Method for extracting okra polysaccharide by microbial fermentation

Abstract

The application discloses a method for extracting okra polysaccharide by microbial fermentation, and the microbial fermentation pretreatment is added before the okra polysaccharide is extracted by hot water and ultrasonic waves. The fermentation strain HQK5-17 is obtained by targeted separation and screening according to the ability of hydrolyzing the cell wall of okra and by mutation. The HQK5-17 grows moderately in the okra powder added with sucrose, produces various hydrolytic enzymes, and then the okra powder fermented is hydrolyzed by adding water and keeping warm, so that the cellulose, hemicellulose and pectin and other substances in the cell wall are hydrolyzed, which is helpful to the dissolution of the combined okra polysaccharide in the ultrasonic water extraction, thereby the extraction yield of the okra polysaccharide can be obviously improved. Compared with the direct extraction without the fermentation pretreatment, the extraction yield of the okra polysaccharide can be increased by 30.5%.

Description

(I) Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a method for extracting okra polysaccharides using microbial fermentation. (II) Background Technology

[0002] Okra, scientifically known as *Abelmoschus esculentus*, is also commonly called lady's finger or okra. It is an annual herbaceous plant belonging to the genus *Abelmoschus* of the Malvaceae family. The fruit, flowers, leaves, and buds of okra are all edible. The young pods are what people commonly refer to as okra. It is rich in polysaccharides, flavonoids, protein, vitamins, minerals, and fats, among other bioactive components, and has high nutritional and medicinal value. It is beneficial for digestion, combating fatigue, strengthening the kidneys, and boosting immunity. In Europe and America, okra has long been used as a vegetable for athletes and a health supplement for the elderly. Although okra was introduced to my country from India in the 1990s, it was not widely cultivated as a vegetable for a long time until recent years when its nutritional value has been recognized, leading to its increasing popularity. Okra is grown in large quantities in many regions of my country, including Hainan, Guangdong, Guangxi, Fujian, Zhejiang, Jiangsu, Hunan, Hubei, and Shandong.

[0003] Plant polysaccharides are natural, multifunctional active ingredients with various effects such as anti-fatigue, anti-oxidation, antibacterial, anti-cancer, blood sugar and lipid reduction, and improvement of immunity. As a plant with both medicinal and edible properties, okra has a high polysaccharide content. Studies have shown that okra polysaccharides have good biological activity. For example, Ren Dandan et al. showed that okra polysaccharides can inhibit the growth of various tumor cells [Ren Dandan, Chen Gu. Inhibitory effect of okra polysaccharide components on the proliferation of human tumor cells. Food Science, 2010, 31(21):353-356]; Zhao Huanhuan et al. showed that okra polysaccharides have excellent antioxidant activity [Zhao Huanhuan, Jia Lu, Pei Yingxin. Determination of in vitro antioxidant activity of crude okra polysaccharides. Journal of Zhengzhou University (Medical Edition), 2012, 47(1):40-43]. In recent years, the planting area of ​​okra in China has been increasing year by year. Therefore, the development and application of okra polysaccharides is of great significance for improving its added value and resource utilization.

[0004] Currently, there are numerous research reports on okra polysaccharide extraction methods. The basic method is hot water extraction followed by ethanol precipitation (referred to as "water extraction and alcohol precipitation"). Based on this, microwave, ultrasonic, and enzymatic extraction methods are used as auxiliary extraction methods. Different extraction methods have their own advantages and disadvantages. For example, the conventional water extraction and alcohol precipitation method is simple to operate but suffers from low extraction yield and long extraction time; microwave-assisted extraction has a short extraction time and high efficiency, but the polysaccharides are easily damaged by microwaves, resulting in a decrease in activity; ultrasonic-assisted extraction requires low-end equipment and does not significantly increase extraction costs, but its effect on improving extraction yield is not significant; enzymatic extraction can significantly improve extraction yield, and the conditions are mild, resulting in good polysaccharide activity, but the disadvantage is increased enzyme usage costs.

[0005] Among the enzymatic methods for extracting active ingredients from plants, cellulase is the most commonly used, followed by pectinase and protease. Since the cell walls of plants are composed of substances such as cellulose, hemicellulose, lignin, and pectin, using a single enzyme has very limited effect on improving the extraction yield. Many studies use multiple enzymes (complex enzymes) simultaneously. For example, Yong Chengwen used cellulase and pectinase to extract polysaccharides from okra [Yong Chengwen, Wang Wenling, Li Xiangqiu, et al. Response surface optimization of complex enzyme method for extracting okra polysaccharides. China Food Additives, 2018(4):99-105]. The polysaccharide yield was significantly improved compared with non-enzymatic extraction methods. However, the use of multiple enzymes undoubtedly increases the extraction cost.

[0006] Microorganisms can produce a variety of enzymes that hydrolyze plant tissues; plant debris and decaying leaves in nature are decomposed by these enzymes. In particular, some molds in nature can produce a variety of enzymes, including cellulase, hemicellulase, ligninase, pectinase, and protease. Therefore, if a suitable mold is used for direct fermentation pretreatment of okra, and the growth stage and enzymatic hydrolysis conditions are well controlled, the dissolution of bound polysaccharides can be effectively promoted, thereby increasing the polysaccharide extraction yield. Furthermore, compared to enzymatic-assisted extraction methods, this saves on enzyme costs.

