-ALP Cat:ab97221 1mg / mL 2μg / mL 1:500

[0086] (B) Preparation of PBST (0.05% Tween 20, Cat#TB220): add 0.5 mL of Tween 20 to 1 L of PBS;

[0087] Wash the plate with PBST machine (Thermoscientific wellwash versa) or by hand (the plate after machine washing still needs to be manually tapped / centrifuged for 1 minute using a microplate centrifuge (MPC-P25) to make sure no water or bubbles are visible on the plate).

[0088] Blocking: Add 80 μl of 5% BSA (BioFroxx, Cat. NO: 4240GR100) (prepared in PBST) to the washed plate and place in an incubator at 37°C for 1 hour. Wash the plate with a PBST machine or by hand.

[0089] (C) Sample addition and standard. Standard: 10 μl / well original concentration 1 μg / mL, gradient dilution 250 ng / mL, 125 ng / mL, 62.5 ng / mL, 31.25 ng / mL, 15.63 ng / mL, 7.81 ng / mL, 3.9 ng / mL and 1.95 ng / mL. (Blocking solution dilution); Sample: cell supernatant transfected with antibody gene. Negative control / blank well: blocking solution 10 μl / well.

[0090] Incubate at 37°C for 30 min. Wash the plate in PBST machine or by hand.

[0091] (D) Secondary antibody was added at a concentration of 10 μl / well and then incubated at 37°C for 30 min.

[0092] The experimental system is shown in Table 9 below:

[0093] Secondary Antibody Name Catalog Number Original Concentration Final Concentration Dilution Ratio goat-anti-human IgG-ALP A18808 1.5mg / ml 0.3μg / ml 1:5000 Goat pab to Hu IgG-ALP Ab98532 0.5mg / ml 0.25μg / ml 1:2000

[0094] Wash the plate with PBST machine or by hand. 10μl / well PNPP (disodium p-nitrophenyl phosphate) was used to detect the OD (450mm) values ​​at 5min, 10min, 15min, 20min, 25min, 30min, 35min, 40min, 45min, 50min, 55min and 60min using (Thermoscientific Muttiskan GO). 50mg PNPP powder (Thermo, Prod#34045) + 40mL ddH2O + 10mL Diethanol aminesubstrate Buffer (5X), PNPP was stored at 4℃ in the dark.

[0095] The experimental results are as follows Figure 5 As shown, Figure 5 An OD value greater than 0.1 was considered positive.

[0096] The above description is only a preferred embodiment of the present invention, which is only illustrative and not restrictive of the present invention. A person skilled in the art will understand that many changes, modifications and even equivalent changes may be made to the present invention within the spirit and scope defined by the claims of the present invention, but all of them will fall within the scope of protection of the present invention.

Claims

1. A novel coronavirus SARS-COV-2 RBD-specific monoclonal antibody, characterized in that: The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO: 17; the amino acid sequence of the light chain variable region is shown in SEQ ID NO:

18.

2. A novel coronavirus SARS-COV-2 RBD-specific monoclonal antibody, characterized in that: The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO: 19; the amino acid sequence of the light chain variable region is shown in SEQ ID NO: 20.

Images