Melon stem and vine tissue-specific expression promoter pCmpmr10.1 and its application

Abstract

The invention discloses a melon stem and vine tissue-specific expression promoter pCmpmr10.1 and its application, belonging to the technical field of plant genetic engineering and molecular biology. In order to isolate and obtain a stem and vine-specific expression promoter from melon, and further provide a basic research theory for creating and screening melon materials resistant to powdery mildew, the invention provides a melon stem and vine tissue-specific expression promoter pCmpmr10.1 having a nucleotide sequence as shown in SEQ ID NO.1 or SEQ ID NO.2, and the promoter has the function of driving the Cmpmr10.1 gene to be specifically expressed in plant stems and vines, and can lay a theoretical foundation for improving the expression and accumulation level of exogenous genes in specific tissues of crops by genetic engineering means.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering and molecular biology, and in particular relates to a melon stem and vine tissue-specific expression promoter pCmpmr10.1 and an application thereof. Background Art

[0002] Powdery mildew of melon (Cucumis melo L.) is one of the important diseases that harm melon production and can occur throughout the growth period of melon. After being infected with powdery mildew, melons show white spots at the invasion point, and the plants turn yellow and wilt in the later stage of growth. The photosynthesis capacity decreases, causing premature aging and death. Because powdery mildew develops and spreads very quickly, it can even occur repeatedly in some areas, causing damage throughout the year, seriously affecting the yield and quality of melons. Therefore, the use of molecular biological technology to study the powdery mildew resistance of melons, identify genes that improve powdery mildew resistance, and analyze gene functions is of great significance for creating excellent disease-resistant materials and the prevention and control of powdery mildew.

[0003] The prior art uses the disease-resistant melon material MR-1 and the disease-susceptible melon material M4-7 as parents to construct a genetic population, locates a gene highly linked to melon powdery mildew resistance on chromosome 10 (Gene ID: MELO3C012438, annotation: MLO-like protein), named Cmpmr10.1, and finds that the expression level of this gene in the disease-susceptible melon material is significantly higher than that in the disease-resistant material, and has tissue specificity. Other studies have found that the expression level of the MLO gene rises sharply in the early stage of powdery mildew induction, proving that the MLO gene assists pathogens in invading host plants in the early stage of infection. The wild-type MLO gene can regulate the formation of papillae in epidermal cells, inhibit the burst of hydrogen peroxide in the cell wall at the site of fungal infection in the epidermal cell wall, and inhibit the secondary oxidation burst and death of mesophyll cells, which is conducive to the invasion of pathogens and weakens the defense ability of plants. This type of gene negatively regulates plant defense ability and cell death.

[0004] Currently, there are few melon tissue-specific promoters reported. The isolation of a stem-specific expression promoter from melon, cloning and functional analysis of the promoter will provide basic research theory for studying the function of the pCmpmr10.1 promoter in melon, and for creating and screening melon materials resistant to powdery mildew. This is of great significance for accelerating the breeding process of melon powdery mildew resistance. Summary of the invention

[0005] In order to isolate and obtain stem-specific expression promoters from melons, and further provide a basic research theory for creating and screening melon materials resistant to powdery mildew, the present invention provides the following technical solutions:

[0006] The first object of the present invention is to provide a melon stem and vine tissue-specific expression promoter pCmpmr10.1, the nucleotide sequence of the promoter pCmpmr10.1 is shown in SEQ ID NO.1 or SEQ ID NO.2.

[0007] The second object of the present invention is to provide a primer set for amplifying the above-mentioned melon stem and vine tissue-specific expression promoter pCmpmr10.1, when the nucleotide sequence of the melon stem and vine tissue-specific expression promoter pCmpmr10.1 is as shown in SEQ ID NO.1, the nucleotide sequence of the primer set is as shown in SEQ ID NO.3 and SEQ ID NO.4, when the nucleotide sequence of the melon stem and vine tissue-specific expression promoter pCmpmr10.1 is as shown in SEQ ID NO.2, the nucleotide sequence of the primer set is as shown in SEQ ID NO.5 and SEQ ID NO.6.

[0008] The third object of the present invention is to provide a recombinant vector containing the above-mentioned melon stem and vine tissue-specific expression promoter pCmpmr10.1.

