Molecular marker loci related to milk production traits in dairy cows and their applications

Abstract

The present invention provides a molecular marker site related to milk production traits on chromosome 19 of dairy cows, wherein the molecular marker site is a SNP mutation of C>T at site 62955914 on chromosome 19 of dairy cows. By optimizing the dominant allele of the above marker, the present invention can increase the dominant allele frequency from generation to generation, improve the milk production traits of dairy cows, accelerate the genetic improvement process of dairy cows, and thus effectively improve the economic benefits of dairy cow breeding.

Description

[0001] Application technology

[0002] The invention belongs to the field of biotechnology, and in particular relates to a trait related to milk production in dairy cows on dairy cow chromosomes. Background Art

[0003] In dairy cow breeding, because milk production traits have extremely high economic value, the importance of genetic improvement work related to them is self-evident. The accuracy of QTL positioning has a profound impact on breeders' search for genes or regions that affect milk production traits. Accurate QTL positioning can effectively improve the accuracy of selection, provide a scientific basis for breeding work, and accelerate the breeding process. Therefore, it is feasible to improve the milk production traits of resource cattle using genetic means. In the past ten years, there have been many reports on the genetic basis of dairy cow milk production traits at home and abroad. So far, only a few genes are internationally recognized as major effect genes affecting milk production traits. The larger QTL confidence interval limits the efficiency of gene identification. The in-depth mining of functional genes for dairy cow milk production traits has just started, and it is urgent to seek new strategies for the identification of major effect genes of quantitative traits. Identifying new molecular markers that affect milk production traits and adding those with significant effects to marker assisted selection (MAS) and genomic selection (GS) can accelerate the genetic improvement of dairy cow populations, thereby improving the production performance of economic traits and increasing the economic benefits of breeding enterprises. Summary of the invention

[0004] In view of the problems existing in the prior art, the present invention provides molecular markers that are significantly correlated with the milk production traits of dairy cows and are identified through genotyping and correlation analysis strategies, and use them in molecular marker-assisted selection and genomic selection to select favorable genotypes for breeding, thereby increasing the gene frequency of dominant alleles from generation to generation, which can accelerate the process of genetic breeding and improvement of dairy cows and bring huge economic benefits to local dairy cow farming.

[0005] The primary purpose is to determine the SNP molecular markers that affect the milk production traits of dairy cows. The molecular markers are located on chromosome 19 (NC_037346.1) of the dairy cow genome reference sequence.

[0006] The SNP site of the molecular marker corresponds to the C>T mutation at position 62955914 on chromosome 19 (NC_037346.1) of the ARS-UCD1.2 genome of dairy cows.

[0007] The molecular marker is located in the following sequence:

[0008] 5'-CTTGGGTTCAGAGCATTTTGGTCCAGGCAGCAAGCAGGCATGTGATGCTGGCCTGCAACGCCTCGAGCACACACCAGGTGCAGCGACTGTGCCTTTAACAAGCTTGTTATTTGGCTGTGCCGGGTCTTAGTTGCGGCCCAGGGGCTCTCGATCTGGGG ATCTGGGCGCAGAGCAGCCAGAGGGCGCCCACCCACCCCAGCGTTGTTCCAGTGGACCTGTTTGCTCCTGTCTTTTTTCCGTTGTACTGATCGTAGCGCGTGTTTCAGGCCTCAGTGTGCTGGTCTGACCATCGCACAGTGTGAAAGGGCTCCCGCAGCCGA [C / T] GTCGCTCAGCCGTCACCTCGCATCACCTTTTTTACTTTGGTGAGAGCGCTCCGGCTCGGCTGTCAGCGGGGATCGGTACACAGTCCGGGACTGCACGGCAGCCCCCGTGTTGCCCTGTCCCACGCGGGAGCCTCTTTCTCCCCCGCCTCTA GCTGATGACCAAGCACCCCGGGAAGCGGCTGGGCTGCGGGCCCGAGGGCGAGCGCGACGTGCGGGAGCATGCCTTCTTCCGGAGGATCGACTGGGAGAAGCTGGAGAACCGTGAGATCCAGCCACCCTTCAAGCCCAAAGTGGTGAGTT-3'

[0009] Another object of the present invention is to provide a primer and probe set for detecting the above-mentioned molecular marker, characterized in that the base sequence of the primer and probe set is as follows:

[0010] SEQ ID NO.1: 5'-ACGTTGATGAAAAGGTGATGCGAGGTGAC-3'

[0011] SEQ ID NO.2: 5'-ACGTTGGATGACCATCGCAGTGTGAAAG-3'

[0012] SEQ ID NO.3: 5'-TGACGGCTGAGCGAC-3'

[0013] Another object of the present invention is to provide a kit for detecting the above-mentioned molecular markers, wherein the kit comprises the above-mentioned primer and probe set.