[0007] To improve the extraction yield of okra polysaccharides, this invention improves the conventional water extraction and alcohol precipitation method by adding a microbial fermentation pretreatment step, which can significantly increase the extraction yield of okra polysaccharides. (III) Summary of the Invention

[0008] The purpose of this invention is to provide a method for extracting okra polysaccharides using microbial fermentation, applying microbial fermentation technology to the extraction of okra polysaccharides. After fermentation of okra with the microorganism *Penicillium chrysogenum* HQK5-17, followed by hot water ultrasonic extraction, the polysaccharide extraction yield is significantly improved.

[0009] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0010] This invention provides a method for extracting okra polysaccharides using microbial fermentation. The method is as follows: (1) Add spore liquid of Penicillium marinum HQK5-17 to okra powder, stir evenly, and ferment at 28-30℃ for 56-60h to obtain okra fermentation product; Penicillium marinum HQK5-17 is deposited at Guangdong Provincial Microbial Culture Collection Center, accession number GDMCC No:63778, accession date September 10, 2023, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province; postcode 510070; (2) Add deionized water to okra fermentation product, stir evenly, and keep warm at 35-40℃ for 4-5h, then filter after ultrasonic water extraction, concentrate the filtrate to obtain okra water extract concentrate; (3) Add ethanol to okra water extract concentrate to precipitate polysaccharides, wash the precipitate with acetone, and vacuum dry to obtain okra polysaccharides.

[0011] Furthermore, the okra powder mentioned in step (1) is the young pods of the plant Abelmoschus esculentus, which are washed, dried at 85°C, and then pulverized through a 60-mesh sieve.

[0012] Further, the preparation method of the *Penicillium* HQK5-17 spore solution in step (1) is as follows: *Penicillium* HQK5-17 spores preserved at low temperature are inoculated onto potato dextrose agar (PDA) plates and cultured at 28–30℃ for 72–80 h. Sterile sucrose aqueous solution is added to the culture, and the spores are suspended by stirring with an inoculation loop to obtain the spore solution. Preferably, the spore concentration of the spore solution is adjusted to 1×10⁻⁶ using sterile sucrose aqueous solution. 7 –2×10 7 The concentration of sucrose in the sterile sucrose aqueous solution is 20–30 g / L, and it is sterilized by autoclaving at 115°C for 15 min. The PDA plate culture medium is a commercially available potato dextrose agar medium, purchased from Qingdao Haibo Biotechnology Co., Ltd., prepared with tap water at a concentration of 46 g / L, with natural pH, and sterilized by autoclaving at 121°C for 15 min.

[0013] Furthermore, the volume of the spore liquid of *Penicillium chrysogenum* HQK5-17 used in step (1) is 3–4 mL / g based on the mass of okra powder.

[0014] Further, the preparation method of okra water extract concentrate in step (2) is as follows: add deionized water to okra fermentation product, stir evenly, keep warm at 35-40℃ for 4-5 hours, then transfer to an ultrasonic cleaner at 75-80℃, and ultrasonically extract at 200W for 40-50 minutes. After ultrasonic water extraction, filter while hot using a Buchner funnel, and concentrate the filtrate under reduced pressure at 60℃ and -0.1Mpa to 1 / 16-1 / 14 of the original volume to obtain okra water extract concentrate. The volume of deionized water added is 35-40mL / g based on the mass of okra powder before fermentation.

[0015] Further, the preparation method of okra polysaccharide in step (3) is as follows: add 3-4 times the volume of anhydrous ethanol to the okra water extract concentrate to make the ethanol volume fraction of the system reach 75%-80%, let it stand at 4℃ for 14-18h, centrifuge at 8000r / min for 5-10min, collect the precipitate, wash the precipitate once with acetone at 1.5-2.0mL / g based on the mass of the raw okra powder, centrifuge again, and then dry the precipitate under vacuum at 50℃ and -0.1Mpa to constant weight to obtain okra polysaccharide.

[0016] Compared with existing technologies, the beneficial effects of this invention are mainly reflected in the addition of microbial fermentation pretreatment before ultrasonic extraction of okra polysaccharides in hot water. The fermentation strain used, *Penicillium chrysogenum* HQK5-17, was specifically isolated and screened for its ability to hydrolyze okra cell walls and obtained through mutagenesis. *Penicillium chrysogenum* HQK5-17 grows moderately in okra powder with added sucrose, producing various hydrolytic enzymes. Subsequently, the fermented okra powder is incubated with water for enzymatic hydrolysis, hydrolyzing substances such as cellulose, hemicellulose, and pectin in the cell walls. This facilitates the dissolution of bound okra polysaccharides during ultrasonic water extraction, thereby significantly improving the polysaccharide extraction yield. Compared with direct extraction without fermentation pretreatment, the okra polysaccharide extraction yield can be increased by 30.5%. (iv) Description of the attached drawings

[0017] Figure 1 Standard curve for polysaccharide determination using the phenol-sulfuric acid method.

[0018] Figure 2 Standard curve for glucose determination using the DNS method.

[0019] Figure 3 Photograph of *Penicillium chrysogenum* HQK5-17 colonies after 5 days of incubation at 28°C on a PDA. (V) Detailed Implementation

[0020] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto.

[0021] In this embodiment of the invention, the okra is the young pod of the plant *Abelmoschus esculentus*, with a length of 10–15 cm. The okra powder is made by washing fresh okra with tap water, drying it at 85°C, and then pulverizing it through a 60-mesh sieve.