[0009] The fourth object of the present invention is to provide an expression cassette containing the above-mentioned melon stem and vine tissue-specific expression promoter pCmpmr10.1.

[0010] The fifth object of the present invention is to provide a recombinant bacterium containing the above-mentioned melon stem and vine tissue-specific expression promoter pCmpmr10.1.

[0011] The sixth object of the present invention is to provide the use of the above-mentioned melon stem and vine tissue-specific expression promoter pCmpmr10.1 or the above-mentioned primers or the above-mentioned recombinant vector or the above-mentioned expression cassette or the above-mentioned recombinant bacteria in promoting the expression of Cmpmr10.1 gene in plants.

[0012] In one embodiment of the present invention, the application is to obtain transgenic plants containing the melon stem and vine tissue-specific expression promoter pCmpmr10.1.

[0013] In one embodiment of the present invention, the plant is melon.

[0014] The seventh objective of the present invention is to provide the use of the above-mentioned melon stem and vine tissue-specific expression promoter pCmpmr10.1 or the above-mentioned primers or the above-mentioned recombinant vector or the above-mentioned expression cassette or the above-mentioned recombinant bacteria in plant genetic improvement.

[0015] In one embodiment of the invention, the plant comprises Cucumis melon.

[0016] Beneficial effects of the present invention:

[0017] The melon stem and vine tissue-specific expression promoter pCmpmr10.1 obtained by the present invention is derived from powdery mildew susceptible melon M4-7. The melon stem and vine tissue-specific expression promoter pCmpmr10.1 fragment has the following characteristics: (1) it is located at the 5' end and upstream of the Cmpmr10.1 gene; (2) the base length is 1805 bp (as shown in SEQ ID NO.1) or 445 bp (as shown in SEQ ID NO.2); (3) it has the necessary site for initiating transcription and the transcription start point; (4) the promoter can drive the specific expression of the target gene in the plant stem and vine, laying a theoretical foundation for improving the expression and accumulation level of foreign genes in specific tissues of crops by genetic engineering means. The present invention also discloses a recombinant expression vector containing a melon stem and vine tissue-specific expression promoter pCmpmr10.1, wherein a downstream gene is specifically expressed in plant stems and vines under the regulation of the tissue-specific expression promoter pCmpmr10.1 of the recombinant expression vector, providing a tool for studying the efficient, stable and specific expression of genes in plant stems and vines in the field of plant genetic engineering, and having broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the result of the analysis of the expression pattern of the melon Cmpmr10.1 gene; Figure 1 Figure a shows the expression pattern analysis results of Cmpmr10.1 gene in disease-resistant melon MR-1. Figure 1 Figure b shows the expression pattern analysis results of Cmpmr10.1 gene in diseased melon M4-7;

[0019] Figure 2 This is a diagram showing the GUS staining of the melon pCmpmr10.1-445bp promoter expression vector and the analysis results of the GUS gene expression level; Figure 2 a in the figure is the result of GUS staining of melon pCmpmr10.1-445bp promoter expression vector, 1 # , 2 # and 3 # They are stems and vines at different stages. # For leaves, Figure 2 Figure b shows the expression analysis results of the melon tissue-specific promoter pCmpmr10.1-445bp in tomato stems and leaves driven by GUS. DETAILED DESCRIPTION

[0020] The present invention is further described in detail below in conjunction with specific embodiments and drawings. Except for the contents specifically mentioned below, the processes, conditions, experimental methods and reagents for implementing the present invention are common knowledge in the art and conventional products on the market, and the present invention has no particular limitations.

[0021] Melon material MR-1 resistant to powdery mildew of melon and melon material M4-7 susceptible to powdery mildew of melon were disclosed in an article entitled “CmPMR and CmPMrs are responsible for resistance to powdery mildew caused by Podosphaera xanthii race 1 in Melon”, and the doi of the article is 10.1007 / s00122-021-04025-4.

[0022] Extraction method of melon genomic DNA:

[0023] The method for extracting genomic DNA was based on the method of Murray et al. (1980) (Murray M., Thompson WF, Rapid isolation of high molecular weight plant DNA [J]. Nucl. Acid. Res., 1980, 8: 668-673.), and was improved on this basis.