[0014] Another object of the present invention is to provide the use of the above molecular markers in screening dairy cows with excellent milk production traits. Specifically, the genotype of the 62955914th base site on chromosome 19 (NC_037346.1) of the dairy cow genome ARS-UCD1.2 is detected, and individuals with heterozygous TC type at this site are eliminated.

[0015] In a preferred embodiment, individuals with homozygous TT or CC type at locus 62955914 on chromosome 19 (NC_037346.1) of dairy cows are retained.

[0016] In another preferred embodiment, individuals with homozygous TT type at locus 62955914 on chromosome 19 (NC_037346.1) of dairy cows are retained.

[0017] Another object of the present invention is to provide an application of the above-mentioned time-of-flight mass spectrometry primer and probe set or detection kit in identifying the genotype of a locus related to the milk production trait of dairy cows. Specifically, the above-mentioned primer and probe set or kit is used to detect the genotype of the 62955914th locus on chromosome 19 (NC_037346.1) of dairy cows, and individuals with heterozygous TC type at this locus are eliminated.

[0018] In a preferred embodiment, individuals with homozygous TT or CC type at locus 62955914 on chromosome 19 (NC_037346.1) of dairy cows are retained.

[0019] In another preferred embodiment, individuals with homozygous TT type at locus 62955914 on chromosome 19 (NC_037346.1) of dairy cows are retained.

[0020] Furthermore, the primer and probe set or detection kit is used in dairy cow genomic selection breeding. Specifically, the primer and probe set or kit is used to detect the genotype of the 62955914th site on chromosome 19 (NC_037346.1) of dairy cows, and individuals with heterozygous TC type at this site are eliminated.

[0021] In a preferred embodiment, individuals with homozygous TT or CC type at locus 62955914 on chromosome 19 (NC_037346.1) of dairy cows are retained.

[0022] In another preferred embodiment, individuals with homozygous TT type at locus 62955914 on chromosome 19 (NC_037346.1) of dairy cows are retained.

[0023] Furthermore, the primer and probe set or detection kit is used to improve the milk production traits of dairy cows. Specifically, the primer and probe set or kit is used to detect the genotype of the 62955914th site on chromosome 19 (NC_037346.1) of dairy cows, and individuals with heterozygous TC type at this site are eliminated.

[0024] In a preferred embodiment, individuals with homozygous TT or CC type at locus 62955914 on chromosome 19 (NC_037346.1) of dairy cows are retained.

[0025] In another preferred embodiment, individuals with homozygous TT type at locus 62955914 on chromosome 19 (NC_037346.1) of dairy cows are retained.

[0026] Another object of the present invention is to provide a method for genetic improvement of dairy cows, the method comprising: determining the genotype of the molecular marker loci related to the milk production trait of the breeding dairy cows in the core dairy cow resource group, and making corresponding selections according to the genotypes of the molecular markers: eliminating individuals with heterozygous TC type at the 62955914th locus on chromosome 19 (NC_037346.1) of the dairy cow resource group, so as to increase the homozygous genotype frequency of the locus from generation to generation, thereby improving the milk production quality of the offspring dairy cows. The dairy cow group includes Holstein cows and their synthetic lines.

[0027] In a preferred embodiment, individuals with homozygous TT or CC type at locus 62955914 on chromosome 19 (NC_037346.1) of dairy cows are retained.

[0028] In another preferred embodiment, individuals with homozygous TT type at locus 62955914 on chromosome 19 (NC_037346.1) of dairy cows are retained.

[0029] The specific steps include:

[0030] (1) Extracting genomic DNA from the cow to be tested;

[0031] (2) using the aforementioned primer and probe set or detection kit to detect the genotype of the dairy cow to be tested;

[0032] (3) Based on the test results, determine the genotype of the molecular marker at the 62955914th site on chromosome 19 (NC_037346.1) of the cow reference genome ARS-UCD1.2

[0033] (4) Eliminate individuals with heterozygous TC type at locus 62955914 on chromosome 19 (NC_037346.1).

[0034] In a preferred embodiment, individuals with homozygous TT or CC type at locus 62955914 on chromosome 19 (NC_037346.1) of dairy cows are retained.