[0022] In this embodiment of the invention, the PDA plate culture medium is a commercially available potato dextrose agar medium, purchased from Qingdao Haibo Biotechnology Co., Ltd. It is prepared with tap water at a concentration of 46 g / L, with a natural pH, and sterilized by high-pressure steam at 121°C for 20 min. Before solidification, it is poured into sterile petri dishes with a diameter of 9 cm, 15–20 mL per dish.

[0023] In this embodiment of the invention, the okra polysaccharide content was determined using the phenol-sulfuric acid method. Specifically, the okra polysaccharide extract was diluted with deionized water at an appropriate ratio (to estimate that the polysaccharide concentration in the sample was within the range of the standard curve). A sample solution with a concentration of 0.2 mg / mL was prepared from the solid okra polysaccharide extract using deionized water. 1 mL of the sample solution was pipetted into a 10 mL stoppered tube, 1 mL of 5% (v / v) phenol aqueous solution was added, and the mixture was shaken well. Then, 5 mL of concentrated sulfuric acid (98% (w / v)) was quickly added, and the mixture was shaken well and heated in a boiling water bath for 15 min, then cooled to room temperature. Using 1 mL of deionized water instead of the sample solution as a reference, the absorbance at a wavelength of 490 nm was measured (A). 490 A was determined in glucose samples of different concentrations using the same method. 490 Plot glucose concentration—A 490 Standard curve ( Figure 1 The regression equation was obtained, and the polysaccharide content in the okra polysaccharide sample was calculated and determined using the regression equation.

[0024] The yield of okra polysaccharide extraction is calculated according to Formula 1:

[0025]

[0026] Example 1: Isolation and screening of microbial strains for fermenting okra

[0027] The microbial strains for fermenting okra were isolated and screened according to the following steps:

[0028] (1) 5g of okra powder was placed in a 50-mL Erlenmeyer flask, along with 0.5g of potting soil and 20mL of sterile physiological saline. The mixture was stirred thoroughly and incubated at 28℃ for 72h. The enriched culture contaminated with mold was then diluted with sterile physiological saline to a concentration of 1×10⁻⁶. -6 1×10 -7 1×10 -8 1×10 -9After dilution, 0.1 mL of the diluted solution was spread onto potato dextrose agar (PDA) plates and incubated at 28°C for 48 h. Colonies of different colors and morphologies were then transferred to fresh PDA plates and incubated at 28°C for 80 h to obtain 9 pure cultured mold strains. The strain numbers are shown in Table 1.

[0029] (2) 10 mL of sterile sucrose aqueous solution was added to fresh plate cultures of the nine strains, and the spores were suspended by stirring with an inoculation loop. The spore solutions were then transferred to sterile test tubes, and the spore concentration was adjusted with sterile sucrose aqueous solution to ensure that the spore solutions of different strains were at a concentration of 1 × 10⁻⁶. 7 –2×10 7 The spore concentration of each strain was within the range of spores / mL. The sterile sucrose aqueous solution had a concentration of 20 g / L and was sterilized by high-pressure steam at 115°C for 15 min.

[0030] (3) Add 1g of okra powder to each of the nine 50-mL Erlenmeyer flasks that have been dry-heat sterilized at 160℃ for 2h, and then add 3mL of the mold spore liquid prepared in step (2) (the volume of the liquid is 3.0mL / g based on the mass of the okra powder). After stirring evenly, seal the Erlenmeyer flasks with 8 layers of gauze and incubate at 28℃ for 60h to obtain okra fermentation product.

[0031] (4) In step (3), 40 mL of deionized water (material-to-liquid ratio of 1:40 g:mL) was added to all the okra fermentation products of each strain. The mixture was stirred evenly and kept warm in a 35℃ water bath for 5 h. Then, it was transferred to an ultrasonic cleaner at 75℃ and ultrasonically extracted at 200W for 50 min. After ultrasonic water extraction, the mixture was filtered through a Buchner funnel while still hot. 1 mL of the filtrate was taken into a 10-mL centrifuge tube, and 4 mL of anhydrous ethanol (ethanol volume fraction of 80%) was added. After thorough shaking, the mixture was allowed to stand at 4℃ for 14 h. After centrifugation at 8000 r / min for 5 min, the supernatant was discarded, and 5 mL of deionized water was added to dissolve the supernatant. The soluble polysaccharide content in the extract was determined by the phenol-sulfuric acid method.

[0032] Following steps (3)–(4), 3 mL of sterile sucrose aqueous solution (concentration 20 g / L) was added to 1 g of okra powder to serve as a blank fermentation control without mold inoculation; following step (4), 40 mL of cellulase phosphate buffer (pH 6.0, 0.2 mol / L, replacing deionized water) with an activity of 250 U / mL was added to 1 g of okra powder to serve as a cellulase enzymatic hydrolysis control; following step (4), 40 mL of deionized water was added to 1 g of okra powder for direct polysaccharide extraction to serve as a direct extraction control. The polysaccharide extraction yields of okra fermented with different strains and the control are shown in Table 1.

[0033] Table 1. Polysaccharide extraction yield from okra fermented with different strains and the control.