[0024] The specific steps are as follows:

[0025] ① Wash and dry the collected young true leaves with sterile water, take 0.2 g and put them into a 1.5 mL centrifuge tube, add liquid nitrogen and grind them thoroughly into white powder, add 800 μL of 2% CTAB solution preheated at 65°C (2% CTAB, 100 mmol / L Tris-HCl pH=8.0), 1.4 mol / L NaCl, 20 mmol / L EDTA pH=8.0, 2% β-mercaptoethanol) and mix well, place in a 65°C water bath for 1 hour, and shake gently every 10 minutes.

[0026] ②Take out the centrifuge tube, wait for it to cool to room temperature, and centrifuge at 13000rpm for 10 minutes. Aspirate the supernatant and place it in a new centrifuge tube. To prevent mechanical shear force from damaging the DNA, the tip of the pipette used for transfer needs to be cut off with scissors in advance to expand the pipette port.

[0027] ③ Add 750 μL of chloroform:isoamyl alcohol (24:1, V / V) solution to the cell wall, mix thoroughly, let it stand for 10 minutes, and then centrifuge at 13000 rpm for 10 minutes.

[0028] ④ Take out the centrifuge tube and use the same method as above to suck out 700 μL of supernatant with the pipette tip against the wall and place it in a new centrifuge tube.

[0029] ⑤ Add 700 μL of chloroform:isoamyl alcohol (24:1, V / V) solution to the wall, gently shake the centrifuge tube to fully mix the solution, let it stand for 10 minutes, then centrifuge at 13000 rpm for 10 minutes.

[0030] ⑥ Aspirate 650 μL of supernatant and place it in a new tube, add 2 μL RNase (10 mg / mL), mix well, and place in a 37°C water bath for 2 hours.

[0031] ⑦ Add 650 μL of chloroform:isoamyl alcohol (24:1, V / V) solution to the cell wall, mix thoroughly, let it stand for 10 minutes, and then centrifuge at 13000 rpm for 10 minutes.

[0032] ⑧ Aspirate 550 μL of supernatant from the tube and place it in a new tube. Add 550 μL of -20℃ pre-cooled isopropanol (add it to the tube wall). Close the tube cap tightly, turn it upside down several times, and place it in a -20℃ refrigerator for 60 minutes.

[0033] ⑨Take out the centrifuge tube and centrifuge it at 13000rpm for 10min. Carefully discard the supernatant and retain the sediment at the bottom of the centrifuge tube.

[0034] ⑩ Wash the precipitate three times with pre-cooled 70% ethanol, place the centrifuge tube in a clean bench, blow dry with sterile air, and add 200 μL ddH 2 Dissolve in 0 and store at -20°C until use.

[0035] Example 1: Obtaining the melon stem and vine tissue-specific expression promoter pCmpmr10.1

[0036] The promoter sequence of the melon Cmpmr10.1 gene (pCmpmr10.1-1805bp) required for the experiment was obtained from the Cucurbitaceae genome website (http: / / cucurbitgenomics.org / organism / 18), and the primer sequence was designed using primer 6 (see Table 1). The core promoter sequence of the Cmpmr10.1 gene was analyzed and predicted using online websites (https: / / alggen.lsi.upc.es / and https: / / www.dna.affrc.go.jp / PLACE / ), which was 445bp of pCmpmr10.1-445bp, and the primers of the promoter sequence were designed (see Table 1). The genomic DNA of the powdery mildew-susceptible melon material M4-7 was extracted, and PCR amplification was performed using the DNA of the powdery mildew-susceptible melon material M4-7 as a template to obtain the target gene fragment. The PCR amplification system and program used in this experiment are shown in Tables 2 and 3.

[0037] Table 1 Primer information for cloning the melon stem and vine tissue-specific expression promoter pCmpmr10.1

[0038]

[0039] Table 2 PCR reaction system for cloning the melon stem and vine tissue-specific expression promoter pCmpmr10.1

[0040]

[0041]

[0042] Table 3 PCR reaction procedures for cloning the melon stem and vine tissue-specific expression promoter pCmpmr10.1

[0043]

[0044] The PCR product was electrophoresed on 1% agarose gel and the target fragment was recovered and purified according to the instructions of the gel recovery kit. The target fragment was connected to the pMD18-T cloning vector. The specific steps are as follows:

[0045] 1) Gel recovery reaction of target fragment, refer to the gel recovery kit ( Quick Gel Extraction Kit, Code No. EG101-01) instructions.