[0035] In another preferred embodiment, individuals with homozygous TT type at locus 62955914 on chromosome 19 (NC_037346.1) of dairy cows are retained.

[0036] The above-mentioned dairy cow milk production traits include: one or more of the following traits: milk fat rate, milk protein rate, 305-day milk fat amount, 305-day milk protein amount, 305-day milk production amount, etc.

[0037] Compared with the prior art, the present invention has the following advantages and effects:

[0038] First, new molecular markers related to milk production traits in dairy cows were identified, and corresponding mass spectrometry detection primers and probe sets were developed.

[0039] Second, the molecular markers determined by the present invention are applied to the genetic improvement of excellent milk production traits of dairy cows, which can improve the milk production quality of future dairy cows and thus increase the market competitiveness of breeding enterprises. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] The method of the present invention and its beneficial effects are described in detail below in conjunction with the accompanying drawings and specific implementation methods.

[0041] Figure 1 This is the result of mixed pool PCR sequencing of the Holstein cow 19:g.62955914C>T site.

[0042] Figure 2 The PCR sequencing results were compared with the corresponding region of chromosome 19 of the reference genome ARS-UCD1.2.

[0043] Figure 3 Typing results of locus 19:g.62955914C>T on chromosome 19 of the Holstein cow reference genome ARS-UCD1.2. DETAILED DESCRIPTION

[0044] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0045] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by ordinary technicians in the technical field to which this application belongs.

[0046] Example 1 Detection of variant sites

[0047] 1. Experimental animals and test characteristics

[0048] The experimental group consisted of 1,114 Chinese Holstein cows from the Pingjibao Dairy Farm No. 2 of the Ningxia Helanshan Dairy Company. The feeding conditions and environment of all cows remained basically unchanged. The birth years of this experimental group were distributed between 2012 and 2021. The production performance records of the experimental cows included individual number, individual date of birth, farm number, father number, mother number, grandfather number, calving date, parity, 305-day milk yield (MY305), 305-day milk fat yield (FY305), 305-day milk protein yield (PY305), fat percentage (FP), and protein percentage (PP). Among them, MY305 is the milk yield trait, and FY305, PY305, FP, and PP are four milk component traits, which are collectively used as the five milk production traits in this study.

[0049] 2. Extraction of blood DNA

[0050] Blood was collected from the root of the tail, and DNA was extracted from the blood of dairy cows using a DNA extraction kit. The quality of DNA extraction was tested by agarose gel electrophoresis, and the concentration of the extracted DNA was tested by a micro-nucleic acid protein detector. 40 qualified DNA samples were randomly selected, and 1uL of each was mixed into a 1.5mL centrifuge tube to construct a DNA mixing pool, which was stored at -20℃ for subsequent experiments.

[0051] 3. Primer design and PCR amplification

[0052] The bovine genome sequence published on NCBI (https: / / www.ncbi.nlm.nih.gov / ) was used to design amplification primers (Table 1) using Primer5.0 software and sent to Shaanxi Qingke Biotechnology Co., Ltd. for synthesis.

[0053] Table 1 Amplification primer sequence information

[0054]

[0055] The gene amplification system was 50 μL: 6 μL cDNA sample, 2 μL upstream and downstream primers, 25 μL Taq PCR Master Mix, 15 μL ddH2O. The PCR amplification program was: 95°C pre-denaturation for 5 min; 95°C denaturation for 15 s, annealing for 40 s, 72°C extension for 1 min, 35 cycles in total; 72°C extension for 5 min, 4°C storage. The product was tested by 1% agarose gel electrophoresis and sent to Shaanxi Qingke Biotechnology Co., Ltd. for sequencing.

[0056] 4. Sequencing results and screening of polymorphic sites

[0057] The amplified samples that met expectations were sent to Shaanxi Qingke Biotechnology Co., Ltd. for sequencing. The results were compared with the original sequence using SnapGene and compared with the sequencing peak graph to find the variant sites in the dairy cow population (see Figure 1 , Figure 2 ).

[0058] Example 2 Genotyping

[0059] Combined with the sequence information of the SNP site, the software MassARRAY Assay Design SUITE V2.0 was used to design the PCR reaction and single-base extension primers. The DNA sequence of the primers is as follows:

[0060] Table 2 Primers and probes for genotyping by flight mass spectrometry of mutation sites

[0061]

[0062] The detected SNP loci and the complete blood of the dairy cow group were submitted to Compson for SNP time-of-flight mass spectrometry for gene detection and typing ( Figure 3 ). The primers and probes are combined to prepare a detection kit.