[0034]

[0035] As shown in Table 1, the blank fermentation control, which included sterile sucrose solution but was not inoculated with mold, showed a small amount of bacterial growth, but the polysaccharide extraction yield was not significantly different from the direct extraction control. After fermentation with most strains, the polysaccharide extraction yield of okra did not significantly increase; in fact, the yield decreased significantly with some strains, such as HQK4 and HQK7. This indicates that the microbial strains used to ferment okra to improve polysaccharide extraction yield exhibit species selectivity. After fermentation with strain HQK5, the polysaccharide extraction yield of okra was 7.83%, an increase of 15.7% compared to the 6.77% of the unfermented control, significantly better than the 7.24% polysaccharide yield extracted by cellulase enzymatic hydrolysis (an increase of 8.15%). Therefore, strain HQK5 was selected in this invention as the fermentation strain for improving the polysaccharide extraction yield of okra.

[0036] Example 2: Microbial strain mutagenesis and selection for fermented okra

[0037] Mutagenesis breeding was performed on strain HQK5 to screen for strains with excellent fermentation performance. The specific method is as follows:

[0038] (1) Preparation of spore suspension: After activating strain HQK5 on PDA agar at 28℃ for 48 h, 5 mL of sterile physiological saline was added, and the spores were suspended by stirring with an inoculation loop. 1 mL of the spore suspension was transferred to an Erlenmeyer flask containing 50 mL of sterile physiological saline (with 20–30 glass beads added), and shaken at room temperature for 15 min. The spore suspension was filtered to remove mycelia (a small wad of fluffy cotton was placed at the bottom of the Erlenmeyer funnel). The spores in the spore suspension were counted under a microscope using a hemocytometer. The spores were then diluted appropriately with sterile physiological saline to adjust the spore count to 1.33 × 10⁻⁶. 7 cells / mL;

[0039] (2) Mutagenesis: Under red light illumination, 1.5 mL of the above spore suspension was placed in a 6 cm diameter petri dish. The petri dishes were placed on a magnetic stirrer and irradiated for 1.0, 1.5, 2.0, 2.5, 3.0, 4.0, and 5.0 mins respectively at a distance of 30 cm from a 15 W UV lamp that had been preheated for 30 min. After the above irradiation treatment, the spore suspension was diluted appropriately, and 0.1 mL was transferred and spread onto PDA agar plates containing 10 g / L sodium deoxycholate. The same procedure was performed to dilute and spread the spore suspension without UV irradiation as a control to calculate the lethality rate. After inoculation, the PDA plates were wrapped in black cloth, inverted, and incubated at 30 °C for 36 h. The colonies on the plates were counted, and the lethality rate was calculated.

[0040] (3) Screening: Colonies with a lethality rate of over 90% on PDA plates were selected and transferred to fresh PDA plates to obtain 45 strains. Each strain was inoculated into fresh culture of PDA plates that had been cultured at 28°C for 80 h, and 10 mL of sterile physiological saline was added. The spores were suspended by stirring with an inoculation loop to obtain the spore liquid of each strain. 2 mL of the spore liquid of each strain was taken and inoculated into 50 mL of enzyme-producing medium. After incubation at 28°C and 180 r / min for 72 h, the fermentation broth was filtered using a Buchner funnel, and the filtrate (i.e., crude enzyme solution) was collected. The cellulase activity of the fermentation filtrate of each strain was first determined. Thirteen strains with enzyme production activity greater than 10% higher than the original strain HQK5 were selected. The spore liquid of these strains was then used to inoculate okra powder for fermentation according to the method in Example 1. Polysaccharides were extracted by ultrasonic water extraction and alcohol precipitation. The polysaccharide extraction yields of the mutant strains fermenting okra and the control are shown in Table 2.

[0041] Table 2. Polysaccharide extraction yield of mutant strain from fermented okra and control strain.

[0042]

[0043] As shown in Table 2, among the 13 mutant strains, strain HQK5-17 exhibited a cellulase activity of 44.5 U / mL during fermentation, which was 31.4% higher than the 33.9 U / mL of the wild-type strain HQK5. After fermenting okra with this strain, the polysaccharide extraction rate was 8.76%, which was 11.9% higher than the 7.83% of the wild-type strain HQK5 and 29.4% higher than the direct extraction control (6.77%). Therefore, strain HQK5-17 was selected in this invention as the strain for improving the polysaccharide extraction rate during okra fermentation.

[0044] The enzyme-producing culture medium consists of: 40 g / L wheat bran, 6 g / L (NH4)2SO4, 4 g / L peptone, 5 g / L KH2PO4, 1 g / L MgSO4·7H2O, and 0.5 g / L CaCl2, with tap water as the solvent and a pH of 6.0. 50 mL of the enzyme-producing culture medium is placed in a 250 mL Erlenmeyer flask, or 100 mL in a 500 mL Erlenmeyer flask. The flask is sealed with eight layers of gauze and sterilized by autoclaving at 121°C for 20 minutes.

[0045] The cellulase activity assay was performed as follows: 1.5 mL of 10 g / L sodium carboxymethyl cellulose solution (pH 6.0, prepared with 0.2 mol / L phosphate buffer) and 0.5 mL of crude enzyme solution were added to 10 mL graduated test tubes. The tubes were incubated in a 50°C water bath for 30 min, then 3 mL of DNS reagent was added, and the mixture was boiled for 5 min. After cooling under running water, deionized water was added to bring the volume to 10 mL, and the mixture was shaken well. A crude enzyme solution inactivated by boiling at 100°C for 10 min was used as a reference. The absorbance (A) was measured at 540 nm using a spectrophotometer.540 ), from the glucose standard curve ( Figure 2 Calculate the glucose concentration in the sample, and then calculate the cellulase activity (U / mL). Cellulase activity is defined as the amount of enzyme required to hydrolyze sodium carboxymethyl cellulose to produce 1 μmol of glucose per minute under conditions of pH 6.0 and 50℃; one unit of enzyme activity (U) is defined as this amount of enzyme.