[0046] 2) Connect the target fragment to the pMD18-T vector: Prepare a connection reaction system to connect the target fragment to the pMD18-T vector, mix well, and connect at 25°C for 1 hour.

[0047] 3) The ligation product was transformed into E. coli. The transformation method was carried out according to the instructions of the competent cell E. coli DH5α (Code No. 9057, Takara).

[0048] 4) PCR identification of positive clones.

[0049] A single colony with complete and full morphology was randomly picked for colony PCR reaction. The PCR product was detected by 1% agarose gel electrophoresis. The bacterial solution identified as a positive clone was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing to obtain the target gene sequence.

[0050] pCmpmr10.1-1805bp (SEQ ID NO.1):

[0051]

[0052] pCmpmr10.1-445bp (SEQ ID NO.2):

[0053] TTCAAGCAAATGTTAACCATATGTTTTAAGTTTATATTTCTTTTTTCTTCAAAGTACCTCCAGAACCCCTTACTTTGACTTAGAAACCATTTAAAAAACATATAGATACGAAAATCAATTTATGCTATTGAAAAAGCAATATATAATTATTATTTCTTTTTTCAAAAAAGTGAAGCCTCAAGTCTAACACAATATAAGATGGTCCCTTTTCTCTCTCATCC TTTGACAAACCCTTCTAGGAAAGGGTCAAAATGAAATGAGTCATCATTCATTTCCTCTCCTTATTGGTTGCAGACCTTCTTATGCTTAAGTCTTTTTAACTAACTGCCTCTCCACATGCATAAGAAAATATAAATACGTACGAAGACAGTGGTGCTTTGCATCTACTTGTTTCATCCTTCTCCTCCTAGAATTTCATTTCTTCGTTGTAAGCTTGAGAGCTTTG

[0054] Example 2: Real-time fluorescence quantitative PCR for melon tissue-specific expression of Cmpmr10.1 gene

[0055] The full-length coding sequence (CDS) of Cmpmr10.1 was obtained from the Cucurbitaceae database melon reference genome DHL92 v3.6.1 (http: / / cucurbitgenomics.org / organism / 18). The NCBI database (http: / / www.ncbi.nlm.nih.gov / tools / primer-blast) was used to design specific primers for real-time fluorescence quantitative PCR (see Table 4). Real-time fluorescence quantitative PCR was performed using melon cDNA samples from MR-1 and M4-7 as templates, with 3 biological replicates and 3 technical replicates for each sample. The melon Actin gene (Gene ID: MELO3C008032.2) was used as a reference to design primers. The relative gene expression was calculated with reference to 2 -ΔΔCT Method: The expression level of MR-1 leaves at 0 h after inoculation with powdery mildew was used as calibration.

[0056] Table 4 Primer sequence information of real-time fluorescence quantitative PCR for melon tissue-specific expression of Cmpmr10.1 gene

[0057]

[0058] Table 5 Real-time fluorescence quantitative PCR reaction system for melon tissue-specific expression of Cmpmr10.1 gene

[0059]

[0060] Table 6 Real-time fluorescence quantitative PCR reaction procedures for melon tissue-specific expression of Cmpmr10.1 gene

[0061]

[0062] Real-time fluorescence quantitative PCR analysis of melon tissue-specific expression of Cmpmr10.1 gene revealed significant differences in the expression level of this gene 24 h after inoculation. The expression level in powdery mildew-susceptible melon M4-7 was significantly higher than that in disease-resistant melon MR-1, and the expression level in melon stems was significantly higher than that in leaves at the same time (see Figure 1 ).