[0063] Example 3 Association analysis between genotype and milk production traits

[0064] Table 3 Association analysis between mutation site 19: g.62664044_62664049 and milk production traits

[0065]

[0066] Note: P value indicates the degree of association between each SNP and milk production traits; different superscript letters indicate the differences between genotypes after multiple comparisons (uppercase letters are used when P<0.01, and lowercase letters are used when P<0.05)

[0067] As can be seen from the table, in Holstein cows 19:g.62955914C>T has a very significant effect on milk fat rate, milk protein rate, 305-day milk fat amount and 305-day milk protein amount (P<0.01), and the dominant genotype is the homozygous TT type.

[0068] Example 3 Method for genetic improvement of milk production traits of dairy cows

[0069] A method for genetically improving milk production traits of dairy cows, wherein the dairy cow population includes Holstein cows and synthetic lines thereof, and the method comprises the following steps:

[0070] 1) Determine the genotype of the molecular marker loci related to the milk production traits of the core group of dairy cows

[0071] 2) making corresponding selections according to the genotypes of the molecular markers: eliminating individuals with heterozygous TC type at locus 62955914 on chromosome 19 (NC_037346.1) of the core group of dairy cow resources, so as to increase the frequency of heterozygous genotypes at this locus from generation to generation, thereby improving the milk production quality of future dairy cows.

[0072] Wherein step 1 comprises the following steps:

[0073] 1.1) Extracting genomic DNA from the cow to be tested;

[0074] 1.2) Detecting the genotype of the dairy cow to be tested using the aforementioned primer and probe set or detection kit;

[0075] 1.3) Based on the test results, determine the genotype of the molecular marker at site 62955914 on chromosome 19 (NC_037346.1) of the reference genome ARS-UCD1.2 of the tested dairy cow

[0076] In a preferred embodiment, individuals with homozygous TT or CC type at locus 62955914 on chromosome 19 (NC_037346.1) of dairy cows are retained.

[0077] In another preferred embodiment, individuals with homozygous TT type at locus 62955914 on chromosome 19 (NC_037346.1) of dairy cows are retained.

[0078] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to the above embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for improving the milk production traits of Chinese Holstein cows or their synthetic lines, characterized in that: The method comprises the following steps: detecting the genotype of the 62955914th site on chromosome 19 of the ARS-UCD1.2 genome of dairy cows, and eliminating individuals with heterozygous TC genotype at the site; the milk production traits comprise: one or more of milk fat rate, milk protein rate, 305-day milk fat amount, and 305-day milk protein amount.

2. The method according to claim 1, characterized in that The method for detecting the genotype of the 62955914th site on chromosome 19 of the ARS-UCD1.2 genome of dairy cows comprises the following steps: (1) Extracting genomic DNA from the dairy cow resource population to be tested; (2) Using a primer and a probe set to detect the genotype of the dairy cow to be tested; the base sequence of the primer and the probe set is as follows: SEQ ID NO.1: ACGTTGGATGAAAAGGTGATGCGAGGTGAC SEQ ID NO.2: ACGTTGGATGACCATCGCAGTGTGAAAG SEQ ID NO.3: TGACGGCTGAGCGAC; (3) Based on the test results, the genotype of locus 62955914 on chromosome 19 of the dairy cow ARS-UCD1.2 genome was determined.

3. Application of SNP loci in improving milk production traits of Chinese Holstein cows or their synthetic lines, wherein the milk production traits include: One or more of milk fat rate, milk protein rate, 305-day milk fat amount, 305-day milk protein amount, the SNP site corresponds to the C>T mutation at position 62955914 on chromosome 19 of the bovine ARS-UCD1.2 genome; wherein the milk production trait index of individuals with genotype TT or CC is higher than that of individuals with genotype TC.

4. Use of primers and probe sets in improving the milk production traits of Chinese Holstein cows or their synthetic lines, wherein the milk production traits include: One or more of milk fat rate, milk protein rate, 305-day milk fat amount, and 305-day milk protein amount, the primer and probe set is used to detect the C>T mutation at position 62955914 on chromosome 19 of the bovine ARS-UCD1.2 genome, wherein the milk production trait index of individuals with genotypes of TT or CC is higher than that of individuals with genotypes of TC; the base sequence of the primer and probe set is as follows: SEQ ID NO.1: ACGTTGGATGAAAAGGTGATGCGAGGTGAC, SEQ ID NO.2: ACGTTGGATGACCATCGCACAGTGTGAAAG, SEQ ID NO.3: TGACGGCTGAGCGAC.

Images