[0046] Cellulase activity is calculated according to Formula 2.

[0047]

[0048] In Formula 2, C: glucose concentration (μmol / mL) calculated from the standard curve; V1: enzyme reaction system volume, i.e., 2 mL; T: reaction time, i.e., 30 min; V2: crude enzyme solution volume, i.e., 0.5 mL.

[0049] Construction of the glucose standard curve: Add 0, 0.2, 0.4, 0.6, 0.8, 1.0, and 1.2 mL of 1 g / L standard glucose aqueous solution to seven 10-mL graduated test tubes, respectively. Then add 2.0, 1.8, 1.6, 1.4, 1.2, 1.0, and 0.8 mL of pH 6.0, 0.2 mol / L phosphate buffer to each tube, respectively. Add 3.0 mL of DNS solution to each tube. Boil the mixture in a water bath for 5 minutes, cool under running water, and then dilute to 10 mL with deionized water. Shake well and measure A using a spectrophotometer. 540 Plotting glucose concentration on the x-axis, A 540 Plot a standard curve for the ordinate ( Figure 2 ).

[0050] Preparation of DNS reagent: Add 6.3g of 3,5-dinitrosalicylic acid and 262mL of 2mol / L NaOH aqueous solution to 500mL of hot aqueous solution containing 182g of sodium tartrate, then add 5g of redistilled phenol and 5g of sodium sulfite, stir to dissolve, cool, and add deionized water to make up to 1L. Store in a brown bottle and use after 7 days.

[0051] Example 3: Classification and identification of strain HQK5-17

[0052] Strawberry strain HQK5-17 was streaked onto PDA plates and incubated at 28°C for 2 days. Grayish-white, fluffy hyphae grew on the plate surface, radiating from the inoculation point, with irregular, serrated edges. After 3 more days of incubation, the colony front gradually turned grayish-green from the center outwards, with a raised center and white edges; the colony back was brown, with a darker center. Microscopic examination revealed conidiophores exhibiting the characteristic "broom-like" branching of Penicillium, with 1–2 layers of trabeculae. Conidia were spherical to nearly spherical, with smooth surfaces and a diameter of 2.5–3.0 μm. A photograph of HQK5-17 colonies after 5 days of incubation on PDA plates at 28°C is shown below. Figure 3 .

[0053] The rDNA-ITS nucleotide sequence of strain HQK5-17 was determined as shown in SEQ ID NO.1. This sequence was compared with the BLAST sequence from type material in NCBI (National Center for Biotechnology Information, https: / / www.ncbi.nlm.nih.gov) and showed the highest homology (99.78%) with two known typical Penicillium marinum strains (Sequence ID: NR137882.1 and KJ834512.1). Based on the colony morphology and rDNA-ITS nucleotide sequence alignment of strain HQK5-17, the biological classification of strain HQK5-17 can be determined as follows (refer to Mycobank, http: / / www.mycobank.org): Kingdom Fungi, Phylum Ascomycota, Subphylum Pezizomycotina, Class Eurotiomycetes, Subclass Eurotiomycetidae, Order Eurotiales, Family Aspergillaceae, Genus Penicillium, Genus Penicillium marinum.

[0054] The rDNA-ITS nucleotide sequence of the strain HQK5-17 is as follows:

[0055] ACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTTACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCGAACTCTGCCTGAAGATTGTCGTCTGAGTGAAAATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGA ACGCACATTGCGCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTTGGGCCCCGTCCTCCGATTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTTGGAT.

[0056] In summary, strain HQK5 was isolated from the microbial enrichment culture of okra powder. After ultraviolet mutagenesis, strain HQK5-17, namely Penicillium marinum HQK5-17, was obtained through screening. This strain is deposited at the Guangdong Provincial Microbial Culture Collection Center, accession number GDMCC No:63778, deposit date September 10, 2023, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province, 510070, China.

[0057] Example 4: Application of Penicillium HQK5-17 in the extraction of okra polysaccharides

[0058] The following steps can be taken to apply Penicillium HQK5-17 to the extraction of okra polysaccharides:

[0059] (1) PDA plate spores of *Penicillium chrysogenum* HQK5-17, stored at 4℃, were inoculated onto fresh PDA plates and cultured at 28℃ for 80 h. 10 mL of sterile sucrose aqueous solution was added to a petri dish, and the spores were suspended by stirring with an inoculation loop. The spore suspension was transferred to sterile test tubes, and the spore concentration was adjusted to 1.63 × 10⁻⁶ spores with sterile sucrose aqueous solution. 7The concentration of *Penicillium* spores was increased to 20 g / mL to obtain *Penicillium* HQK5-17 spore suspension. The composition and preparation method of the PDA plate culture medium were the same as in Example 1; the concentration of the sterile sucrose aqueous solution was 20 g / L, and it was sterilized by high-pressure steam at 115°C for 15 min.