[0063] Example 3: Construction of melon tissue-specific promoter pCmpmr10.1 vector and Agrobacterium-mediated genetic transformation of tomato

[0064] The obtained melon tissue-specific promoter pCmpmr10.1-445bp fragment was used to construct a melon tissue-specific promoter pCmpmr10.1-445bp analysis vector using the homologous recombination method, and homology arm primers were designed. The sequences are as follows: pBWA(V)HG-pmr10.1pro-F (SEQ ID NO.11): cgcaaaccgcctgcaCTGCAGTTCAAGCAAATGTTAACCATATG, pBWA(V)HG-pmr10.1pro-R (SEQ ID NO.12): ttaccctcagatctaCCATGGCAAAGCTCTCAAGCTTACAAC. The Cmpmr10.1 gene promoter fragment was amplified by PCR and the PCR product was purified and then connected to the enzyme-cut pBWA(V)HG expression vector. After the sequencing results were correct, the constructed vector was transformed into Agrobacterium competent cells. Agrobacterium transformation was used to infect tomato cotyledons, and transformed seedlings were obtained after screening and rooting culture. Tomato genomic DNA was extracted using the CTAB method, and PCR detection was performed to obtain positive transformed seedlings.

[0065] Positively transformed tomato leaves and stems were collected, and a GUS staining kit (GUSBlue KIT, Beijing Huayueyang Biotechnology Co., Ltd.) was used. The leaves and stems were cut into small pieces using a vacuum device, and then vacuum-infected five times, each time for 10 min, with an interval of 1 min. Untransformed tomatoes were used as controls. After the infection, the samples were incubated at 37°C for 12 h, and the chlorophyll of the samples was removed with 75% ethanol until the control turned white. The samples were observed and photographed for preservation.

[0066] Real-time fluorescence quantitative primers were designed using the sequence information of the GUS gene in the NCBI database. The sequences are as follows: pBWA(V)HG-pmr10.1pro-GUS-F (SEQ ID NO.13): CATGAAGATGCGGACTTGCG, pBWA(V)HG-pmr10.1pro-GUS-R (SEQ ID NO.14): ATGCCATGTTCATCTGCCCA. Real-time fluorescence quantitative PCR was performed using cDNA from transformed tomato leaves and stems as templates and pBWA(V)HG-pmr10.1pro-GUS-F / R as primers. Three biological replicates and three technical replicates were performed for each sample period. The internal reference primers were designed with tomato actin gene (ACT), and the sequences were as follows: pBWA(V)HG-Cmpmr10.1pro-GUS-ACT-(SEQ ID NO.15)F: CGGTGACCACTTTCCGATCT, pBWA(V)HG-Cmpmr10.1pro-GUS-ACT-R (SEQ ID NO.16): TCCTCACCGTCAGCCATTTT. Relative gene expression was calculated according to 2 -ΔΔCT Method, the expression level of transformed tomato leaves was used as a reference, and the statistics were calculated and plotted (see Figure 2 ).

[0067] Through qualitative and quantitative analysis of tomato leaves and stems after GUS staining, it was found that the expression level of melon tissue-specific promoter pCmpmr10.1-445bp sequence driven by GUS was significantly different in tomato stems and leaves.

[0068] In summary, the melon tissue-specific promoter pCmpmr10.1-445bp of the present invention can be specifically and highly expressed in melon stems and vines infected with powdery mildew.

[0069] Although the present invention has been disclosed as above in the form of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A melon stem and vine tissue-specific expression promoter pCmpmr10.1 Specific expression in melon stems infected with powdery mildew Cmpmr10.1 The application in gene, characterized in that The melon stem and vine tissue-specific expression promoter pCmpmr10.1 The nucleotide sequence is shown in SEQ ID NO.

2.

2. A method for amplifying the melon stem and vine tissue-specific expression promoter described in claim 1 pCmpmr10.1 The primer set was specifically expressed in the melon stems and vines infected with powdery mildew Cmpmr10.1 The application in gene, characterized in that The nucleotide sequences of the primer set are shown in SEQ ID NO.5 and SEQ ID NO.

6.

3. A method comprising the melon stem and vine tissue-specific expression promoter as claimed in claim 1 pCmpmr10.1 Specific expression of recombinant vector in melon stems infected with powdery mildew Cmpmr10.1 Application in genes.

4. A method comprising the melon stem and vine tissue-specific expression promoter as claimed in claim 1 pCmpmr10.1 The expression cassette of the PCR product was specifically expressed in melon stems infected with powdery mildew. Cmpmr10.1 Application in genes.

5. A method comprising the melon stem and vine tissue-specific expression promoter as claimed in claim 1 pCmpmr10.1 The recombinant bacteria expressed specifically in the stems of melon infected with powdery mildew Cmpmr10.1 Application in genes.

Images