[0060] (2) 10g of okra powder was placed in a 150-mL Erlenmeyer flask that had been sterilized by dry heat at 160℃ for 2 hours. Then, 30mL of the *Penicillium* HQK5-17 spore solution prepared in step (1) was added (the volume was 3.0mL / g based on the weight of the okra powder), and the mixture was stirred evenly. The Erlenmeyer flask was sealed with 8 layers of gauze and incubated at 28℃ for 60 hours to obtain okra ferment.

[0061] (3) Transfer all the okra ferment from step (2) into a 500-mL beaker, add 400mL of deionized water [material-to-liquid ratio of 1:40 (g:mL)], stir well, and keep warm in a 35℃ water bath for 5 hours. Then, transfer the Erlenmeyer flask into an ultrasonic cleaner at 75℃, and extract with 200W ultrasonic for 50 minutes. Filter the extract while it is still hot using a Buchner funnel. Concentrate all the filtrate under reduced pressure at 60℃ and –0.1Mpa to 25mL (1 / 16 of the original filtrate volume) to obtain okra water extract concentrate.

[0062] (4) Add 100 mL of anhydrous ethanol (4 times the volume of the concentrate, with an ethanol volume fraction of 80%) to all the okra water extract concentrate obtained in step (3). After standing for 14 h at 4 °C, centrifuge at 8000 r / min for 5 min, discard the supernatant, add 15 mL of acetone (1.5 mL / g based on the mass of the raw okra powder) to the centrifuge tube, shake thoroughly, and centrifuge again. Dry the precipitate under vacuum at 50 °C and –0.1 MPa to constant weight to obtain okra polysaccharide extract.

[0063] Following the steps above, 1.27g of polysaccharide extract was obtained from 5g of okra, with a polysaccharide content of 68.6%, resulting in 0.871g of okra polysaccharide and an extraction yield of 8.71%.

[0064] Comparative Example 1: Extraction of okra polysaccharides using conventional water extraction and alcohol precipitation method (compared with Example 4)

[0065] (1) 10g of okra powder was placed in a 500-mL beaker, and 400mL of deionized water was added [the ratio of material to liquid is 1:40 (g:mL)]. After stirring evenly, the mixture was kept warm in a 35℃ water bath for 5 hours. Then, the Erlenmeyer flask was transferred to an ultrasonic cleaner at 75℃ and ultrasonically extracted at 200W for 50 minutes. The mixture was filtered through a Buchner funnel while still hot. All the filtrate was concentrated under reduced pressure at 60℃ and -0.1Mpa to 25mL (1 / 16 of the original filtrate volume) to obtain okra water extract concentrate.

[0066] (2) Add 100 mL of anhydrous ethanol (4 times the volume of the concentrate, with an ethanol volume fraction of 80%) to all the okra water extract concentrate obtained in step (1). After standing for 14 h at 4 °C, centrifuge at 8000 r / min for 5 min, discard the supernatant, add 15 mL of acetone (1.5 mL / g based on the mass of the raw okra powder) to the centrifuge tube, shake thoroughly, and centrifuge again. Dry the precipitate under vacuum at 50 °C and –0.1 MPa to constant weight to obtain okra polysaccharide extract.

[0067] Following the steps above, 1.06g of polysaccharide extract was obtained from 10g of okra, with a polysaccharide content of 64.3%, resulting in 0.682g of okra polysaccharide and an extraction yield of 6.82%.

[0068] Comparing the results of Example 4 and Comparative Example 1, it can be seen that: before ultrasonic water extraction of okra polysaccharides, the addition of Penicillium HQK5-17 fermentation pretreatment increased the polysaccharide extraction yield from 6.82% of direct extraction to 8.71%, an increase of 27.7%.

[0069] Example 5: Application of Penicillium HQK5-17 in the extraction of okra polysaccharides

[0070] The following steps can be taken to apply Penicillium HQK5-17 to the extraction of okra polysaccharides:

[0071] (1) PDA plate spores of *Penicillium chrysogenum* HQK5-17, stored at 4℃, were inoculated onto fresh PDA plates and cultured at 30℃ for 76 h. 10 mL of sterile sucrose aqueous solution was added to the culture dish, and the spores were suspended by stirring with an inoculation loop. The spore suspension was transferred to sterile test tubes, and the spore concentration was adjusted to 1.48 × 10⁻⁶ using sterile sucrose aqueous solution. 7 The concentration of *Penicillium* spores was increased to 25 g / mL to obtain *Penicillium* HQK5-17 spore suspension. The composition and preparation method of the PDA plate culture medium were the same as in Example 1; the concentration of the sterile sucrose aqueous solution was 25 g / L, and it was sterilized by high-pressure steam at 115°C for 15 min.

[0072] (2) 10g of okra powder was placed in a 150-mL Erlenmeyer flask that had been sterilized by dry heat at 160℃ for 2 hours. Then, 35mL of the *Penicillium* HQK5-17 spore solution prepared in step (1) was added (the volume was 3.5mL / g based on the weight of the okra powder), and the mixture was stirred evenly. The Erlenmeyer flask was sealed with 8 layers of gauze and incubated at 30℃ for 58 hours to obtain okra ferment.

[0073] (3) Transfer all the okra ferment from step (2) into a 500-mL beaker, add 375mL of deionized water [material-to-liquid ratio of 1:37.5 (g:mL)], stir well, and keep warm in a 40℃ water bath for 4.5h. Then, transfer the Erlenmeyer flask into an ultrasonic cleaner at 80℃, and extract with 200W ultrasonic for 45min. Filter the extract while it is still hot using a Buchner funnel, and concentrate all the filtrate under reduced pressure at 60℃ and –0.1Mpa to 25mL (1 / 15 of the original filtrate volume) to obtain okra water extract concentrate.

[0074] (4) Add 75 mL of anhydrous ethanol (3 times the volume of the concentrate, the ethanol volume fraction of the system is 75%) to all the okra water extract concentrate obtained in step (3), let it stand at 4℃ for 16 h, centrifuge at 8000 r / min for 10 min, discard the supernatant, add 20 mL of acetone to the centrifuge tube, shake it thoroughly and centrifuge it again, and dry the precipitate at 50℃ and -0.1 MPa under vacuum until constant weight to obtain okra polysaccharide extract.

[0075] Following the steps above, 1.32g of polysaccharide extract was obtained from 10g of okra, with a polysaccharide content of 67.7%, resulting in 0.894g of okra polysaccharide and an extraction yield of 8.94%.

[0076] Comparative Example 2: Extraction of okra polysaccharides using conventional water extraction and alcohol precipitation method (compared with Example 5)

[0077] (1) 10g of okra powder was placed in a 500-mL beaker, and 375mL of deionized water was added [the ratio of material to liquid was 1:37.5 (g:mL)]. After stirring evenly, the mixture was kept warm in a 40℃ water bath for 4.5h. Then, the Erlenmeyer flask was transferred to an ultrasonic cleaner at 80℃ and ultrasonically extracted at 200W for 45min. The mixture was filtered through a Buchner funnel while hot, and all the filtrate was concentrated under reduced pressure at 60℃ and –0.1Mpa to 25mL (1 / 15 of the original filtrate volume) to obtain okra water extract concentrate.

[0078] (2) Add 75 mL of anhydrous ethanol (3 times the volume of the concentrate, the ethanol volume fraction of the system is 75%) to all the okra water extract concentrate obtained in step (1), let it stand at 4℃ for 16 h, centrifuge at 8000 r / min for 10 min, discard the supernatant, add 20 mL of acetone to the centrifuge tube, shake it thoroughly and centrifuge it again, and dry the precipitate at 50℃ and -0.1 MPa under vacuum until constant weight to obtain okra polysaccharide extract.

[0079] Following the steps above, 1.08g of polysaccharide extract was obtained from 10g of okra, with a polysaccharide content of 63.4%, yielding 0.685g of okra polysaccharide and an extraction yield of 6.85%.

[0080] Comparing the results of Example 5 and Comparative Example 2, it can be seen that: before ultrasonic water extraction of okra polysaccharides, the addition of Penicillium HQK5-17 fermentation pretreatment increased the polysaccharide extraction yield from 6.85% of direct extraction to 8.94%, an increase of 30.5%.

[0081] Example 6: Application of Penicillium HQK5-17 in the extraction of okra polysaccharides

[0082] The following steps can be taken to apply Penicillium HQK5-17 to the extraction of okra polysaccharides:

[0083] (1) PDA plate spores of *Penicillium chrysogenum* HQK5-17 stored at 4℃ were inoculated onto fresh PDA plates and cultured at 30℃ for 72 h. 10 mL of sterile sucrose aqueous solution was added to the culture dish, and the spores were suspended by stirring with an inoculation loop. The spore suspension was transferred to sterile test tubes, and the spore concentration was adjusted to 1.55 × 10⁻⁶ using sterile sucrose aqueous solution. 7 The PDA plate culture medium composition and preparation method are the same as in Example 1; the concentration of the sterile sucrose aqueous solution is 30 g / L, and it is sterilized by high-pressure steam at 115°C for 15 min.

[0084] (2) 10g of okra powder was placed in a 150-mL Erlenmeyer flask that had been sterilized by dry heat at 160℃ for 2 hours. Then, 40mL of the *Penicillium* HQK5-17 spore solution prepared in step (1) was added (the volume was 4mL / g based on the mass of the okra powder), and the mixture was stirred evenly. The Erlenmeyer flask was sealed with 8 layers of gauze and incubated at 30℃ for 56 hours to obtain okra ferment.

[0085] (3) Transfer all the okra ferment from step (2) into a 500-mL beaker, add 350 g of deionized water [material-to-liquid ratio of 1:35 (g:mL)], stir well, and keep warm in a 40℃ water bath for 4 hours. Then, transfer the Erlenmeyer flask into an ultrasonic cleaner at 80℃, and extract with 200W ultrasonic for 40 minutes. Filter the extract while it is still hot using a Buchner funnel. Concentrate all the filtrate under reduced pressure at 60℃ and –0.1 MPa to 25 mL (1 / 14 of the original filtrate volume) to obtain okra water extract concentrate.

[0086] (4) Add 75 mL of anhydrous ethanol (3 times the volume of the concentrate, with an ethanol volume fraction of 75%) to all the okra water extract concentrate obtained in step (3). After standing at 4°C for 18 h, centrifuge at 8000 r / min for 10 min and discard the supernatant. Add 20 mL of acetone to the centrifuge tube, shake thoroughly, and centrifuge again. Dry the precipitate under vacuum at 50°C and –0.1 MPa to constant weight to obtain okra polysaccharide extract.

[0087] Following the steps above, 1.27g of polysaccharide extract was obtained from 10g of okra, with a polysaccharide content of 68.8%, resulting in 0.874g of okra polysaccharide and an extraction yield of 8.74%.

[0088] Comparative Example 3: Extraction of okra polysaccharides using conventional water extraction and alcohol precipitation method (compared with Example 6)

[0089] (1) 10g of okra powder was placed in a 500-mL beaker, and 350mL of deionized water was added [the ratio of material to liquid was 1:35 (g:mL)]. After stirring evenly, the mixture was kept warm in a 40℃ water bath for 4 hours. Then, the Erlenmeyer flask was transferred to an ultrasonic cleaner at 80℃ and ultrasonically extracted at 200W for 40 minutes. The mixture was filtered through a Buchner funnel while still hot. All the filtrate was concentrated under reduced pressure at 60℃ and –0.1Mpa to 25mL (1 / 14 of the original filtrate volume) to obtain okra water extract concentrate.

[0090] (2) Add 75 mL of anhydrous ethanol (3 times the volume of the concentrate, with an ethanol volume fraction of 75%) to all the okra water extract concentrate obtained in step (1). After standing at 4°C for 18 h, centrifuge at 8000 r / min for 10 min and discard the supernatant. Add 20 mL of acetone to the centrifuge tube, shake thoroughly, and centrifuge again. Dry the precipitate under vacuum at 50°C and –0.1 MPa to constant weight to obtain okra polysaccharide extract.

[0091] Following the steps above, 1.09g of polysaccharide extract was obtained from 10g of okra, with a polysaccharide content of 62.9%, resulting in 0.686g of okra polysaccharide and an extraction yield of 6.86%.

[0092] Comparing the results of Example 6 and Comparative Example 3, it can be seen that: before ultrasonic water extraction of okra polysaccharides, the addition of Penicillium HQK5-17 fermentation pretreatment increased the polysaccharide extraction yield from 6.86% of direct extraction to 8.74%, an increase of 27.4%.

[0093] Unless otherwise specified, the raw materials, instruments and equipment used in this invention are all commonly used in the field; unless otherwise specified, the methods used in this invention are all conventional methods in the field.

[0094] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, alterations, amplifications, and equivalent transformations made to the above embodiments based on the technical essence of the present invention shall still fall within the protection scope of the present invention.

Claims

1. A method for extracting okra polysaccharides using microbial fermentation-assisted extraction, characterized in that, The method is as follows: (1) Add the spore liquid of Penicillium marinum HQK5-17 to okra powder, stir evenly, and ferment at 28–30℃ for 56–60h to obtain okra fermentation product; the Penicillium marinum HQK5-17 is preserved at Guangdong Provincial Microbial Culture Collection Center, preservation number GDMCC No:63778; (2) Add deionized water to okra fermentation product, stir evenly, and keep warm at 35–40℃ for 4–5h, extract by ultrasonic water extraction, filter, concentrate the filtrate, and obtain okra water extract concentrate; (3) Add ethanol to okra water extract concentrate to precipitate polysaccharides, wash the precipitate with acetone, and vacuum dry to obtain okra polysaccharide.

2. The method for extracting okra polysaccharides using microbial fermentation as described in claim 1, characterized in that, The okra powder mentioned in step (1) is the young pods of the plant Abelmoschus esculentus, which are washed, dried at 85°C, and then pulverized through a 60-mesh sieve.

3. The method for extracting okra polysaccharides using microbial fermentation as described in claim 1, characterized in that, The preparation method of the *Penicillium* HQK5-17 spore solution in step (1) is as follows: *Penicillium* HQK5-17 spores preserved at low temperature are inoculated on PDA plate medium and cultured at 28–30℃ for 72–80h. Sterile sucrose aqueous solution is added to the culture, and the spores are suspended by stirring with an inoculation loop to obtain the spore solution; the concentration of sucrose in the sterile sucrose aqueous solution is 20–30g / L.

4. The method for extracting okra polysaccharides using microbial fermentation as described in claim 1, characterized in that, Step (1) The spore concentration is 1×10 7 –2×10 7 per mL.

5. The method for extracting okra polysaccharides using microbial fermentation as described in claim 1, characterized in that, The volume of the spore liquid of *Penicillium spores* HQK5-17 used in step (1) is 3–4 mL / g based on the mass of okra powder.

6. The method for extracting okra polysaccharides using microbial fermentation as described in claim 1, characterized in that, Step (2) The preparation method of okra water extract concentrate is as follows: Add deionized water to okra fermentation product, stir evenly, keep warm at 35-40℃ for 4-5 hours, then transfer to an ultrasonic cleaner at 75-80℃, and extract with ultrasonic 200W for 40-50 minutes. After ultrasonic water extraction, filter with a Buchner funnel while hot, and concentrate the filtrate under reduced pressure at 60℃ and -0.1Mpa to 1 / 16-1 / 14 of the original volume to obtain okra water extract concentrate. The volume of deionized water added is 35-40mL / g based on the mass of okra powder before fermentation.

7. The method for extracting okra polysaccharides using microbial fermentation as described in claim 1, characterized in that, The preparation method of okra polysaccharide in step (3) is as follows: Add 3-4 times the volume of anhydrous ethanol to the okra water extract concentrate to make the ethanol volume fraction of the system reach 75%-80%. After standing at 4℃ for 14-18h, centrifuge at 8000r / min for 5-10min, collect the precipitate, wash the precipitate once with acetone at 1.5-2.0mL / g based on the mass of the raw okra powder, centrifuge again, and dry the precipitate under vacuum at 50℃ and -0.1Mpa to constant weight to obtain okra polysaccharide.

Images